ID: 1128150141

View in Genome Browser
Species Human (GRCh38)
Location 15:65357998-65358020
Sequence CCTAGAATCCTGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128150141 Original CRISPR CCTAGAATCCTGAAGGTGGA GGG (reversed) Intronic
900722071 1:4183302-4183324 GGGAGAATCCTGCAGGTGGACGG + Intergenic
901008903 1:6187223-6187245 CCTTGAATCCAGGAGGCGGAGGG + Intronic
901226593 1:7616626-7616648 CCTAGAATCCTGAGGGGGAATGG + Intronic
902403938 1:16173003-16173025 CCTAGCAATCCGAAGGTGGAGGG - Intergenic
903118268 1:21195963-21195985 GCTTGAACCCTGGAGGTGGAGGG + Intergenic
903933051 1:26875082-26875104 TCAAGAATCCTGAGGGGGGAGGG - Intergenic
904822213 1:33253174-33253196 CCAGGCATCATGAAGGTGGATGG + Intergenic
907505975 1:54918542-54918564 CCAAGAATATTGAAAGTGGAAGG + Intergenic
910364008 1:86444759-86444781 GCTTGAATCCTGAAAGTGAAAGG + Intronic
910820457 1:91339315-91339337 CCTAGAATTCAGAATCTGGATGG + Intronic
910892523 1:92032491-92032513 CCCTGAATCCTGAAAGTAGAGGG - Exonic
911268773 1:95775523-95775545 CCATGAATCCTGAGGGTGGATGG - Intergenic
912542432 1:110427210-110427232 CCTAGAAATCTGAAGGTGCTAGG + Intergenic
913123076 1:115759788-115759810 CTAAGAACCCTGAAGGTAGATGG - Intronic
914900394 1:151708420-151708442 CCTAGAATCTCAAAGCTGGAAGG + Intronic
916581958 1:166116881-166116903 CCTAGAAGGCTGGAGCTGGAAGG - Intronic
916854555 1:168736590-168736612 CCTACAATCCTGAAGGCAGGTGG + Intergenic
918120699 1:181537180-181537202 ACTTGAATCTTGGAGGTGGAGGG - Intronic
918279014 1:182984546-182984568 CTTTGAACCCAGAAGGTGGATGG + Intergenic
919194357 1:194264245-194264267 CCTAGATTCCAGAAGATGTATGG + Intergenic
919340606 1:196301820-196301842 GCTTGAATCCAGGAGGTGGAAGG - Intronic
919661974 1:200256302-200256324 GCTTGAATCCAGGAGGTGGAGGG - Intergenic
922936372 1:229426142-229426164 CCTAGAATCCTGGTGCTGGCAGG - Intergenic
923555932 1:235000307-235000329 GCTTGAATCCGGGAGGTGGACGG + Intergenic
923687379 1:236162765-236162787 CCTAGATTCCAGAAGATGTATGG + Intronic
1063923447 10:10954326-10954348 CCTTGAACCTGGAAGGTGGAGGG - Intergenic
1065525324 10:26614141-26614163 GCTTGAACCCAGAAGGTGGATGG + Intergenic
1068258481 10:54544698-54544720 CTAACAATACTGAAGGTGGAAGG - Intronic
1070101851 10:73395701-73395723 GCTTGAACCCGGAAGGTGGAGGG + Intronic
1070167185 10:73907611-73907633 GCTTGAACCCAGAAGGTGGAGGG + Intergenic
1070754943 10:78986086-78986108 CTCAGAATGGTGAAGGTGGAGGG + Intergenic
1071503988 10:86222058-86222080 CCAAGAACCCTGAAGCTGGCAGG + Intronic
1072062027 10:91822646-91822668 CTTTGAACCCTGGAGGTGGAGGG - Intronic
1072346775 10:94515428-94515450 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1072744687 10:97931873-97931895 CCTAGGTTCCTGGATGTGGAGGG + Intronic
