ID: 1128151754

View in Genome Browser
Species Human (GRCh38)
Location 15:65367621-65367643
Sequence GAGAGTGGCCAGCGGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 400}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128151754_1128151770 25 Left 1128151754 15:65367621-65367643 CCCGCCACCCGCTGGCCACTCTC 0: 1
1: 0
2: 3
3: 34
4: 400
Right 1128151770 15:65367669-65367691 ACTCCTCTCTCACTTCAGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 265
1128151754_1128151760 -7 Left 1128151754 15:65367621-65367643 CCCGCCACCCGCTGGCCACTCTC 0: 1
1: 0
2: 3
3: 34
4: 400
Right 1128151760 15:65367637-65367659 CACTCTCCACCCAGTGTCCCAGG 0: 1
1: 1
2: 3
3: 35
4: 290
1128151754_1128151773 30 Left 1128151754 15:65367621-65367643 CCCGCCACCCGCTGGCCACTCTC 0: 1
1: 0
2: 3
3: 34
4: 400
Right 1128151773 15:65367674-65367696 TCTCTCACTTCAGCTTGGTTGGG 0: 1
1: 0
2: 0
3: 25
4: 282
1128151754_1128151772 29 Left 1128151754 15:65367621-65367643 CCCGCCACCCGCTGGCCACTCTC 0: 1
1: 0
2: 3
3: 34
4: 400
Right 1128151772 15:65367673-65367695 CTCTCTCACTTCAGCTTGGTTGG 0: 1
1: 0
2: 1
3: 15
4: 193
1128151754_1128151761 -6 Left 1128151754 15:65367621-65367643 CCCGCCACCCGCTGGCCACTCTC 0: 1
1: 0
2: 3
3: 34
4: 400
Right 1128151761 15:65367638-65367660 ACTCTCCACCCAGTGTCCCAGGG 0: 1
1: 0
2: 1
3: 17
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128151754 Original CRISPR GAGAGTGGCCAGCGGGTGGC GGG (reversed) Intronic
900387601 1:2417650-2417672 GAGTGTGGCCAGCCGGTGAGGGG + Intergenic
900397056 1:2457346-2457368 GTGAGTGGCCAGGGGCTGGGGGG + Intronic
900611343 1:3545820-3545842 GCTTGTGGCCAGCGGGAGGCTGG - Intronic
900947360 1:5838622-5838644 GAGACAGGCAAGCGGGAGGCTGG + Intergenic
900977946 1:6028758-6028780 GACAGTGGCCACCAGGAGGCGGG - Intronic
901230872 1:7641170-7641192 GAGAGCCGCCAGCGGCTGCCGGG - Intronic
901883055 1:12205162-12205184 GAGGGAGGCCAGGGGGTGGAGGG + Intronic
902369558 1:15997331-15997353 GACAGTGGCCAGGGTGAGGCTGG - Intergenic
902532464 1:17099159-17099181 GAGGGTCGCCAGAGAGTGGCAGG + Intronic
902781534 1:18708189-18708211 GAGAGTGGGCTGGGGGTTGCGGG - Intronic
902882249 1:19380159-19380181 GAAAGCTGCCTGCGGGTGGCTGG - Intronic
903221010 1:21869752-21869774 GACAGTGCAGAGCGGGTGGCTGG - Intronic
903336690 1:22629141-22629163 GAGAGTGGCCAGGGAGAGCCTGG - Intergenic
903670175 1:25030885-25030907 GAGACTGGCCAGGGTGGGGCTGG - Intergenic
903750197 1:25616744-25616766 GGGCGTGGCCGGCGGGCGGCAGG + Intergenic
903806498 1:26009402-26009424 GGGAGGGGCCAGCGCTTGGCGGG + Intergenic
905847090 1:41242167-41242189 GAGAGCGGCGGGCGGGCGGCGGG + Intergenic
906063165 1:42961399-42961421 GAAAGTGGCCAGCATGGGGCTGG - Intergenic
906320615 1:44813319-44813341 GAGACTGGTGAGCGGGCGGCAGG + Intronic
906666419 1:47625353-47625375 GAGATTGGCCAGGGGTGGGCAGG - Intergenic
906677445 1:47703248-47703270 GAGTGTGGCCATCGGGTGCCGGG - Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
910759438 1:90719754-90719776 GACAGTGGCCAGAGGGGTGCGGG + Intergenic
912548463 1:110467870-110467892 CAGGGTGGCCATCTGGTGGCTGG + Intergenic
914424520 1:147562763-147562785 GAGTGTGGACGGGGGGTGGCAGG + Intronic
915275318 1:154784345-154784367 TAGAGGGGCCAGCTGGTGCCAGG - Intronic
915836623 1:159181819-159181841 GAGACTGGGAAGTGGGTGGCAGG - Intronic
915923972 1:160002204-160002226 AAGAGTTGCCATGGGGTGGCTGG - Intergenic
917749059 1:178037971-178037993 GGGAGTGGCCAGAGCGCGGCAGG + Intergenic
922100986 1:222476682-222476704 TAGAGAGGCCACTGGGTGGCAGG + Intergenic
923211402 1:231807241-231807263 GGGAGTGGCCAGAGCTTGGCTGG - Intronic
923403338 1:233636850-233636872 GAGAATGGGCAGTAGGTGGCAGG + Intronic
924381966 1:243473910-243473932 GAGAGTTGCCGGCGGGGGGGGGG + Intronic
1062857079 10:784762-784784 CAGAGGGGCCAGCGGGGAGCCGG - Intergenic
1062938316 10:1403997-1404019 GAGAGTGGATGGGGGGTGGCTGG - Intronic
1067710859 10:48650036-48650058 GAGAGAGACCAGGAGGTGGCAGG + Intronic
1067749836 10:48963659-48963681 TAGGGTGGCCCTCGGGTGGCTGG + Intronic
1069827050 10:71260799-71260821 ATGAGTGGGCAGTGGGTGGCTGG + Intronic
1070159778 10:73859257-73859279 GACAGTGGCCAGCGGGCTGCAGG + Intronic
