ID: 1128148317

View in Genome Browser
Species Human (GRCh38)
Location 15:65344983-65345005
Sequence TGGGACTGCTTTTGAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128148317_1128148323 17 Left 1128148317 15:65344983-65345005 CCAGGTTTTCAAAAGCAGTCCCA 0: 1
1: 0
2: 1
3: 11
4: 236
Right 1128148323 15:65345023-65345045 CTGTTTTCATCCTACACATCAGG 0: 1
1: 1
2: 0
3: 13
4: 213
1128148317_1128148318 -8 Left 1128148317 15:65344983-65345005 CCAGGTTTTCAAAAGCAGTCCCA 0: 1
1: 0
2: 1
3: 11
4: 236
Right 1128148318 15:65344998-65345020 CAGTCCCAGTTTCGAGTATTTGG 0: 1
1: 0
2: 0
3: 4
4: 65
1128148317_1128148325 29 Left 1128148317 15:65344983-65345005 CCAGGTTTTCAAAAGCAGTCCCA 0: 1
1: 0
2: 1
3: 11
4: 236
Right 1128148325 15:65345035-65345057 TACACATCAGGCAATGAGTCAGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128148317 Original CRISPR TGGGACTGCTTTTGAAAACC TGG (reversed) Intronic
901120598 1:6890032-6890054 TGGAACTGCTCTTTAAAATCAGG - Intronic
905691406 1:39945829-39945851 TGAGACTGATGTTGGAAACCCGG - Intergenic
906947964 1:50311532-50311554 TAGGGCTGGTTTTTAAAACCAGG + Intergenic
908184593 1:61640597-61640619 TGGGACTGCTTATGAATTTCGGG - Intergenic
908604898 1:65786560-65786582 TGCAAATGCATTTGAAAACCTGG - Intergenic
909645760 1:77915102-77915124 TTAGACTGGTTTTGAAACCCTGG - Intronic
911531440 1:99047977-99047999 AGGGACTTCATATGAAAACCTGG - Intergenic
913313107 1:117523026-117523048 AGGGGCGGCTTTTGAAAACCTGG + Exonic
914701807 1:150140973-150140995 TGGGACAGCCTTTGAATAGCAGG + Intronic
918781692 1:188708080-188708102 TGGGACATCTTTTTATAACCTGG - Intergenic
920386403 1:205572776-205572798 TGAGACTGATTTTTAAAACAAGG - Intronic
921215964 1:212936976-212936998 TGGGATGGCTCTTGAAAGCCTGG - Intergenic
921987553 1:221328439-221328461 GAGAACTCCTTTTGAAAACCTGG - Intergenic
923872487 1:238011093-238011115 AGCCACTGCTTTAGAAAACCAGG + Intergenic
923966433 1:239145421-239145443 AGGGACTGCATTTGGAAAACAGG + Intergenic
924184238 1:241470872-241470894 TAGGGCTGATTTTGAAAGCCTGG - Intergenic
924360723 1:243239020-243239042 TGGGACTTCTTTGAAAACCCTGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063613831 10:7585487-7585509 TGGAACTGCTTTGCAAAACAAGG - Intronic
1064381167 10:14843006-14843028 GGGCATAGCTTTTGAAAACCTGG - Intronic
1064478921 10:15720099-15720121 TGGGACTGCAATAGAAATCCGGG - Exonic
1066265017 10:33768284-33768306 TGGGAATGGTTTTGGAAAGCAGG - Intergenic
1067040171 10:42947340-42947362 TGGAACTGCTTTTGCATCCCTGG - Intergenic
1068133354 10:52923221-52923243 TGTGAATGTTTCTGAAAACCAGG + Intergenic
1068800354 10:61133263-61133285 AGGTACTGCTTTTGAAGAACAGG - Intergenic
1071427367 10:85572358-85572380 TGGCATTACATTTGAAAACCAGG - Intergenic
1072479073 10:95793204-95793226 TAGGACTGCTTCTAAAAAGCAGG + Intronic
1073891458 10:108107052-108107074 TTGGACTGTTTCTGAAAACATGG + Intergenic
1074513704 10:114143767-114143789 TAAGACTGTTTGTGAAAACCTGG + Intronic
1075177348 10:120177938-120177960 TAGGACTTCGATTGAAAACCAGG - Intergenic