1072777877 10:98218992-98219014 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1072948501 10:99832285-99832307 CCAAGAATCCTGGAGATTGAGGG + Intronic
1073305250 10:102498161-102498183 CCTTAAAACATGAAGGTGGATGG + Intronic
1073314780 10:102571938-102571960 CCTTGAATCCTAAAGTTGCAAGG - Intronic
1073504260 10:103969904-103969926 CCTAGAATCTTGTAGTTAGAAGG + Intronic
1075427195 10:122351080-122351102 CCAAGCATACTGAGGGTGGAGGG + Intergenic
1076288340 10:129323372-129323394 CCTTGGATCCTAGAGGTGGATGG - Intergenic
1076400201 10:130178335-130178357 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1077596626 11:3537578-3537600 CCTAGACTTCAGAAGGTGAATGG - Intergenic
1078422313 11:11222794-11222816 ACTTGAAACCAGAAGGTGGAGGG - Intergenic
1081149578 11:39610395-39610417 CCTATCATCATGAAGCTGGATGG - Intergenic
1081156602 11:39700651-39700673 CCTTTAATCCTGATGATGGATGG + Intergenic
1081733422 11:45387278-45387300 CCCAGAATCTTGCAGGAGGAAGG + Intergenic
1083967921 11:66054097-66054119 ACTTGAACCCTGGAGGTGGACGG + Intronic
1086056574 11:82654084-82654106 CCTAGATTTCTGAAGATGTATGG + Intergenic
1086170272 11:83828096-83828118 CTTAGCAACCTGAAGATGGAGGG - Intronic
1087217651 11:95511312-95511334 TGTAGAATTCAGAAGGTGGAAGG - Intergenic
1088660186 11:112037544-112037566 CATAGAATCTTGGAGGTGGAAGG - Intronic
1089833320 11:121348213-121348235 CCTAGCATCCTCAGGGTGGTAGG + Intergenic
1091086929 11:132730094-132730116 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1091841757 12:3626621-3626643 CCATGAATCCTGCTGGTGGAAGG + Intronic
1092068237 12:5611051-5611073 GCTTGAACCCTGGAGGTGGAGGG - Intronic
1092380621 12:7993764-7993786 CCTTGAACCCAGAAGGCGGAAGG + Intergenic
1092422796 12:8346351-8346373 CCTAGACTTCAGAAGGTGTATGG - Intergenic
1093091229 12:14922984-14923006 ACTTGAACCCAGAAGGTGGAGGG + Intronic
1094055709 12:26267722-26267744 GCTTGAATCCAGGAGGTGGAGGG - Intronic
1094127593 12:27039731-27039753 ACTTGAATCCGGGAGGTGGAGGG - Intronic
1094623857 12:32105171-32105193 GCTTGAATCCAGGAGGTGGAGGG - Intergenic
1095768085 12:45918622-45918644 GCTTGAACCCGGAAGGTGGAGGG + Intergenic
1095854586 12:46845776-46845798 GCTTGAATCCAGGAGGTGGAGGG + Intergenic
1095993781 12:48060415-48060437 CCTAGAATCTTAAAGTTGGAAGG + Intronic
1096011348 12:48218302-48218324 GCTAGAATCAGGAGGGTGGATGG + Intergenic
1099453966 12:82842183-82842205 ACTAGAAAACTGAAGTTGGAGGG - Intronic
1099454895 12:82851345-82851367 GCTTGAACCCAGAAGGTGGAGGG + Intronic
1100676929 12:96878440-96878462 TGCAGAATTCTGAAGGTGGAAGG - Intergenic
1101322933 12:103689184-103689206 CCAAGAATACTCAAGGTGGCTGG + Intronic
1102634573 12:114311868-114311890 CCTAGAGACCTGCTGGTGGATGG - Intergenic
1103588437 12:121973299-121973321 CCTAGATTTCAGAAGGTGTATGG + Intronic
1104372149 12:128232912-128232934 CCCAGAACCCTGAAGGTGGTGGG + Intergenic
