ID: 1128145400

View in Genome Browser
Species Human (GRCh38)
Location 15:65329899-65329921
Sequence GTTTGGGAGTGCTTCAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128145400_1128145411 28 Left 1128145400 15:65329899-65329921 CCAGGTCTGAAGCACTCCCAAAC 0: 1
1: 0
2: 1
3: 14
4: 119
Right 1128145411 15:65329950-65329972 CAGCTGCTCCCACTCCCAAGTGG 0: 1
1: 1
2: 6
3: 28
4: 264
1128145400_1128145401 -10 Left 1128145400 15:65329899-65329921 CCAGGTCTGAAGCACTCCCAAAC 0: 1
1: 0
2: 1
3: 14
4: 119
Right 1128145401 15:65329912-65329934 ACTCCCAAACACCCAGCCTCTGG 0: 1
1: 0
2: 0
3: 37
4: 545
1128145400_1128145402 -9 Left 1128145400 15:65329899-65329921 CCAGGTCTGAAGCACTCCCAAAC 0: 1
1: 0
2: 1
3: 14
4: 119
Right 1128145402 15:65329913-65329935 CTCCCAAACACCCAGCCTCTGGG 0: 1
1: 0
2: 2
3: 21
4: 304
1128145400_1128145403 -8 Left 1128145400 15:65329899-65329921 CCAGGTCTGAAGCACTCCCAAAC 0: 1
1: 0
2: 1
3: 14
4: 119
Right 1128145403 15:65329914-65329936 TCCCAAACACCCAGCCTCTGGGG 0: 1
1: 0
2: 1
3: 34
4: 329
1128145400_1128145412 29 Left 1128145400 15:65329899-65329921 CCAGGTCTGAAGCACTCCCAAAC 0: 1
1: 0
2: 1
3: 14
4: 119
Right 1128145412 15:65329951-65329973 AGCTGCTCCCACTCCCAAGTGGG 0: 1
1: 0
2: 2
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128145400 Original CRISPR GTTTGGGAGTGCTTCAGACC TGG (reversed) Intronic
908062246 1:60363905-60363927 GTATTGGAGAGCTTCAGGCCAGG + Intergenic
908457463 1:64318285-64318307 CTTTGGGGGTGCTGAAGACCAGG + Intergenic
908651177 1:66334882-66334904 CTTTGGGATTGCTTGAGCCCAGG + Intronic
909082306 1:71127298-71127320 GCTTTGGAGTGCCTCAGCCCAGG + Intergenic
909131735 1:71745618-71745640 TTTTGGGAAAGTTTCAGACCAGG + Intronic
915871350 1:159562870-159562892 GTTTGTGAATGCTGCAGGCCTGG + Intergenic
917765676 1:178214025-178214047 CTTTGGGATTGCTTGAGGCCAGG + Intronic
918005810 1:180541187-180541209 GTTTGTGAGTGTGTCAGGCCAGG - Intergenic
919483925 1:198122640-198122662 GTTTTGGAGTCATACAGACCTGG - Intergenic
919777632 1:201204623-201204645 GTTTGGGAGTCAGCCAGACCTGG + Intronic
924772771 1:247090746-247090768 GTCTGGGAGTGCTGCAGTCACGG - Intergenic
1064676320 10:17763818-17763840 GTTTTGGAGTCCTCAAGACCTGG + Intronic
1073487094 10:103826374-103826396 GTTTTGGAGTCCAACAGACCTGG - Intronic
1075439685 10:122469784-122469806 GTTTGGGAGTGAAACAGACATGG - Intronic
1078012097 11:7580277-7580299 GATGGGAAGTGCTGCAGACCTGG - Intronic
1078017288 11:7625729-7625751 ATTTGGCAGTCCTTCTGACCTGG + Intronic
1080918986 11:36689674-36689696 GTTTGGAAATGCTCCATACCAGG - Intergenic
1084498352 11:69519139-69519161 GTCAGGGATGGCTTCAGACCAGG - Intergenic
1087595448 11:100248315-100248337 GTTTGGGACTGCTTGAGGCCAGG + Intronic