1080384133 11:31800556-31800578 TGAGACTGCATTTGAAGGCCTGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080953539 11:37065321-37065343 CGGGACTCCTTTAGGAAACCTGG + Intergenic
1082907116 11:58320421-58320443 TGGGAATGCTTATGAAGACATGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1085029276 11:73259787-73259809 GGGGACAGCTTGTGAAGACCAGG - Intergenic
1087517134 11:99178269-99178291 TGAGACTGGTCTTGAAATCCTGG - Intronic
1090465805 11:126932013-126932035 TGGTATTGATTTTGAAATCCTGG + Intronic
1090541788 11:127714222-127714244 TGTGACTGTATTTGAAAACATGG - Intergenic
1090853609 11:130592682-130592704 TGGGATGGCTTTTAAAACCCTGG - Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1095279811 12:40336744-40336766 TGTTTCTGCTTTTGAACACCAGG + Intronic
1095457217 12:42400930-42400952 AGGGACTGTATTTGAAAACATGG - Intronic
1095560237 12:43555553-43555575 TGGGAAGTCTTTTGAAAACTAGG + Intergenic
1098090612 12:66896852-66896874 TGGGAATGTTTTTGAAATCTTGG - Intergenic
1098251876 12:68578760-68578782 TGGGACTGTTTTTGAAATGCCGG - Intergenic
1099988632 12:89698911-89698933 TGGGAATACAGTTGAAAACCAGG - Intronic
1101639673 12:106579030-106579052 TGGCACTGCTTGTGCAGACCTGG - Intronic
1102357155 12:112247475-112247497 TGGGAATGATCTTGAAAACATGG - Exonic
1103005173 12:117415127-117415149 TAGGACTGCATTTGAAAAAGGGG - Intronic
1103447279 12:121002352-121002374 TGGGCCTGCTGCTGAGAACCTGG + Exonic
1103943570 12:124513886-124513908 TGGGGATGATTTGGAAAACCAGG - Intronic
1104310949 12:127653916-127653938 TGGGACAGTATTTGAACACCAGG + Intergenic
1104481692 12:129113356-129113378 TGGGAGTGTTGTTGAACACCAGG - Intronic
1106031818 13:26011431-26011453 TGGGACTGTATTTGGAAACAGGG - Intronic
1106849313 13:33772433-33772455 CAGGACTATTTTTGAAAACCAGG - Intergenic
1107058311 13:36130438-36130460 AGAGGCTGCTTTTGAAAACCAGG - Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107337416 13:39369980-39370002 TGGCTCTGATTTTGAAAACGTGG + Intronic
1107516845 13:41137660-41137682 TGGGATTGTTTTTGTAAACAGGG - Intergenic
1107879007 13:44816912-44816934 TGGAATTGCTTTTGAATGCCAGG + Intergenic
1110466339 13:75806510-75806532 TGGCAGTTCTTTTGAAAAGCCGG + Intronic
1110533347 13:76622598-76622620 TGGAACTTCTTTTGTAAAACAGG - Intergenic
1112314529 13:98349836-98349858 TGGGACTGCTTTTGAGGGGCAGG + Intronic
1113887019 13:113666350-113666372 TGGGACAGCTGGTGAACACCTGG - Intergenic
1113900671 13:113795083-113795105 TTGGTTTGCGTTTGAAAACCGGG + Intronic
1114555786 14:23561530-23561552 TGGGGCTGCTTCTGAAAGCTGGG + Exonic
1114930617 14:27462993-27463015 TGGGGCTGCTTTTGATTAGCTGG - Intergenic
1119501581 14:75132533-75132555 AGGTACTGCTTCTGAGAACCTGG - Exonic
1121108417 14:91295812-91295834 TGGGACTGCATTTGGAGACAGGG + Intronic
1121994193 14:98589213-98589235 TGGGACTGGTTTTGGAAAGCAGG - Intergenic
1202937002 14_KI270725v1_random:98452-98474 TGGAACTTTTTTTGAAAACTGGG + Intergenic
1123886731 15:24734114-24734136 TGGGAATGTTGTTGTAAACCCGG - Intergenic