1105664474 13:22537255-22537277 ACCAGAATCCTGAATTTGGAAGG + Intergenic
1106460259 13:29961991-29962013 CCTGGAAGCCTGAAGAGGGAGGG + Intergenic
1107286247 13:38796060-38796082 CATAGAATCATTAAGGTGGCTGG + Intronic
1107642097 13:42454002-42454024 CCTTGAATCCAGGAGGTGGAGGG - Intergenic
1109576295 13:64263671-64263693 CCTAGATTTCTGAAGATGTATGG + Intergenic
1109810716 13:67509424-67509446 CCTAGATTTCAGAAGGTGTATGG + Intergenic
1113245236 13:108388021-108388043 CCTAAAATCCTCAAGGGGAACGG - Intergenic
1113280530 13:108782885-108782907 CCTAGATTTCAGAAGGTGTATGG + Intronic
1113836012 13:113328988-113329010 CCCAGAAGCCTGAAGGTAGCAGG + Intronic
1114040403 14:18673065-18673087 ACTTGAACCCTGGAGGTGGAGGG + Intergenic
1114045440 14:18871581-18871603 ACTTGAACCCTGGAGGTGGAGGG + Intergenic
1114118772 14:19647887-19647909 ACTTGAACCCTGGAGGTGGAGGG - Intergenic
1115233619 14:31187273-31187295 GCTTGAACCCTGGAGGTGGAAGG + Intronic
1116943388 14:50812528-50812550 CATAGATTCCAGAAAGTGGAAGG + Intronic
1117072856 14:52071593-52071615 CCCAGATTCCTGAAGGAGGAGGG - Intergenic
1117735847 14:58767598-58767620 CCTTGAATCTTAATGGTGGAAGG + Intergenic
1118232807 14:63969423-63969445 ACTTGAATCCAGGAGGTGGAGGG - Intronic
1118890163 14:69902469-69902491 CCTGGACTCTTGAAGGTGGTGGG + Intronic
1119228199 14:72960230-72960252 ACTAGAACCCAGGAGGTGGAGGG - Intergenic
1119836735 14:77756794-77756816 ACTTGAATCCGGTAGGTGGAGGG + Intronic
1120931583 14:89854403-89854425 CTTAGTATCCTGAATGAGGAGGG - Intronic
1121907347 14:97758461-97758483 CCTAGAAACTTCTAGGTGGATGG - Intronic
1122193327 14:100065559-100065581 CCTAGAATCTTAACGGTGAATGG + Intronic
1123916472 15:25034090-25034112 CCTCGAATTCTGAAGTTGTAAGG - Intergenic
1124030202 15:26003568-26003590 GCTTGAACCCTGGAGGTGGAGGG + Intergenic
1126612795 15:50546726-50546748 GATAGAATCTTGAAGGTGAATGG - Intergenic
1127412388 15:58722257-58722279 ACTTGAACCCGGAAGGTGGAGGG + Intronic
1128150141 15:65357998-65358020 CCTAGAATCCTGAAGGTGGAGGG - Intronic
1128201750 15:65814940-65814962 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1129888211 15:79053335-79053357 CCTAGAAGGCTGACAGTGGAGGG - Intronic
1130062614 15:80580696-80580718 CCGAGAGCCCTGAGGGTGGATGG - Intronic
1130997670 15:88912878-88912900 CCTAGAATCTCCCAGGTGGAAGG + Intronic
1131530479 15:93187010-93187032 ACTAGAATCCAGAATGTAGAAGG - Intergenic
1133516796 16:6517305-6517327 CCTTGAATACTAAAGGTGAAGGG - Intronic
1134837882 16:17377092-17377114 GCTTGAACCCGGAAGGTGGAGGG + Intronic
1135858102 16:26030680-26030702 CCTAGAATTCTTATGGTTGAAGG - Intronic
1137223976 16:46483814-46483836 CTTAGAATCCAGAATCTGGATGG + Intergenic
1139163566 16:64539625-64539647 CCTTGAATCCGGGAGGCGGAGGG + Intergenic
1139949044 16:70660400-70660422 CCTGGGGACCTGAAGGTGGATGG + Exonic