1089534296 11:119151008-119151030 GGTTTGGGGTGCTTCAGAGCAGG + Intronic
1090884353 11:130862596-130862618 GTTCCTGAGTGCTTCAAACCGGG - Intergenic
1091345815 11:134853240-134853262 GCTGGGGAGAGCTTCAGGCCAGG + Intergenic
1095773048 12:45983715-45983737 GTTTAGGAGTCAGTCAGACCTGG - Intronic
1096674036 12:53217036-53217058 GTTGGGGCGGGCTTCTGACCAGG - Intronic
1097274964 12:57806923-57806945 GCTTGGTAGTGCTTCAGCCAGGG + Intronic
1101973660 12:109336071-109336093 GATTGGGATTGCTTGAGCCCAGG - Intergenic
1103806688 12:123579319-123579341 CTTTGGGACTGCTTGAGCCCAGG + Intergenic
1105381766 13:19893880-19893902 GCTTGGGAGAGCTTGAGCCCAGG - Intergenic
1105805658 13:23950431-23950453 GTCTGGGTGTGCTGCAGGCCAGG + Intergenic
1106233892 13:27845158-27845180 CTTTTGGAGTTCTTCAGGCCTGG + Intergenic
1114903437 14:27096249-27096271 GTTGGGGAGTTCTTCAGTCATGG - Intergenic
1118657769 14:67971144-67971166 GCTCTGGAGTGCTTCAGACCAGG + Intronic
1121860573 14:97313958-97313980 TTTTGGAATTGCTGCAGACCAGG + Intergenic
1122325573 14:100879247-100879269 GTTAGGGACTGCTTGAGACCAGG + Intergenic
1125838038 15:42771266-42771288 GTTAAGGAATGCTTCAGGCCGGG - Intronic
1127792516 15:62410935-62410957 GTTTGGGAGTCTTTTAAACCAGG + Intronic
1128140103 15:65293659-65293681 TTGTGGGATTGCTTAAGACCAGG + Intronic
1128145400 15:65329899-65329921 GTTTGGGAGTGCTTCAGACCTGG - Intronic
1128697526 15:69779784-69779806 TTTTGGAAGTGCTTCAGGCCGGG + Intergenic
1129242639 15:74260666-74260688 GCTTGGGAATGATTCAGAGCTGG - Intronic
1130685187 15:86031056-86031078 ATTTTGGAGTCATTCAGACCTGG + Intergenic
1133936085 16:10270507-10270529 GTTTGGGAGTGAATCCAACCAGG + Intergenic
1134073109 16:11272839-11272861 GCTTGGGAGTTCAGCAGACCTGG - Intronic
1137581402 16:49635746-49635768 GTTTGAGAGTGCCGAAGACCTGG - Exonic
1139334961 16:66225303-66225325 GTTTGGGATTCCCGCAGACCCGG + Intergenic
1139349325 16:66325463-66325485 CTGTGAGAGAGCTTCAGACCAGG + Intergenic
1141220152 16:82061970-82061992 GTTTGGGAGTTCTTCAGGCCAGG - Intronic
1142065918 16:88062712-88062734 GTTTGGAAATGCCTCAGACTGGG + Intronic
1144632646 17:16881906-16881928 GTGTGGGATTGCTGCAGCCCTGG - Intergenic
1145058388 17:19717484-19717506 TTTTGGGTGTGGTTCAGCCCAGG + Intronic
1147385812 17:40081341-40081363 GCTTAGGATTGCTTGAGACCAGG - Intronic
1149077031 17:52607762-52607784 GTTTGTAAGTGTTTGAGACCGGG + Intergenic
1150313919 17:64152823-64152845 GTTTGGAAGTGCTTCTGCCCGGG + Intronic
1154062430 18:11074492-11074514 GATTGTGAGTTCTTCAGGCCTGG - Intronic
1156490960 18:37495777-37495799 ATCAGGGAGTGCTTCAGGCCTGG - Intronic
1162010922 19:7814435-7814457 GGTTGGAAGTGCTGCAGCCCCGG - Intergenic
1163477779 19:17537020-17537042 GTTTTGGAGTCAGTCAGACCCGG - Intronic