1124203436 15:27697832-27697854 TGGTATTGCTTTTGAAACTCAGG - Intergenic
1126301798 15:47205157-47205179 TGGAACTGGTTTTGTAATCCAGG - Intronic
1127683973 15:61323732-61323754 TGGGACGGCATTTAAAGACCTGG + Intergenic
1127839672 15:62820276-62820298 TGCAACTGATTTAGAAAACCAGG + Intronic
1128148317 15:65344983-65345005 TGGGACTGCTTTTGAAAACCTGG - Intronic
1132168496 15:99622154-99622176 TGGGAATGTTTTTAAAAATCTGG + Intronic
1135004159 16:18803025-18803047 TGTTACTGCATTTGAAATCCTGG - Intergenic
1135042513 16:19128878-19128900 TTAGACTGCTTTTGAAAACCAGG - Intronic
1135815021 16:25624600-25624622 TGGGGCTTCTCTTGAAAAACCGG + Intergenic
1135931393 16:26740558-26740580 CCGGACTGCTTCTGCAAACCAGG + Intergenic
1137949472 16:52769699-52769721 ATGGGCTGCTTTTGAAAACTTGG + Intergenic
1138195253 16:55047096-55047118 TGGGGCTTCTTTGGAAAACTTGG + Intergenic
1139002118 16:62524830-62524852 TAGGACTGCTTTTGATAAAACGG - Intergenic
1139544916 16:67645573-67645595 TGGAGCTGCTGCTGAAAACCTGG + Exonic
1142014358 16:87736478-87736500 TGTAACTGCTTTTGAAAGACAGG - Intronic
1142737120 17:1908171-1908193 TGCAACTGTTTTCGAAAACCTGG - Intergenic
1143962415 17:10731541-10731563 TGGGACTGCATTTGCAGACAGGG + Intergenic
1144845958 17:18219192-18219214 TGGGCCAGCTTCTGAAAGCCAGG + Intergenic
1147058535 17:37854201-37854223 TGGGACTGCCTTTGTAGGCCTGG - Intergenic
1149130040 17:53288207-53288229 TGGTACTCATTTTAAAAACCTGG + Intergenic
1150434830 17:65145715-65145737 TGTGACTGCTTTTGAAGATAAGG - Intronic
1152431997 17:80253639-80253661 TGTGACTGCGTTTGGAAACAGGG + Intergenic
1153975087 18:10262256-10262278 TGGGAGTGATATTGAAAACAAGG + Intergenic
1155704526 18:28792353-28792375 TGGCACTGATTTTGGAAACTGGG + Intergenic
1156690875 18:39705400-39705422 TGGGCCTGCATTTCAAAAGCAGG + Intergenic
1157326322 18:46671457-46671479 TGGGTCTGCATCAGAAAACCAGG + Intronic
1157629765 18:49082670-49082692 TGGCAATGCTTTTGGAAACATGG + Intronic
1158369242 18:56779984-56780006 TGGGACTGATATTTAAACCCAGG - Intronic
1158491025 18:57909911-57909933 TGCGTCTGTTTTTGAAAGCCTGG + Intergenic
1160795393 19:942894-942916 TGGGACTGCATTTGGAAATAGGG + Intronic
1164144965 19:22506479-22506501 AAGAACTGCTTTAGAAAACCTGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167712235 19:51119512-51119534 TGGAAGTGCTCATGAAAACCTGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925532617 2:4881732-4881754 TGTGACTGCTCTTGAAGAGCAGG + Intergenic
926988996 2:18656775-18656797 TGTGACTGTTTATGAAAAACTGG - Intergenic
927800731 2:26096579-26096601 GGGAACTACTTTTGAAAACTTGG + Intronic
929024160 2:37583243-37583265 GGGGACTGCATTTGACAATCAGG - Intergenic
929342064 2:40831996-40832018 TGGGAATGATTTAGAAAAACAGG + Intergenic
930355209 2:50309574-50309596 GGGGACTGCCATAGAAAACCAGG - Intronic
935374375 2:102379975-102379997 TGGGACTGTTTTTGGAGCCCAGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942594855 2:177583288-177583310 TGTGACTACATTTGAAAACAAGG - Intergenic
944555154 2:200880786-200880808 TGGGATTGATTTTTAAAACTAGG + Intronic