1142387881 16:89778077-89778099 CCTTGAACCCAGGAGGTGGAGGG + Intronic
1142593941 17:1020602-1020624 CCAAGAATCCCGTAGGTGGCTGG + Intronic
1142909012 17:3071451-3071473 GCTGAAATCCTGAATGTGGAAGG + Intergenic
1142925550 17:3232791-3232813 GCTGAAATCCTGAATGTGGAAGG - Intergenic
1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG + Intronic
1144283742 17:13752187-13752209 GCTTGAACCCTGGAGGTGGAGGG + Intergenic
1144944499 17:18962884-18962906 CGGAGAGTCCTGAAAGTGGATGG + Intronic
1145186436 17:20798756-20798778 ACTTGAATCCAGGAGGTGGAGGG - Intergenic
1146939156 17:36832103-36832125 CCTAGAATGCTGGGAGTGGAGGG - Intergenic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1148610873 17:48963749-48963771 GCTTGAATCCAGGAGGTGGAGGG + Intronic
1148622322 17:49043875-49043897 CCTTGCATCCTCAAGGAGGAAGG - Intronic
1151926498 17:77201531-77201553 GCTTGAACCCGGAAGGTGGAGGG - Intronic
1152350811 17:79783130-79783152 CCTTGAAAGCTGATGGTGGACGG + Intronic
1152899113 17:82929852-82929874 CCTGGAGCCCTGAAAGTGGAGGG - Intronic
1152938527 17:83153983-83154005 CCCAGAATCCTGCAGGCCGAAGG + Intergenic
1157687833 18:49657073-49657095 TCTAGATTCCTGAAGGAGAAAGG - Intergenic
1159148009 18:64480222-64480244 CCTAGAACACAGAAAGTGGATGG + Intergenic
1159783138 18:72682362-72682384 CACAGAATCATGAAGCTGGAGGG + Intergenic
1160561431 18:79759926-79759948 ACTTGAACCCAGAAGGTGGAGGG - Intergenic
1162393315 19:10402749-10402771 CTAAGGATCCTGAAGGGGGACGG + Intronic
1165497822 19:36164171-36164193 TCTTGAACCCAGAAGGTGGAGGG - Intergenic
1165709043 19:37996776-37996798 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1165958783 19:39517879-39517901 GCTAGAACCCAGGAGGTGGAAGG + Intronic
1166624908 19:44342730-44342752 GCTGGAATCCAGGAGGTGGAGGG + Intronic
1167252326 19:48406447-48406469 CCTTTAATCCTGAACGAGGATGG + Intronic
1167553580 19:50178048-50178070 GCTTGAATCCGGGAGGTGGAGGG + Intergenic
925555401 2:5125746-5125768 CCTCGAATCCTGATGTTGCATGG + Intergenic
925997348 2:9304134-9304156 CCTGGATCCCTGAGGGTGGAGGG + Intronic
929938193 2:46310303-46310325 CCTAGAATCCAGAATGAGAAAGG - Intronic
930042778 2:47140967-47140989 GCTTGAATCTGGAAGGTGGAGGG - Intronic
935111354 2:100097331-100097353 CATAGAATTTTGAAGCTGGAAGG + Intronic
935130541 2:100257933-100257955 CCTGGCATCTGGAAGGTGGAGGG - Intergenic
935496100 2:103783330-103783352 CCTAGAATCCTGAAGGCAGAGGG + Intergenic
936123614 2:109767833-109767855 CATAGAATTTTGAAGCTGGAAGG - Intergenic
936221072 2:110603633-110603655 CATAGAATTTTGAAGCTGGAAGG + Intergenic
938227854 2:129632414-129632436 CCTAGTAGCCTAAAAGTGGATGG - Intergenic
938269783 2:129959423-129959445 GCTTGAACCCTGGAGGTGGAGGG - Intergenic
939126287 2:138181409-138181431 TGTAGAATACTGAAGCTGGAAGG - Intergenic
939126294 2:138181487-138181509 TGTAGAATACTGAAGCTGGAAGG - Intergenic
939126300 2:138181565-138181587 TGTAGAATACTGAAGCTGGAAGG - Intergenic
939728708 2:145754938-145754960 CCTAGAATCCTAGTGTTGGATGG + Intergenic
940381344 2:153018167-153018189 CCTAGATTTCAGAAGGTGTATGG - Intergenic
942210802 2:173667609-173667631 CCTAGAGTACTGAAGGTGCTTGG - Intergenic
943224894 2:185159706-185159728 CCTTGAACCCAGGAGGTGGAGGG + Intergenic
943842225 2:192598252-192598274 CCTAGTATCCTGAAGGGGAGAGG + Intergenic
945988933 2:216377353-216377375 ACTTGAATCCAGGAGGTGGAGGG + Intergenic
946795427 2:223345945-223345967 TCTAGAACCCTAATGGTGGAAGG - Intergenic
947580009 2:231309628-231309650 CCTCGAATTCTGAAGTTGCAAGG - Intronic
947580014 2:231309668-231309690 TCTTGAATTCTGAAGTTGGAAGG + Intronic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
1169233878 20:3912865-3912887 ACTTGAACCCTGGAGGTGGAGGG + Intronic
1169854918 20:10091997-10092019 CTTAGAATCTTGAATATGGAAGG - Intergenic
1170028787 20:11922010-11922032 TCTTGAATTCTGAAGGTAGAAGG + Intronic
1170920548 20:20674929-20674951 CCTAAAATGGTGAAGGGGGAGGG + Intronic
1172778485 20:37422006-37422028 CCAGGAAGCCTGGAGGTGGAAGG - Intergenic
1175618074 20:60420449-60420471 CATAGAAGCCTGAACCTGGAGGG + Intergenic
1176887564 21:14274244-14274266 CCTCGAACCCTGAACGTGGACGG + Intergenic
1178794768 21:35733545-35733567 GCTTGAACCCTGGAGGTGGAGGG + Intronic
1179588538 21:42389639-42389661 AATAGAATCCTGCAGGTGGGAGG - Intronic
1180251392 21:46592482-46592504 CCTAGATTCCAGAAGATGTATGG + Intergenic
1180463971 22:15594198-15594220 ACTTGAACCCTGGAGGTGGAGGG + Intergenic
1181561362 22:23703708-23703730 ACTTGAACCCGGAAGGTGGAGGG + Intergenic
1181746530 22:24958566-24958588 CCTTGAACCCCGGAGGTGGAGGG + Intronic
1182190311 22:28453139-28453161 CATAGAATCATTAAGGTGGCTGG - Intronic
1184783455 22:46660329-46660351 TCTGGAAGCCTGAAGGAGGAGGG + Intronic
950578310 3:13846346-13846368 CCAAGACTCCTGAGGGTGGTAGG + Intronic
950973708 3:17216675-17216697 CCTAGAGTCCTGGTGGTGGGTGG - Intronic
951413183 3:22390393-22390415 CTTAGAATTCTAAAGCTGGAAGG + Intergenic
951696580 3:25451123-25451145 CCTAGATTAAGGAAGGTGGAAGG + Intronic
952535584 3:34305648-34305670 CCCACAATCTTGAAGGTGGTGGG - Intergenic
953070862 3:39518213-39518235 CCTAGAACCCAAAAGGTGCAAGG + Intronic
953165680 3:40462998-40463020 ACTTGAACCCGGAAGGTGGAGGG - Intergenic
954371727 3:50172501-50172523 CCCAGCATCCTGGAGTTGGAGGG + Intronic
954397670 3:50301532-50301554 ACTTGAATCCGGAAGGTGGAGGG + Intronic
955893362 3:63673811-63673833 CTTAGAATCCTAGAGCTGGATGG - Intronic
955898341 3:63725104-63725126 CCTAGAATCCTGAATCCTGAAGG - Intergenic
956436090 3:69235890-69235912 CCTAGAATCCTGGAGGAGTAAGG - Intronic
956907230 3:73779110-73779132 CCAAGAATACTCAAGGTGAAGGG - Intergenic
957873114 3:86112738-86112760 CCTAGATTTCAGAAGGTGTATGG + Intergenic
959608195 3:108264814-108264836 CAAAAAATTCTGAAGGTGGATGG + Intergenic
961900227 3:130202907-130202929 CCTAGACTTCAGAAGGTGTATGG - Intergenic
963832123 3:150019486-150019508 CCTAGAATGTTGATGCTGGAAGG + Intronic
964155515 3:153580799-153580821 TCAAGAAACCTGAAGCTGGAGGG + Intergenic
964927365 3:161975361-161975383 CCTGGAACCCTGAAAGTGCAGGG + Intergenic
965095959 3:164226184-164226206 GCTTGAACCCTGGAGGTGGAGGG + Intergenic
966797199 3:183726882-183726904 GCTTGAACCCTGGAGGTGGAGGG - Intronic
967261108 3:187643291-187643313 CCTAGAATGCCGAAGCTGGGAGG - Intergenic
968690794 4:1988924-1988946 CCTAAAATTCTGAAGTTGGTGGG + Intronic
969011202 4:4064057-4064079 CCTAGATTTCAGAAGGTGTATGG - Intergenic
969742870 4:9045841-9045863 CCTAGATTTCAGAAGGTGTATGG + Intergenic
970129577 4:12852571-12852593 TGTAGAATCCTGAAGCTTGAAGG + Intergenic
970426836 4:15953565-15953587 CCTAGATTTCTGAAGATGTATGG - Intergenic
970705579 4:18797705-18797727 CCTAGAATCCAGAAGCAGGTTGG - Intergenic
971505808 4:27365373-27365395 GCTTGAATCCAGGAGGTGGAGGG + Intergenic
971802966 4:31316759-31316781 ACCAGAATCCTGAAGGATGAGGG - Intergenic
972223507 4:36984255-36984277 GCTTGAACCCAGAAGGTGGAGGG + Intergenic
972467512 4:39371357-39371379 CCTAGATTTCTGAAGATGTATGG + Intergenic
972678151 4:41280093-41280115 CCTGGAAGGCGGAAGGTGGAAGG - Intergenic
972799781 4:42462532-42462554 CCTAGATTTCTGAAGATGTATGG + Intronic
973666379 4:53163645-53163667 GCTTGAATCCAGGAGGTGGAGGG + Intronic
974033644 4:56798059-56798081 CTTAGAATCCTCAAGGTGGCCGG - Intergenic
974742250 4:66021830-66021852 CCTAGATTCCTGAGGATGTATGG - Intergenic
975059261 4:69977663-69977685 CATAGAATCCAGAATCTGGATGG - Intergenic
975902161 4:79165762-79165784 TTTACAATCCTGAAGGTAGACGG + Intergenic
976620566 4:87122975-87122997 ACTAGAACCCAGGAGGTGGAGGG - Intronic
976663943 4:87570437-87570459 CCTGGCATCCTGAAGTTGTAAGG - Intergenic
976709458 4:88053572-88053594 GCTTGAATCCAGAAGGCGGAGGG + Intronic
979700012 4:123656702-123656724 CCTAGATTCCAGAAGATGTATGG - Intergenic
983111818 4:163760009-163760031 CCTACAGTTCTGGAGGTGGAAGG + Intronic
986299656 5:6467949-6467971 GGAAGAATCCTGAAGGCGGAGGG - Intronic
987038702 5:14041752-14041774 GCTGGAATCCTGCAGGAGGAGGG + Intergenic
987567058 5:19602880-19602902 CCTTGAATCCAGGAGGCGGAGGG + Intronic
987734899 5:21828203-21828225 GCTTGAACCCGGAAGGTGGACGG - Intronic
990499957 5:56386195-56386217 CCTTGATTCCTGAAGGTTGCAGG - Intergenic
993661799 5:90646854-90646876 ACTTGAATCCAGAAGGCGGAGGG - Intronic
994324245 5:98430725-98430747 CCTAGAAATCTGAAGCTGGAAGG + Intergenic
994524206 5:100882863-100882885 CCTAGACTTCTGAAGATGTATGG + Intronic
995608910 5:113888814-113888836 CAAAGAAACCTGAAGCTGGAAGG + Intergenic