1070648631 10:78219242-78219264 GAGAGTGGCCCCCTGGTTGCTGG + Intergenic
1070791483 10:79192119-79192141 GAGTATGGCCAGAGGATGGCAGG + Intronic
1072749847 10:97969888-97969910 GAGAGTTGTCAGCGGGTAGATGG - Intronic
1073121237 10:101123556-101123578 GCGGGTGGCGCGCGGGTGGCAGG + Intronic
1073578067 10:104641513-104641535 GGCAGTGGCCAGCCAGTGGCCGG + Exonic
1076674155 10:132139725-132139747 GACAGGGGCCAGTGGTTGGCGGG + Intronic
1076790818 10:132775813-132775835 GAGAGAAGCCAGGGCGTGGCAGG - Intronic
1076828083 10:132980465-132980487 GTGAGTGCCCAGCGAGTGCCCGG + Intergenic
1076828099 10:132980542-132980564 GAGAGTGCCCAGCGAGTGCCCGG + Intergenic
1076828117 10:132980629-132980651 GCGAGTGCCCAGCGAGTGCCCGG + Intergenic
1076828133 10:132980706-132980728 GCGAGTGCCCAGCGAGTGCCCGG + Intergenic
1076828140 10:132980739-132980761 GCGAGTGCCCAGCGAGTGCCCGG + Intergenic
1076828152 10:132980804-132980826 GTGAGTGCCCAGCGAGTGCCCGG + Intergenic
1076828159 10:132980837-132980859 GCGAGTGCCCAGCGAGTGCCCGG + Intergenic
1076889117 10:133275378-133275400 GTGAGAGGCCAGTGGGTGTCTGG - Intronic
1076909606 10:133380301-133380323 GAGATTGGCCAGCACGTGGCCGG + Exonic
1077241398 11:1512396-1512418 GAGAGTGGGCAGTGGGCAGCAGG - Intergenic
1077302067 11:1852018-1852040 GAGAGAGGCCAGGGGTTGGGAGG - Intergenic
1077360533 11:2138589-2138611 GAGAGAGGACAGCGAGAGGCGGG + Intronic
1077392800 11:2307791-2307813 GAGAGGGGACAGTGGTTGGCCGG + Intronic
1077423889 11:2465577-2465599 GAGAGGGGCCAGCACGGGGCAGG - Intronic
1078655875 11:13238575-13238597 GAGGGTGGGCAGCGGGAGGATGG + Intergenic
1079254054 11:18811271-18811293 GAGAGTGGGCAGCTGGAGGATGG + Intergenic
1080387722 11:31819555-31819577 TAGAGTGGCCAGTGGGAGGTGGG - Intronic
1081566518 11:44264198-44264220 GAGAGTGGGCAGAGGATGACAGG - Exonic
1081668713 11:44931575-44931597 GAGGGTGGCCAGTGGCTGGCTGG - Exonic
1081781519 11:45716376-45716398 GAGAGGAGCCAGCTGGTGGGGGG + Intergenic
1081834619 11:46143593-46143615 GAGAGTGCCCGCCGGGTGTCAGG + Intergenic
1083270605 11:61570319-61570341 GAGGGTGGCCAGAGGCTGGAAGG + Intronic
1083292962 11:61699935-61699957 GAGGGTGGCAGGCAGGTGGCCGG + Intronic
1083923773 11:65793969-65793991 GAGAGGGTCCAGCGGGTTTCTGG - Intronic
1084033753 11:66495603-66495625 GAGAGGGGCAGGCAGGTGGCAGG - Intronic
1084086394 11:66857171-66857193 GAGGGTGGGCGGCGGGCGGCCGG + Intronic
1084168639 11:67389608-67389630 GAGAGTGGCCTGGAGGGGGCAGG + Intronic
1084529164 11:69717023-69717045 GAGGGTGGCCAGAGGGAGCCAGG + Intergenic
1084570668 11:69957790-69957812 GAGAGTGGCTGGGGGGTGGTAGG + Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084967785 11:72753414-72753436 GTGAATGGCCAGTGGGGGGCAGG - Intronic
1085304391 11:75476898-75476920 TGGAGTGGCCAGGGGGTGGCAGG - Intronic
1087001948 11:93430136-93430158 AACAGTAGCCAGAGGGTGGCAGG - Intronic
1087007441 11:93483510-93483532 GAGAGAGGCCTGGGGGTGGAGGG + Intronic
1087182035 11:95150849-95150871 GAGAGAGGCCAGCAGGTATCGGG - Intergenic
1087230064 11:95651023-95651045 GAGTGTGGCCAGTGGGTCACTGG - Intergenic
1088462184 11:110093375-110093397 GAAAGCGGCGAGCGGGCGGCGGG - Exonic
1088812971 11:113403945-113403967 GAGAGTGGCCAGCTGAAGGAGGG + Intergenic
1088906994 11:114162576-114162598 GAGAGTGGGCAGAGGGTGCATGG - Intronic
1090211037 11:124921262-124921284 GAGTGTGTCCGGCCGGTGGCTGG + Exonic
1090709949 11:129375434-129375456 GAGCCGGGCCGGCGGGTGGCAGG + Intergenic
1090805018 11:130197538-130197560 CAGAGAGGCCAGCTGGTCGCAGG - Intronic
1091628168 12:2138570-2138592 GAGAGTGACCAGCAGCAGGCCGG + Intronic
1091996272 12:4996604-4996626 GACAGTGTACAGCGGGTGGCAGG + Intergenic
1093411939 12:18877903-18877925 AAGAATGGCCAGTGGCTGGCTGG + Intergenic
1094718347 12:33034938-33034960 GAGAGGGACCAGCGGTGGGCAGG + Intergenic
1094758565 12:33500514-33500536 GAGAGTGGATAGTGGGTGCCAGG - Intergenic
1098330183 12:69344790-69344812 GAGAGTTGCCGGGGGTTGGCGGG - Intergenic
1098429567 12:70405005-70405027 AAGAGTGGCCAGAGGGTGAAAGG + Intronic
1101598756 12:106190090-106190112 CATAGAGGCCAGAGGGTGGCTGG + Intergenic
1102010976 12:109618109-109618131 GGGAGTGGCCAGGGGGCAGCAGG - Intergenic