945592980 2:211756694-211756716 TGGAAGTGCTTTTTAAAACTAGG - Intronic
945928123 2:215827143-215827165 TGAGTGTGCTTTTGAAATCCAGG - Intergenic
948633726 2:239319758-239319780 CAGGACTGTTTTTGAGAACCAGG - Intronic
1169883145 20:10368895-10368917 AGGGTCTGATTTTGAAAGCCTGG + Intergenic
1171313039 20:24161128-24161150 TGGGACTGTTCTTGAAGTCCAGG + Intergenic
1173498779 20:43537515-43537537 TGGGACTGCATTTGGAAAAAGGG - Intronic
1174063216 20:47846691-47846713 GGGGGCTGCTTTTGAACACATGG - Intergenic
1174072510 20:47908982-47909004 GGGGGCTGCTTTTGAACACATGG + Intergenic
1174151565 20:48489722-48489744 GGGGGCTGCTTTTGAACACATGG - Intergenic
1174949307 20:55027284-55027306 TGTGACTGCTTCTGAAGAGCAGG + Intergenic
1176586313 21:8590525-8590547 TGGAACTTTTTTTGAAAACTGGG - Intergenic
1176998772 21:15586272-15586294 TGGAATTGCTTTTTAAAAGCAGG + Intergenic
1177868401 21:26540401-26540423 GTGTACTGCTTTTAAAAACCAGG + Intronic
1178108134 21:29343930-29343952 TGGGTTTGCATTTGAAAAGCAGG + Exonic
1180269119 22:10567428-10567450 TGGAACTTTTTTTGAAAACTGGG - Intergenic
1182563218 22:31178148-31178170 TAGGACTGTTTTTTAAAACTAGG + Intronic
1182689146 22:32144350-32144372 TGTGACTGTTTTTGAATTCCTGG - Intergenic
1182842317 22:33401270-33401292 TGGGACTGAATTTGGAAACAGGG + Intronic
949195374 3:1299731-1299753 GAGAACTGCTTTTGAAATCCTGG + Intronic
951432936 3:22629006-22629028 TGGAAGTGCTGTTGACAACCTGG - Intergenic
952127311 3:30315986-30316008 TGGCAATGGTTATGAAAACCTGG - Intergenic
953384272 3:42497506-42497528 TGTGGCTGCTTTTGAAAACAGGG + Intronic
953796747 3:45991832-45991854 TGTGACTGCATTTGAAGACAGGG + Intronic
955060983 3:55491191-55491213 GGGGACTGCCTTAGAAAGCCAGG + Intergenic
955358454 3:58251467-58251489 TGTCACTGATTTTGAAAACTGGG - Intronic
955761426 3:62288095-62288117 AGGCACTGCATTTCAAAACCTGG + Intronic
958028912 3:88083159-88083181 TGGGACTGTATTTGAAGACAGGG - Intronic
959754236 3:109877556-109877578 TGCAACTGCTTTTGAAGACTTGG - Intergenic
959999763 3:112718601-112718623 TGGTACAGCTTTTAAAAACAAGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961644456 3:128385179-128385201 TGGGACTGCTCTGGAGAGCCTGG - Intronic
961745726 3:129062446-129062468 TCTGACTCCTTCTGAAAACCTGG + Intergenic
961968389 3:130931019-130931041 AGATACTACTTTTGAAAACCAGG - Intronic
963660593 3:148122749-148122771 TGAGAATGCATTTGCAAACCTGG + Intergenic
964825105 3:160817195-160817217 TGGGAGGGCTTTCCAAAACCAGG + Intronic
965502494 3:169473063-169473085 TGGACCTCCTTTTGGAAACCAGG - Intronic
970427120 4:15955760-15955782 AGGGACAGCTTTTGACTACCTGG + Intergenic
970757030 4:19438946-19438968 TGAGATTGCATTTGAAAACTTGG - Intergenic
970812761 4:20114509-20114531 TAATACTGCTTTTGAAAACAAGG - Intergenic
972316222 4:37928606-37928628 TGGGTATACTTTTGAAAATCTGG + Intronic
972958720 4:44424914-44424936 TGGGACTGCATTTGGAAATAGGG + Intronic
973798198 4:54450220-54450242 TGGGAGTGCTATTGGAGACCGGG - Intergenic
974826711 4:67140479-67140501 TTGGACAGCTTCTGAAAGCCTGG + Intergenic