996988627 5:129600951-129600973 GCTTGAACCCGGAAGGTGGAGGG - Intronic
997664273 5:135616066-135616088 CCTAGATTTCTGAAGATGTATGG + Intergenic
997945269 5:138194802-138194824 GCTAGAATCCGGGAGGCGGAGGG - Intronic
999088746 5:148916228-148916250 CCTTGATTCATGAAGGGGGACGG - Intergenic
999473695 5:151878794-151878816 CCTAGATTTCAGAAGGTGTATGG + Intronic
999756046 5:154665239-154665261 ACTTGAACCCAGAAGGTGGAGGG - Intergenic
1001250688 5:170144541-170144563 CCTTGGCTCCTGTAGGTGGAAGG + Intergenic
1004683065 6:17915543-17915565 CCCAGAGTCCTCAAGGTGGCAGG - Intronic
1006233426 6:32605448-32605470 CCTTGAACCCAGGAGGTGGAGGG + Intergenic
1006559433 6:34897059-34897081 GCTAGAGCCCAGAAGGTGGAAGG + Intronic
1007610307 6:43144702-43144724 CCTAGAATGTTAGAGGTGGAGGG + Intronic
1008834527 6:55808950-55808972 CCTAGATTCATGAAGGTACATGG - Intronic
1008871703 6:56279861-56279883 CCTAGATTACTGAAGGAGGTTGG - Intronic
1009898578 6:69783480-69783502 CTTGGAAGCCTGAAGGTGGGAGG - Intronic
1011546629 6:88488461-88488483 CCTAGAGTCCTGAAGGAGTGGGG - Intergenic
1015331364 6:131983143-131983165 GCTAAAATCCTGAAGTTAGAAGG - Intergenic
1015767217 6:136731416-136731438 CTTAGAATCTTGAAGGGGCAAGG - Intronic
1015944794 6:138488949-138488971 CCTAGAATGCTGGAGCTGAAAGG - Intronic
1016460361 6:144275033-144275055 CCAAGTACCCTGAAAGTGGAGGG - Intergenic
1017796760 6:157851670-157851692 GCTTGAACCCTGGAGGTGGAGGG - Intronic
1019693493 7:2431529-2431551 CCTGGCATCCACAAGGTGGAAGG - Intronic
1019948431 7:4349365-4349387 AAAAGAATTCTGAAGGTGGATGG - Intergenic
1020541553 7:9465187-9465209 CATAGAATTCTGAATATGGATGG - Intergenic
1020729684 7:11866064-11866086 CCTAGAATTCAGAAGATGTATGG + Intergenic
1022119757 7:27296724-27296746 GCTTGAACCCAGAAGGTGGAGGG + Intergenic
1023345895 7:39270929-39270951 CCTAGAATCCTCAAGGCGGAAGG - Intronic
1024236569 7:47403155-47403177 CCTGGATTCCTGAAGAGGGAGGG - Intronic
1026838581 7:73654702-73654724 ACTAGAACCCGGGAGGTGGAGGG + Intergenic
1026888844 7:73970604-73970626 CCAAGAATCCTGATGTTAGACGG - Intergenic
1028760740 7:94493663-94493685 TCTTGAATCCAGGAGGTGGAGGG - Intergenic
1029070490 7:97892071-97892093 CCTAGATTTCAGAAGGTGTATGG - Intergenic
1029503526 7:100948811-100948833 GCTTGAAACCAGAAGGTGGAGGG - Intergenic
1032136933 7:129288441-129288463 GCTTGAACCCAGAAGGTGGAGGG - Intronic
1035698352 8:1618763-1618785 TCAAGAATGCTGAAGGTGCACGG - Intronic
1036248074 8:7137655-7137677 CCTAGACTTCAGAAGGTGTATGG + Intergenic
1036886174 8:12555343-12555365 CCTAGATTTCAGAAGGTGTATGG - Intergenic
1036893790 8:12614431-12614453 CCTAGATTTCAGAAGGTGTAAGG - Intergenic
1037278169 8:17203888-17203910 GCTTGAATCCGGGAGGTGGAGGG - Intronic
1037526722 8:19731423-19731445 CCTGGAACCCGGGAGGTGGAGGG + Intronic
1037897241 8:22666150-22666172 CCTAAAATCATCAAGGTGTATGG + Intronic