1166130960 19:40745231-40745253 GGTAGGGGGTGCTTCAGAGCTGG - Intronic
1167464114 19:49641119-49641141 GTATGTGAGAGCTTGAGACCAGG + Intergenic
1167806628 19:51791128-51791150 GTTTGGGATCGCTTGAGGCCAGG + Intronic
1167911351 19:52704810-52704832 ACTTGGGAGTGATTCACACCTGG - Exonic
1167923051 19:52798972-52798994 TTTTGGGAGTGATTCACACCTGG - Exonic
1167990148 19:53353024-53353046 TTTTGGGCGTGATTCACACCTGG + Exonic
925401467 2:3576027-3576049 GTTTGGGAGTGATACCGCCCAGG + Intronic
926749989 2:16191049-16191071 TCTGGGGAGTCCTTCAGACCCGG - Intergenic
929265232 2:39911703-39911725 GTTTGGGAGTCATTCAGATCTGG - Intergenic
929882179 2:45846707-45846729 CCTTAGGAGTCCTTCAGACCTGG + Intronic
931425396 2:62166291-62166313 GTGGGGGATTGCTTCAGCCCAGG + Intergenic
932798597 2:74719290-74719312 GTTTGGGAGTGAGTCAGACAAGG + Intergenic
932882734 2:75518847-75518869 CTTTGGCAGTGGTTCAGAGCTGG + Intronic
933526311 2:83444806-83444828 GTTTGGGAATGCATCAGAAGAGG - Intergenic
937883867 2:126887034-126887056 GTCTGTGAGTGCTCCAGTCCGGG - Intergenic
942033984 2:171992890-171992912 GTTTGTGTGTGCTTCAGATGAGG + Intronic
943678899 2:190746757-190746779 GGTTGGGAGTTCTTCAGAATAGG + Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
945821965 2:214675262-214675284 GTATGGGAATGCTACACACCTGG + Intergenic
946389029 2:219404576-219404598 GGGTGGGGGTGCTTCAGTCCAGG + Intergenic
1169465029 20:5829942-5829964 GTTTGGGAGTCTTTCAGTCTTGG + Intronic
1179063303 21:38000477-38000499 ATTTGGGAGTGCTTGGAACCAGG - Intronic
1182172070 22:28241144-28241166 GTATTGGGGTGCTTCATACCTGG - Intronic
1182285896 22:29246753-29246775 GTTTGGAACTCCCTCAGACCAGG - Intronic
1184144704 22:42602777-42602799 GTTTTGGTGAGCTTCAGAGCAGG + Exonic
950366486 3:12488843-12488865 GCTTGGGAGTTCAACAGACCTGG + Intronic
950485052 3:13268223-13268245 GTTTGGGAGTCCCACAGACCAGG + Intergenic
950913371 3:16617581-16617603 GTTGAGGACTGCTTGAGACCAGG - Intronic
958841671 3:99212393-99212415 GTTTCTGAGTGATTTAGACCAGG + Intergenic
960449479 3:117788856-117788878 GTTTGGAAGAGCTTCAGAGTGGG - Intergenic
962385697 3:134930537-134930559 GTTAGGGAGTCTTTCAGGCCAGG - Intronic
962993637 3:140603256-140603278 GTGTCCGAGTGCTTGAGACCTGG - Intergenic
964656208 3:159068421-159068443 GTTTAGGAGTTCTTCAGACAAGG + Intronic
965339961 3:167477787-167477809 GTTTGGGAGTAAAACAGACCTGG + Intronic
967984674 3:195086088-195086110 GTTTGGGGGTGCTGGAAACCAGG - Intronic
970255775 4:14169044-14169066 GTTTGCAAGTGATTCAGAGCAGG + Intergenic
970391736 4:15618924-15618946 CTTTGGGAGTGCTTGAGCCCAGG + Intronic
971391955 4:26194294-26194316 CTTTGGGAGTGTTTCTTACCCGG - Intronic
974589188 4:63921197-63921219 GTTTGGGAGTGCTGGTGAACAGG - Intergenic
978718148 4:111871171-111871193 GCTTGGGATTGCTTGAGCCCAGG + Intergenic
981956963 4:150487731-150487753 GTTTTGGATTGCCTCAAACCAGG - Exonic
982356897 4:154480854-154480876 GTTGGTGAGTGCTTGAGGCCAGG - Intronic
984142578 4:176021704-176021726 GATTGGCAGTGTTTCAGAGCAGG + Intergenic
992097633 5:73377923-73377945 GTTGGGGAGGGCTTCAGATATGG - Intergenic
995047524 5:107669483-107669505 GTTCGGAACTGCTCCAGACCCGG + Intronic
995783555 5:115803842-115803864 GTTTGGGACTGCAGCAGATCGGG + Intergenic
997353047 5:133244421-133244443 GTCTGGATGTGCTTCTGACCTGG - Intronic
997881770 5:137598319-137598341 GTCTGGGAGGGCTTCAGACACGG - Intronic
1000062345 5:157668709-157668731 GACTGGGAGTGCTTCAGCTCTGG + Intronic
1000381790 5:160636163-160636185 GTTAGGGAGGGCTTCCTACCTGG + Exonic
1001609206 5:172986533-172986555 GGATGGGAGTGTTTGAGACCAGG + Intronic
1002043378 5:176529678-176529700 GTTTGGGAGACCTGCAGCCCTGG - Intronic
1002601359 5:180355533-180355555 CTTTGGGATTGCTTGAGCCCAGG + Intergenic
1011634899 6:89362622-89362644 GTCATGGAGAGCTTCAGACCTGG + Intergenic
1011954433 6:93008373-93008395 GTTTGTGATTGCTTGAGACCTGG - Intergenic
1012239460 6:96855728-96855750 GATTGGAAGTTCTTCAGAACTGG - Intergenic
1013245106 6:108278834-108278856 GTTTGGTAGAGCGTCTGACCAGG + Intergenic
1014328762 6:120033170-120033192 GTTTTGCAGTGTTTCAGACCCGG + Intergenic
1020344766 7:7151093-7151115 GTTTTGGAGTTATACAGACCTGG - Intergenic
1021636673 7:22700701-22700723 GTTTTAGAGTGAGTCAGACCTGG - Intergenic
1024617772 7:51129984-51130006 GCATGGGAGTGCTTGAGCCCGGG + Intronic
1025866957 7:65391175-65391197 GTTGGAGATTGCTTCAGGCCAGG - Intronic
1026134075 7:67644009-67644031 CTTTGGGGATGCTTCAGGCCTGG - Intergenic
1032165139 7:129539551-129539573 GTCTTGGGGTGATTCAGACCAGG - Intergenic
1034730499 7:153382995-153383017 GTTTGGCGGTGCTTCTGACTTGG - Intergenic
1037455888 8:19063695-19063717 GTGTGGTAGTGCGTCAGAACTGG + Intronic
1038577725 8:28719210-28719232 GATTTGGAGTGATACAGACCTGG + Intronic
1039613050 8:38934225-38934247 GGCTGGGACTGCTTGAGACCAGG - Intronic
1042918006 8:73894161-73894183 GATTGGGATTGCTTGAGGCCAGG + Intergenic
1045905808 8:107343287-107343309 GTTTGGAGAGGCTTCAGACCGGG + Intronic
1045999216 8:108399119-108399141 CTTTGGGATTGCTTGAGTCCAGG + Intronic
1048424833 8:134313400-134313422 GTTTGGGAGTTTTTCTGACTGGG + Intergenic
1059511355 9:114851217-114851239 CTGTGGGAATGGTTCAGACCAGG + Intergenic
1060379249 9:123150730-123150752 GTTTTGGACTCCTTGAGACCTGG - Intronic
1060709148 9:125839027-125839049 GATTTGGAGTCATTCAGACCTGG + Intronic
1189904607 X:45744743-45744765 ATTAGGGAGTTCTTCACACCTGG + Intergenic
1195314893 X:103667922-103667944 GTTTTGGAGTGTGACAGACCTGG - Intergenic
1195992308 X:110694768-110694790 GTTGGGGAGGGCTTGTGACCTGG + Intronic