978187089 4:105868819-105868841 TGGAACTGCTTTTATAAAACAGG + Intronic
978469902 4:109053862-109053884 TGGGTCTGCTTTTGGAGAGCAGG + Intronic
978957014 4:114626450-114626472 TGGGACTGAATTTCACAACCTGG + Intronic
981011927 4:139933809-139933831 TGGGGCTTTGTTTGAAAACCAGG + Intronic
981811267 4:148778112-148778134 TGGGAGTGGTTTTGCAATCCAGG - Intergenic
982329069 4:154161181-154161203 GGGGGCTGCTTTTTAAACCCAGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
983151561 4:164288770-164288792 TGGGAGTCCTTTTGAAACACGGG + Intronic
987555125 5:19436478-19436500 TAGGACTGCTTTTGGAAAATTGG - Intergenic
988991655 5:36677384-36677406 GGTGACAGCTTTTGAAAACAAGG - Intronic
990631370 5:57674162-57674184 TGGGCCTGCTTTTGTATCCCTGG - Intergenic
991928092 5:71724972-71724994 TCGGGCTGGTTTTGAAATCCTGG + Intergenic
993309536 5:86312555-86312577 TGGGACTGCTTCAAAAAAGCAGG + Intergenic
994321901 5:98404188-98404210 TGGGACTGATTTTGAACTTCTGG + Intergenic
995240597 5:109881873-109881895 TAGGTCTGCTTTTGGAAAGCCGG - Intergenic
995474757 5:112536566-112536588 TTGAACTTCTTTTGAAAACTGGG - Intergenic
996325032 5:122263043-122263065 AGGGAGGGCTTTTGAAAATCTGG - Intergenic
998928700 5:147156608-147156630 CTGGACTGCTATTGAGAACCTGG + Intergenic
1000958800 5:167574354-167574376 TGATACTGCTTTTGAACTCCGGG + Intronic
1001767480 5:174262318-174262340 TGGGTCTGCTTTTTAAAGCTTGG - Intergenic
1004857087 6:19762267-19762289 TGGGACTGATCTTGAAGACAGGG + Intergenic
1007655487 6:43448923-43448945 TGGGACTGTTCGGGAAAACCTGG + Exonic
1008874442 6:56310245-56310267 TTGGACTACTTTGGAAGACCTGG + Intronic
1009368287 6:62872921-62872943 TGATACTGTTTTTAAAAACCAGG + Intergenic
1009761297 6:68010216-68010238 TGGCATGGCTTTTGAAAAGCTGG + Intergenic
1010099123 6:72082159-72082181 TGGCACTGCTTTTAAGAATCTGG + Intronic
1011902516 6:92317237-92317259 TGTAACTTCATTTGAAAACCTGG + Intergenic
1013420389 6:109961644-109961666 TGGAGCTGCTTTGGAAAAACAGG + Intergenic
1014916050 6:127149707-127149729 TCAGACTGCTTTTTGAAACCAGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015557689 6:134480012-134480034 TGGGACTGATATTTAAACCCTGG + Intergenic
1016429945 6:143973063-143973085 TGGACCTTCTTGTGAAAACCAGG - Intronic
1017936895 6:159013665-159013687 TGGGTCTGCTCTTGAAATCCTGG + Intergenic
1018240080 6:161765284-161765306 TGCGAATGATTTAGAAAACCCGG - Intronic
1018486774 6:164248793-164248815 TGGCACTGGTATTTAAAACCGGG + Intergenic
1018837839 6:167498495-167498517 TGTGACTGTGTGTGAAAACCTGG + Intergenic
1019793538 7:3033145-3033167 TGGGACTGTATTTGAAGACGGGG + Intronic
1019856901 7:3618265-3618287 TGGGATGGCTTATGAAAAGCAGG - Intronic
1022894277 7:34733885-34733907 TGGTACTGCTATAGAAAACTGGG + Intronic
1023619012 7:42050690-42050712 TGGGCCAGCTTTTGCAATCCAGG + Intronic
1023648967 7:42348724-42348746 TGGGTTTGCTTTGGAAAGCCAGG + Intergenic
1024867242 7:53918121-53918143 TGGGAATGCTTTTAAGAACAAGG - Intergenic