1102500906 12:113351869-113351891 GTGATTGGCCAGGGGGTGGAGGG - Intronic
1103484131 12:121271396-121271418 GAGAGTGGCCACCTGGGGGAGGG - Intronic
1103902159 12:124308934-124308956 GACAGCTGCCAGCGCGTGGCGGG + Intronic
1104849089 12:131862705-131862727 GTGGGTGGCCAGCTGATGGCGGG - Intergenic
1104904146 12:132204584-132204606 GAGATTGGCCGTCGGCTGGCAGG - Intronic
1104930831 12:132338626-132338648 GTGAGGGGCCGGCGGGTGACAGG + Intergenic
1104980442 12:132570998-132571020 GATGCTGGCCTGCGGGTGGCTGG + Intronic
1104992710 12:132635126-132635148 AGGAGTGGCCAGAGAGTGGCTGG - Intronic
1105920514 13:24958955-24958977 CAGAGTGGGGAGGGGGTGGCAGG + Intergenic
1106696130 13:32175397-32175419 GTGAGTGCCCAGAGGGTGGAAGG - Intronic
1108567898 13:51719293-51719315 GAGAGTGGGCAGCGCCTGGGAGG + Exonic
1111580076 13:90211327-90211349 CAGAGTGTCCATCAGGTGGCAGG - Intergenic
1115664767 14:35534527-35534549 CGGAGTGGCGGGCGGGTGGCAGG + Exonic
1116452319 14:45080437-45080459 GAGAGGAGCCAGCGGGAAGCGGG + Intergenic
1119467032 14:74866345-74866367 GAGGGTGGTCAGCATGTGGCTGG + Intronic
1121448275 14:93992216-93992238 GAGAGTGGCCCGCAGGGGACAGG + Intergenic
1121545943 14:94763755-94763777 GTGAGTGGACAGCTGGTGGCTGG - Intergenic
1122171059 14:99876189-99876211 GAGAGTGGCCAGCCCCAGGCAGG + Intronic
1122363710 14:101182285-101182307 GAGAGTGTCCAGAGAGTGACCGG + Intergenic
1123112075 14:105877058-105877080 GAGAGTTGCCAGCGGACGCCTGG - Intergenic
1123703149 15:22930932-22930954 GTGAGTGGCGAGCGAGTGGGAGG - Intronic
1124400544 15:29344170-29344192 TGGAGTGGCCAGCCTGTGGCTGG + Intronic
1126104956 15:45141411-45141433 GTGAGTGGCCAAGGGGTGGCTGG + Intronic
1126683717 15:51228530-51228552 GAGCTTGGCCAGCGCCTGGCTGG + Intronic
1127768081 15:62207538-62207560 GAGAGACGCCAGCGGGAGCCGGG + Intergenic
1127843378 15:62848871-62848893 GAGAGTTACCAGGAGGTGGCAGG - Intergenic
1128151754 15:65367621-65367643 GAGAGTGGCCAGCGGGTGGCGGG - Intronic
1128301234 15:66567569-66567591 GAGGGAGGCCAGGGGGTGGGTGG + Intergenic
1128532615 15:68464912-68464934 GAGAGAGGCCAGAGGGAGGCTGG - Intergenic
1128813816 15:70591019-70591041 GAGAGTGGAGGGCGGGGGGCGGG + Intergenic
1129181666 15:73881777-73881799 GAGGGGGGCCTGCAGGTGGCAGG + Intronic
1129295079 15:74595785-74595807 GAGAGTGGCAAGTGGGAAGCTGG - Exonic
1129463603 15:75712024-75712046 GAGAGTGGGTAGTGGGTGGGGGG + Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129721285 15:77879378-77879400 GAGAGTGGGTAGTGGGTGGGGGG - Intergenic
1129769820 15:78195827-78195849 GGGTCTGGCCAGCAGGTGGCAGG - Intronic
1131117425 15:89803710-89803732 GGGTGTGGACAGCGGGTGGGAGG + Exonic
1132336964 15:101053875-101053897 CAGAGTGGCCAGAGGGTGAAAGG + Intronic
1133015162 16:2936449-2936471 AGGAGAGGCCAGCGGGGGGCGGG - Intronic
1133103881 16:3494686-3494708 CACACTGGCCAGTGGGTGGCGGG + Exonic
1133220430 16:4317112-4317134 CAGCCTGGCCAGAGGGTGGCCGG + Intronic
1134346329 16:13395105-13395127 GAGTGTGGACAGAGGTTGGCAGG + Intergenic
1136477770 16:30524275-30524297 GAGAGAGGTCAGCGGAGGGCTGG - Exonic
1137704650 16:50526300-50526322 GAGAGTGGCCTTGGGGAGGCAGG - Intergenic
1138142701 16:54582528-54582550 GCCAGTTGCCAGGGGGTGGCGGG - Intergenic
1138536402 16:57662671-57662693 GAGCGTGGCCAGATGGCGGCGGG + Intronic
1139489688 16:67279629-67279651 GAGTGTCGCCAGCGGGCGACGGG + Exonic
1140033737 16:71357972-71357994 GAGCATGGCCAGCGTGAGGCAGG + Intergenic
1140389220 16:74570888-74570910 TTGAGGGGCCAGCGGGTGGTAGG - Intronic
1141822949 16:86460244-86460266 GGGAATGGCCAGCAGGTTGCAGG + Intergenic
1141997081 16:87642299-87642321 GAGAGGCTGCAGCGGGTGGCAGG - Intronic
1142012481 16:87722904-87722926 GAGGGTGGGTGGCGGGTGGCAGG + Intronic
1142284949 16:89167875-89167897 CAGAGGGGTCAGGGGGTGGCGGG - Intergenic
1142683327 17:1562607-1562629 GAGAGCGGCCGGCGGGCAGCGGG - Exonic
1143273099 17:5690067-5690089 GGTAGGGGCCAGAGGGTGGCAGG + Intergenic
1143373973 17:6456681-6456703 GAGAGTGACCCGCGGGTAGAGGG - Intronic
1143770478 17:9165342-9165364 GAGAATGGCCTGCGGGTTCCCGG - Intronic
1145250397 17:21294016-21294038 GAGAGGGGCCAGTGTCTGGCAGG + Intronic
1146002424 17:29139340-29139362 GCTAGTGGCCCGGGGGTGGCTGG + Intronic
1147384680 17:40074279-40074301 GGGAGGGGCCAGGGAGTGGCAGG - Exonic
1147537697 17:41331714-41331736 GACAGTGGCCAGGGTGAGGCTGG - Intergenic
1147807777 17:43144370-43144392 GAGAGGGGCCAGGAGGTGGTAGG + Intergenic
1148078674 17:44955283-44955305 GAGAGGGGGCAGCTGGGGGCTGG - Intergenic
1148143067 17:45342026-45342048 GGAAGAGGCCAGCGGGAGGCTGG - Intergenic
1148237128 17:45976390-45976412 GAGAGTGGCTTGGGGGTGGTGGG - Intronic
1150293949 17:63998196-63998218 GAGACTGGCCTCCTGGTGGCGGG + Intergenic
1151333214 17:73423483-73423505 GAGAGTGGCCACTGGGTGCTCGG + Exonic
1151947829 17:77329181-77329203 GAGAATGGCCAGGGGCAGGCAGG + Intronic
1152279398 17:79376402-79376424 GAGAGGGTCCTGCGGGTGCCTGG - Intronic
1152744187 17:82031597-82031619 GAGCGCGGCCGGCGGGGGGCGGG - Intergenic
1156469660 18:37369250-37369272 GGGGGTGGGCAGCGGGAGGCTGG + Intronic
1156787736 18:40935899-40935921 GAGAATGGACAGCAGGTGGTAGG + Intergenic
1157268303 18:46248367-46248389 GAGGGTGAGCAGTGGGTGGCTGG + Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1158623214 18:59050126-59050148 GAGAGTGTCCGGTGGGTGGGAGG - Intergenic
1160783597 19:889564-889586 GAGAGGGGCTGGCGGGTGGCTGG + Intronic
1160835637 19:1123275-1123297 GGGCGTGGCCAGCGGCTTGCAGG + Intronic
1160932602 19:1577804-1577826 GAGAGCAGCCAGCAGGTGCCCGG - Exonic
1161353624 19:3807024-3807046 GAGGGCGGCCCGTGGGTGGCAGG - Intronic
1161613365 19:5256551-5256573 GAGTGTGGACAGCGGGTGTGGGG - Intronic
1162054129 19:8052693-8052715 GAGGGCGGGCAGGGGGTGGCTGG + Intronic
1162385158 19:10356653-10356675 GAGTGTGGCCAGCTGTGGGCAGG + Exonic
1162526308 19:11208888-11208910 GTGAGTGGCCAGGGGTTGGCAGG - Intronic
1162805416 19:13135766-13135788 GACAGTGGCCAGAAGGAGGCTGG + Exonic
1162805522 19:13136200-13136222 GAGAGTGGCACGCGAGTGGCAGG - Intronic
1163303785 19:16464406-16464428 GAGAGTGGCCAGTGGCTGGTGGG - Intronic
1163321342 19:16576772-16576794 GAGAGCCACCAGCGGCTGGCGGG - Exonic
1163404192 19:17112403-17112425 GCCAGTGGCCAGAGGGAGGCTGG + Intronic
1163560188 19:18014395-18014417 GAGAGTGGGGAGCAGGGGGCTGG + Intergenic
1163664595 19:18597394-18597416 GTGAGTGGGGAGGGGGTGGCAGG - Intronic
1163667244 19:18609065-18609087 GAGGATGGCGAGAGGGTGGCAGG - Intronic
1164767652 19:30784123-30784145 GTGAATGGCCATCAGGTGGCGGG + Intergenic
1166112209 19:40629553-40629575 GTGGGCGGCCAGCGGGTGCCAGG - Exonic
1166147719 19:40848787-40848809 GAGACAGGCCAGGGGGCGGCAGG + Intronic
1166178308 19:41090001-41090023 GAGAGAGGTCAGGGGGCGGCGGG - Intronic
1166895912 19:46021891-46021913 GACAGAGGCCTGCAGGTGGCAGG - Intronic
1166975929 19:46605011-46605033 GGGACTGGCCAGTGGGTGGCAGG - Intronic
925145911 2:1583272-1583294 AAGAGTGACCAGCGGGAGGGAGG - Intergenic
925154156 2:1637388-1637410 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154165 2:1637462-1637484 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154187 2:1637610-1637632 CAGAGTGGACAGCGTGCGGCAGG - Intronic
925154201 2:1637684-1637706 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154217 2:1637759-1637781 CAGAGTGGACAGCGTGTGGCAGG - Intronic
931382347 2:61765183-61765205 AATAGTGGCCAGAGGGGGGCCGG - Intergenic
931857481 2:66318340-66318362 TAGAGTTCCCAGTGGGTGGCAGG - Intergenic
932432668 2:71685238-71685260 GAGAGTGGCCCGCTGCTGGGGGG - Intronic
935321492 2:101893838-101893860 CAGAGTGCCCACCGGGTGCCTGG - Intronic
936481780 2:112891441-112891463 GAAAGAGGCCAGCTGGTGGTAGG + Intergenic
937040744 2:118818815-118818837 GGGAGTGGGCAGCATGTGGCCGG - Intergenic
937995983 2:127695529-127695551 GAGAGCGGCCCGCGGCCGGCGGG + Intergenic
938407482 2:131040502-131040524 CAGCGCGGACAGCGGGTGGCTGG + Intronic
939309950 2:140463165-140463187 GACAGTGGCCAGTGGGAGGGTGG + Intronic
944502860 2:200379670-200379692 GGGATTTGCCAGCGGGTGGTGGG + Intronic
944579090 2:201116653-201116675 GGCAGTGGCCAGGGGATGGCGGG + Intronic
944621750 2:201522893-201522915 GGGAGTGGCCAGCAGATGGGAGG - Intronic
945019485 2:205556896-205556918 GAGAATTGCGAGCGGCTGGCAGG - Intronic
948303940 2:236932692-236932714 GAGAGTAGCCTGGGGGTGGGGGG + Intergenic
948586135 2:239020896-239020918 GACAGTGACCAGCGGGTGTTGGG + Intergenic
948801626 2:240435877-240435899 GAGAGGCGCGGGCGGGTGGCCGG + Exonic
948998685 2:241598710-241598732 GTGAGTGGCCAGCAGGTGAGTGG - Intronic
1171175536 20:23048969-23048991 GCCAGTGGCCTGCAGGTGGCTGG + Exonic
1171242326 20:23581897-23581919 GAGAGGGACCAGCGGTGGGCAGG + Intergenic
1171425097 20:25044015-25044037 GAGAGTGGACTGTGGGTGCCAGG - Intronic
1171511266 20:25686476-25686498 GAGAGAAGTCAGAGGGTGGCTGG + Exonic
1172192218 20:33068974-33068996 GTGAGTGGTCAAGGGGTGGCTGG + Intronic
1172271833 20:33659464-33659486 GAGAGGGGCAAGCGGCTGGATGG - Intronic
1172641291 20:36441945-36441967 GGGACTGGGCAGCGGGTGGTGGG - Intronic
1173246305 20:41340166-41340188 GACACTGGCCAGCAGGGGGCAGG - Intergenic
1173698930 20:45049175-45049197 GAGGGTGGCCAGCAGCTGGAGGG + Intronic
1174203950 20:48826341-48826363 AAAAGTGGCCAGCGGGTGGAGGG - Intronic
1174885098 20:54325140-54325162 GAGAGTGGGCAGAGGGAGGTAGG + Intergenic
1175076811 20:56382292-56382314 GACTGTGGCCAGCGGGAAGCAGG + Intronic
1175287221 20:57844978-57845000 GAGAGTGGCTCGCTAGTGGCTGG - Intergenic
1175541775 20:59752375-59752397 GAGAGTGGCCGGGCGGAGGCTGG + Intronic
1175893910 20:62327689-62327711 GAGAGTGGTCGGCAGGTGCCAGG + Intronic
1176032402 20:63019191-63019213 GTGGGTGGCGAGCGGGTGGGCGG - Intergenic
1176032407 20:63019206-63019228 GTGAGTGGCGAGCGGGTGGGTGG - Intergenic
1176134864 20:63518068-63518090 GACAGTGGCTACAGGGTGGCAGG + Intergenic
1178356507 21:31913845-31913867 GAGAGTAGCCTCCGGGTGCCAGG + Intronic
1178397943 21:32259215-32259237 GAGAGTGGCCAGGGGCTCGAGGG + Intergenic
1178962894 21:37084180-37084202 GAGAGTTGACATTGGGTGGCGGG + Exonic
1179176341 21:39010759-39010781 GAGGGAGGCCTGGGGGTGGCAGG - Intergenic
1179178591 21:39026505-39026527 GAAAGAGGCCAGAGGGAGGCTGG + Intergenic
1179908210 21:44435036-44435058 GAGAGGGGACAGCGGGCGTCAGG - Intronic
1179965296 21:44801532-44801554 GAGAGTGGGCAGCGGGCGCAGGG + Intronic
1180159187 21:45991451-45991473 GAGGGTGGTGAGCGGGTGGGAGG + Intronic
1180159195 21:45991474-45991496 GCGAGTGGGCAGCGGGAGGGCGG + Intronic
1181162830 22:20967921-20967943 GCGAGTGGCCTGAGGATGGCCGG - Exonic
1181483956 22:23218956-23218978 CAGAGCGGCCAGCTGGTGCCGGG + Intronic
1181648792 22:24247688-24247710 GAGAGTGGCCAGCTGATGCCGGG - Intergenic
1181674318 22:24441867-24441889 GAGAGTGGTGTGTGGGTGGCAGG - Exonic
1182415319 22:30217700-30217722 GAAAGTGGCCACAGGCTGGCTGG - Intergenic
1182775110 22:32825238-32825260 CAGGGTGGCCAGCTGATGGCTGG + Intronic
1182797416 22:33000872-33000894 AGGAGCGGCCAGCAGGTGGCAGG - Intronic
1183585482 22:38750791-38750813 GAGAGAGGGCAGCATGTGGCAGG - Intronic
1184039746 22:41935721-41935743 GCGAGAGGGCAGGGGGTGGCAGG - Intergenic
1184406684 22:44304536-44304558 CAGAGAGGCCTGCGGGTGGATGG - Intronic
1184478888 22:44736019-44736041 AAGAGTGGCCACCAGGTGGCGGG - Intronic
1184551970 22:45209357-45209379 GAGGGTGGCCTGCAGGGGGCAGG - Intronic
1184871139 22:47239196-47239218 GAGAGTGGCCAGAGTCTTGCTGG + Intergenic
1184988586 22:48152827-48152849 TAGAGGGGCCAGGGGCTGGCAGG + Intergenic
1185057637 22:48589240-48589262 GAAGGTGGCCAGGGGGTGACTGG + Intronic
950310622 3:11954733-11954755 GAGAGGAGCCAGCGAGTGACGGG + Intergenic
950505765 3:13393562-13393584 GCCAGTGGCCAGCAGCTGGCAGG - Intronic
950639568 3:14340062-14340084 GGGAGTGGGCAGAGAGTGGCTGG + Intergenic
951543846 3:23806673-23806695 GGGAGAGGCCGGCGGGGGGCAGG - Intronic
952316744 3:32238635-32238657 GAGAGGGGCGGGCGGGAGGCGGG - Intergenic
952926826 3:38326492-38326514 GAAAGTGCCCAACAGGTGGCAGG + Intergenic
953320267 3:41964897-41964919 GAGAGTCAGCAGCGGGTGGTGGG - Intergenic
953431944 3:42847303-42847325 CTGAGTGGCCAGCGGGGGCCAGG + Intronic
953714042 3:45300838-45300860 GAGAGTTGCCAGCTGGCTGCTGG - Intergenic
954763132 3:52891504-52891526 GAGAGAGGGCAGTGGGTGCCTGG - Intronic
954873800 3:53787541-53787563 GAGAGGGACCAGAGGCTGGCTGG - Intronic
955660271 3:61291466-61291488 GAGAGTGGAGAGTGGGTGGAGGG + Intergenic
955746159 3:62142346-62142368 GAGAGTGACAAGGGGCTGGCTGG + Intronic
956657110 3:71563119-71563141 GACTGTGGCCAGGGAGTGGCTGG + Intronic
958908326 3:99965933-99965955 GAGAGTGGAGAACTGGTGGCAGG - Intronic
962498411 3:135965698-135965720 GGTAGGGGCCTGCGGGTGGCTGG + Exonic
968446011 4:652386-652408 GAGAGTGGAAAGGGGGTTGCAGG + Intronic
968539432 4:1156224-1156246 GGGAGTGGCGAGGGGTTGGCTGG + Intergenic
968642313 4:1720938-1720960 TAGAGTGCCCCGCGGGCGGCCGG - Exonic
968642327 4:1720980-1721002 TAGAGTGCCCCGCGGGCGGCCGG - Exonic
968642341 4:1721022-1721044 TAGAGTGCCCCGCGGGCGGCCGG - Exonic
968642355 4:1721064-1721086 TAGAGTGCCCCGCGGGCGGCCGG - Exonic
969182413 4:5452264-5452286 CAGAGAGGCCAGCGAGTGGAGGG + Intronic
969858932 4:10020894-10020916 GTGAGTGGGGAGCGGGTGGAGGG - Intronic
972628453 4:40822952-40822974 CAGTGTGGCCAGCTGGAGGCAGG + Intronic
974409242 4:61517536-61517558 GAGAGAGGGCTGGGGGTGGCTGG + Intronic
974447705 4:62007732-62007754 AGGAGTGGCCAAGGGGTGGCTGG - Intronic
979546953 4:121950783-121950805 GAGAGTGGGCATCGGGCAGCCGG - Intronic
979561682 4:122108432-122108454 GAGAGGGACCAGCGGTGGGCTGG - Intergenic
980799726 4:137733738-137733760 GAGAGGCGCCAGCGGGAGCCAGG + Intergenic
981614081 4:146628207-146628229 GAGATGGGCCATTGGGTGGCTGG + Intergenic
982485807 4:155964516-155964538 GAGTGGGGTCAGCGGATGGCAGG - Intergenic
984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG + Intergenic
984928426 4:184826181-184826203 GCGCGTGGCTGGCGGGTGGCCGG + Intronic
985698919 5:1358816-1358838 TGGAGAGGCCAGCAGGTGGCAGG + Intergenic
988902256 5:35745785-35745807 GAGAGGGACCAGCGGTGGGCTGG - Intronic
992716277 5:79514129-79514151 CAGAGTGGGCTGCGGGGGGCGGG + Exonic
994525638 5:100902110-100902132 CACAGAGGCCAGCGGGTGGAAGG + Intronic
995320032 5:110824034-110824056 GAGAGTGACTAGGGGGTGGGTGG - Intergenic
995623895 5:114056177-114056199 GCGAGTGGGCAGCGGGGGCCTGG + Intergenic
997507595 5:134430303-134430325 GAGACTGGCCAGGGGCTGGTTGG + Intergenic
997527779 5:134564548-134564570 GACAGAGCCCAGCGGCTGGCTGG - Exonic
997806859 5:136926863-136926885 GAGCTTGGGCAGGGGGTGGCAGG - Intergenic
998352923 5:141512715-141512737 GCGGGTGGGCAGCGGGCGGCGGG + Exonic
999287170 5:150401001-150401023 GAGAGAGGCCAGATGGTGGAGGG - Intergenic
1000091481 5:157933062-157933084 TAGAGTGGGCAGCAGGAGGCTGG + Intergenic
1002134322 5:177098578-177098600 GAGACTGGCCAGGGCGGGGCGGG - Intergenic
1002493936 5:179599268-179599290 CAGAGTGGGCAGCTGGTGGAGGG + Intronic
1004320617 6:14628819-14628841 GACAATGGCCAGCGAGTGGAGGG - Intergenic
1006341282 6:33448546-33448568 GAGGGAGGCCAGAGGGAGGCTGG - Intronic
1008556657 6:52679179-52679201 GAGAGAGGGCAGCCAGTGGCGGG + Intronic
1011574202 6:88776629-88776651 GAAAGTGGTCAACAGGTGGCTGG - Intronic
1016559453 6:145378720-145378742 GAGAGTGGCCAGTGTGGGGGAGG + Intergenic
1019198252 6:170295040-170295062 GAGAATGGGCAGAGGGTGGTTGG - Intergenic
1019361913 7:609046-609068 GGGAGGGGTCAGTGGGTGGCAGG + Intronic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1019664015 7:2242307-2242329 GAGCCGGGCCAGCGGGCGGCAGG + Intronic
1019707377 7:2502972-2502994 GAGAGAGGCCAGCTGGGGGGAGG + Intergenic
1019860033 7:3649719-3649741 GAGAGAGGCCAGCAGTTGGCCGG + Intronic
1019901309 7:4022727-4022749 GAGTGTGGCCAGTGAGTGGTGGG - Intronic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1022479515 7:30733860-30733882 TGGATGGGCCAGCGGGTGGCGGG - Intronic
1022776914 7:33536260-33536282 CAGAGTGGCAAGCGGGTCGTCGG - Intronic
1023528548 7:41130185-41130207 GAGGGTGGGCAGTGGGTGGCAGG - Intergenic
1024060081 7:45690843-45690865 CAGAGAGGCCAGCTGATGGCTGG - Intronic
1025176456 7:56804655-56804677 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025178498 7:56813589-56813611 GAGAGAGGCCAGAGTGAGGCAGG + Intergenic
1025178516 7:56813685-56813707 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025178945 7:56815427-56815449 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025178954 7:56815475-56815497 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025179383 7:56817217-56817239 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025179392 7:56817265-56817287 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025179401 7:56817313-56817335 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025179410 7:56817361-56817383 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025179823 7:56819007-56819029 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025179841 7:56819103-56819125 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025179850 7:56819151-56819173 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025179859 7:56819199-56819221 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025180272 7:56820845-56820867 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025180290 7:56820941-56820963 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025180298 7:56820989-56821011 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025180316 7:56821085-56821107 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025180325 7:56821133-56821155 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025180334 7:56821181-56821203 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025180743 7:56822827-56822849 GAGAGAGGCCAGTGTGAGGCAGG + Exonic
1025180761 7:56822923-56822945 GAGAGAGGCCAGTGTGAGGCAGG + Intronic
1025180769 7:56822971-56822993 GAGAGAGGCCAGTGTGAGGCAGG + Intronic
1025180777 7:56823019-56823041 GAGAGAGGCCAGTGTGAGGCAGG + Exonic
1025181195 7:56824722-56824744 GAGAGAGGCCAGTGTGAGGCAGG + Intronic
1025181626 7:56826464-56826486 GAGAGAGGCCAGTGTGAGGCAGG + Intronic
1025181635 7:56826512-56826534 GAGAGAGGCCAGTGTGAGGCAGG + Intronic
1025181653 7:56826608-56826630 GAGAGAGGCCAGTGTGAGGCAGG + Intronic
1025181662 7:56826656-56826678 GAGAGAGGCCAGTGTGAGGCAGG + Intronic
1025690266 7:63750387-63750409 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025690275 7:63750435-63750457 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025690286 7:63750483-63750505 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025690295 7:63750531-63750553 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025690304 7:63750579-63750601 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025690713 7:63752210-63752232 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025690724 7:63752258-63752280 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025690735 7:63752306-63752328 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025690744 7:63752354-63752376 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025690753 7:63752402-63752424 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025691173 7:63754081-63754103 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025691184 7:63754129-63754151 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025691193 7:63754177-63754199 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025691594 7:63755809-63755831 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025691605 7:63755857-63755879 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025691625 7:63755953-63755975 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025691634 7:63756001-63756023 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025692038 7:63757632-63757654 GAGAGAGGCCAGTGTGAGGCAGG - Exonic
1025692049 7:63757680-63757702 GAGAGAGGCCAGTGTGAGGCAGG - Intronic
1025692069 7:63757776-63757798 GAGAGAGGCCAGTGTGAGGCAGG - Intronic
1025692078 7:63757824-63757846 GAGAGAGGCCAGTGTGAGGCAGG - Exonic
1025692488 7:63759455-63759477 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025692497 7:63759503-63759525 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025692517 7:63759599-63759621 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025692526 7:63759647-63759669 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025692932 7:63761278-63761300 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025692941 7:63761326-63761348 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025693348 7:63762957-63762979 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025693357 7:63763005-63763027 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025693377 7:63763101-63763123 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025693386 7:63763149-63763171 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025693791 7:63764780-63764802 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025693818 7:63764924-63764946 GAGAGAGGCCAGTGTGAGGCAGG - Intergenic
1025695335 7:63771731-63771753 GAGAGAGGCCAGTGTGAGGCAGG + Intergenic
1025912595 7:65840272-65840294 TAGAGAGGCCAGTGTGTGGCAGG - Intergenic
1025976734 7:66376568-66376590 CAGAGGGGCCAGCGTGAGGCAGG + Intronic
1030333290 7:108296011-108296033 GAGAGTTCCCAGAGGGTGTCTGG + Intronic
1033089043 7:138368180-138368202 GAGAGTCGGCAAAGGGTGGCGGG - Intergenic
1033591823 7:142815105-142815127 GAAAGTGGACAGTGGGTGGTGGG + Intergenic
1034412989 7:150950886-150950908 GAGCGTGGCCAGTGGGTGGCAGG - Intronic
1034843170 7:154418534-154418556 GAGAGTGGACAGGGGACGGCTGG + Intronic
1034892820 7:154855602-154855624 TAGAGTGGGCAGAGGGTGGGTGG - Intronic
1035476193 7:159145308-159145330 GAGAGCGGCCGGCGCGGGGCCGG + Intergenic
1037368149 8:18144766-18144788 GAAAGTGGGCAGAGGGTGCCAGG - Intergenic
1037539346 8:19856300-19856322 GAGAGTGCCCAGCGTGTGCCTGG - Intergenic
1038229127 8:25684423-25684445 GAGAGCAGCCAGGGTGTGGCTGG + Intergenic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1039837120 8:41265320-41265342 GAGGTTGTCCAGCTGGTGGCAGG + Exonic
1040604702 8:48920298-48920320 GAGAGAGGCCATTGGGTAGCTGG + Exonic
1041860908 8:62511382-62511404 GAGAGTGGCCTGCAGCGGGCAGG - Intronic
1043772208 8:84218810-84218832 GATAGTGCCCAGCGTGTGGTTGG + Intronic
1043881672 8:85550346-85550368 GATAGTGGCCAGGGGCTGGGAGG + Intergenic
1044730356 8:95224200-95224222 GGGAGTGGCCAGAGGCTGGCAGG - Intergenic
1048822926 8:138396269-138396291 AGCAGTGGCCAGCGTGTGGCAGG + Intronic
1049237079 8:141517826-141517848 GACAGTGGCCAGCTTGGGGCAGG - Intronic
1049411015 8:142474078-142474100 GAGTGAGGCCAGTGGGTGGTGGG + Intronic
1049412309 8:142478721-142478743 GAGTGTGGCCATGGGGTAGCGGG + Intronic
1049710863 8:144062759-144062781 CAGAGAGGCGAGGGGGTGGCTGG - Intronic
1050589210 9:7145178-7145200 GTGCGTGGCCAGAGGGTGGCGGG + Intergenic
1051894631 9:21974835-21974857 GAGAGCAGGCAGCGGGCGGCGGG - Exonic
1052744526 9:32427181-32427203 GAGCGTGGTCAGGTGGTGGCAGG + Intronic
1053070164 9:35096429-35096451 TAGGGTGCCCAGCGGGAGGCTGG - Exonic
1053353030 9:37425568-37425590 GAGAGTGCCAAGAAGGTGGCTGG - Intronic
1054743751 9:68833891-68833913 CAGAGAGGCAAGTGGGTGGCTGG + Intronic
1055303000 9:74901844-74901866 GAGAGAGGCCTCTGGGTGGCTGG - Intergenic
1055398259 9:75896120-75896142 GAGAGTGGCTAGCAGGGGTCAGG - Intronic
1056679153 9:88701927-88701949 GAGGGTGGCCTGGGGGTGGGGGG + Intergenic
1057209039 9:93189650-93189672 GAGAGAGGCTGTCGGGTGGCTGG - Intronic
1060348527 9:122837643-122837665 GAGAGAGGCCAGCTGGTGGCGGG + Intergenic
1061226763 9:129284925-129284947 GGGGGTGGCCTGAGGGTGGCCGG + Intergenic
1061422174 9:130478363-130478385 GAGGGTGGGAGGCGGGTGGCAGG + Intronic
1062044810 9:134420075-134420097 GAGAGTGGCCGGCTAGTGGCTGG + Intronic
1062363911 9:136199946-136199968 GAGAGAGGCAAGCGGCTGCCTGG + Intronic
1062428327 9:136516237-136516259 GGGAGCGGGCAGCGGGAGGCAGG - Intronic
1185865908 X:3623775-3623797 GAGAGGAGCCAGCTGGTGCCAGG - Intronic
1186512329 X:10139201-10139223 GACAGAGGCCAGGGGGTGGCTGG - Intronic
1190745644 X:53320597-53320619 GAGCGTGGCGGGCGGGAGGCCGG - Exonic
1196737519 X:118992634-118992656 GAGAGGGACCAGCGGTGGGCAGG - Intronic
1197360633 X:125498470-125498492 GAGAGTAGTCAGCGGGTGGCAGG - Intergenic
1197725612 X:129774382-129774404 CAGAGTGGGCATCTGGTGGCAGG - Intergenic
1198022114 X:132669306-132669328 GAGATTGGCCAGGGGGTGGTGGG - Intronic
1198215289 X:134549712-134549734 GAGCGGGGCCACCGGGGGGCGGG - Intergenic
1199595247 X:149501831-149501853 GAAAGAGGGCAGCGGGTGGAGGG + Intronic
1200213688 X:154358129-154358151 GAGTGTGGGCTGCGGGTGGCTGG - Intronic
1200235503 X:154466013-154466035 GAGGTGGGCCTGCGGGTGGCTGG + Exonic
1202100621 Y:21303925-21303947 GAGAGGGGCCAGCGGGAACCAGG - Intergenic