1038108681 8:24467980-24468002 CCTTGAACCCAGGAGGTGGAAGG + Intronic
1038457808 8:27689314-27689336 CCTAGAATGCTGAGAGTGAATGG + Intergenic
1042974070 8:74445120-74445142 CATAGAATCATGGAGTTGGAAGG + Intronic
1043080606 8:75760794-75760816 CCTAGATTTCAGAAGGTGTATGG + Intergenic
1044003773 8:86916951-86916973 ACTAGAACCCAGGAGGTGGAGGG - Intronic
1045610466 8:103835182-103835204 CCTTGAACCCGGGAGGTGGAGGG - Intronic
1046814773 8:118571747-118571769 CCTAGATTCCAGAAGATGTATGG + Intronic
1047409930 8:124615965-124615987 AGGAGAATCCTGAAGGTCGAAGG - Intronic
1047857322 8:128925826-128925848 CCTTGAACCCGGGAGGTGGAGGG - Intergenic
1049713293 8:144077160-144077182 ACTTGAACCCTGGAGGTGGAGGG + Intergenic
1050052857 9:1621547-1621569 CCCAGTATCCTGAGGATGGAGGG + Intergenic
1050402622 9:5271964-5271986 CCTAGAGACCTGAAGGAGGTAGG - Intergenic
1051283476 9:15468035-15468057 GCTTGAACCCAGAAGGTGGAGGG + Intronic
1052520588 9:29543433-29543455 CATAGAAACCTGAATATGGATGG - Intergenic
1052530847 9:29682427-29682449 CCTAGATTCCAGATGGTGTATGG + Intergenic
1052683242 9:31721367-31721389 ACTTGAACCCAGAAGGTGGAGGG + Intergenic
1053111573 9:35465018-35465040 GCCTGAATCCTGAAGGTGTAGGG - Intergenic
1053202387 9:36161627-36161649 CCTAGAAACCAAAAGGGGGAGGG + Intronic
1054943330 9:70767964-70767986 CCCAGAATCAAGAAGATGGAAGG + Intronic
1055341358 9:75287496-75287518 CCTACAAGCCAGAAGGGGGAGGG - Intergenic
1056463437 9:86830269-86830291 ACAAGGATCCTGAAGGTGCAGGG - Intergenic
1059693180 9:116706084-116706106 CTTAGAGTCCTGAGGGTGGAGGG + Intronic
1061542022 9:131282738-131282760 CCTAGAAACCTCCAGGAGGATGG - Intergenic
1188354426 X:29174001-29174023 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1188709828 X:33381763-33381785 CCTAAAGTCCTGAGGGTGGTGGG + Intergenic
1189315672 X:40054586-40054608 CCTTGAACCCGGGAGGTGGAGGG - Intronic
1189487357 X:41443808-41443830 TCCAGTCTCCTGAAGGTGGATGG - Intergenic
1190243818 X:48677307-48677329 CCTGGAAGCCTGAGGGAGGAAGG + Intronic
1191587147 X:62840426-62840448 CCGTGAATCCTGAAGGTCAAAGG + Intergenic
1192218661 X:69181554-69181576 CCTAGAATCCTGAAGTTTGAGGG + Intergenic
1193279365 X:79628702-79628724 CCTAGATTTCTGAAGATGTATGG + Intergenic
1193498394 X:82240914-82240936 CCTAGATTTCAGAAGGTGTATGG + Intergenic
1193769263 X:85569310-85569332 CCTAGAAGCCTGGAGGTGTAAGG + Intergenic
1193979791 X:88168359-88168381 CCTAGAATTCAGAATCTGGATGG - Intergenic
1194950856 X:100124005-100124027 CCTAGAATGCTGAAGGGTTAAGG - Intergenic
1196482894 X:116170673-116170695 CCTAGAATTATGTAGGTTGAAGG + Intergenic
1197230994 X:124003502-124003524 GCTTGAACCCGGAAGGTGGAGGG - Intronic
1197696584 X:129556401-129556423 CCTAGACTCCTGAAAGTGCTGGG + Intronic
1199228842 X:145410882-145410904 CATAGACTCTTCAAGGTGGAAGG + Intergenic