1028895010 7:96031265-96031287 TAGGAAAGGTTTTGAAAACCAGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031201754 7:118697286-118697308 TGGGACTGCTGGCGCAAACCTGG - Intergenic
1031213929 7:118866334-118866356 TGGGAGTTCATTTGAAAAACAGG + Intergenic
1031817376 7:126454627-126454649 TGTGACTGCATTTGAAGACGGGG + Intronic
1032502654 7:132411526-132411548 TGTGGCTGTTTTTGGAAACCTGG + Intronic
1034396994 7:150834139-150834161 TCGCACTGCTGTTGAAAATCAGG - Intronic
1034675813 7:152891763-152891785 TGTGACTGCTTTTGGAAATAGGG + Intergenic
1035148336 7:156843245-156843267 TGGGATTGATGTTGAAATCCTGG - Intronic
1035925286 8:3721384-3721406 TGGGACTGATCCTAAAAACCTGG - Intronic
1036380416 8:8232954-8232976 TGGGCCTGCTTTGCAAACCCCGG + Intergenic
1036701061 8:11014320-11014342 TGTGCCTGCTTTTGAAAATCTGG - Intronic
1037815338 8:22109009-22109031 TGGGAGTGCTTTGCAAAACTGGG + Intronic
1038942844 8:32324413-32324435 TGGGCTTGCTTTTGAGTACCGGG + Intronic
1039196297 8:35035253-35035275 TGGGAGTGGTTATGAAAACTGGG - Intergenic
1045793386 8:106013139-106013161 TGGGACTCCCTCTGAAAGCCTGG - Intergenic
1047513745 8:125535651-125535673 TGGGACTACCTTGGAAAACCTGG + Intergenic
1047884451 8:129233405-129233427 TGTGATTGCTTTTGAGAACCTGG - Intergenic
1048008987 8:130441684-130441706 TTGCACTGATTTTGAAAATCTGG + Intronic
1049873183 8:144997824-144997846 AGGTACTGCTTCTGAGAACCTGG + Intergenic
1049976876 9:868516-868538 TGGAACTGCGATTGAAACCCAGG - Intronic
1050437238 9:5624106-5624128 AGGGAATGCTTTTTAAAAACTGG + Intergenic
1050521106 9:6500816-6500838 TGGCACTGGATTAGAAAACCGGG - Intronic
1050610642 9:7349172-7349194 TGGGACTGCTCTTGCAAAGCAGG + Intergenic
1053099512 9:35359408-35359430 TGGGAATGCTTATGAAACTCGGG - Intronic
1053272827 9:36761927-36761949 TGGGACTGAGATTGAAACCCAGG - Intergenic
1054825082 9:69565619-69565641 TGGCACTGCTTTTGAAATGGTGG - Intronic
1054833506 9:69651919-69651941 TGTGACTGCATTTGAAGACAGGG + Intronic
1055150095 9:72986680-72986702 TGGGACATATTTTGAAAACCAGG + Intronic
1055996651 9:82167581-82167603 TGGAACTGCTATGGAAAACTTGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1203616213 Un_KI270749v1:68038-68060 TGGAACTTTTTTTGAAAACTGGG - Intergenic
1186661429 X:11671375-11671397 TGGGACCTTATTTGAAAACCGGG + Intergenic
1187487784 X:19720928-19720950 TGGTACTGATTTTAAAAACTGGG - Intronic
1187990208 X:24862626-24862648 TGGCACTGCTTTTGCAATCTGGG - Intronic
1188467386 X:30497422-30497444 TGGGAAAGCATTTCAAAACCAGG + Intergenic
1189070952 X:37863563-37863585 TGATTATGCTTTTGAAAACCAGG - Intronic
1189671718 X:43417597-43417619 CGGGGCTGCTTTTGAAATGCTGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192047933 X:67696299-67696321 TGGAAATGCTTTCGAATACCAGG - Intronic
1192244091 X:69358874-69358896 TGGGGCTGCCTTTCAAAGCCAGG + Intergenic
1195585590 X:106562050-106562072 TGTGACTGTATTTGAAAACAGGG + Intergenic
1196456699 X:115896021-115896043 TGGGAGTGCTGTGGAGAACCAGG - Intergenic
1197358608 X:125468996-125469018 TGGGATTGCCTATGGAAACCTGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic