ID: 1128156908

View in Genome Browser
Species Human (GRCh38)
Location 15:65396817-65396839
Sequence TGCTGGGTGAGGCGGGCCGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128156908_1128156916 1 Left 1128156908 15:65396817-65396839 CCTTCGGCCCGCCTCACCCAGCA 0: 1
1: 0
2: 0
3: 12
4: 225
Right 1128156916 15:65396841-65396863 ACGGAGCTCAGCGGCTGCAGTGG 0: 1
1: 0
2: 0
3: 16
4: 194
1128156908_1128156919 20 Left 1128156908 15:65396817-65396839 CCTTCGGCCCGCCTCACCCAGCA 0: 1
1: 0
2: 0
3: 12
4: 225
Right 1128156919 15:65396860-65396882 GTGGCGAAGTCGCGCGTGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 20
1128156908_1128156917 18 Left 1128156908 15:65396817-65396839 CCTTCGGCCCGCCTCACCCAGCA 0: 1
1: 0
2: 0
3: 12
4: 225
Right 1128156917 15:65396858-65396880 CAGTGGCGAAGTCGCGCGTGCGG 0: 1
1: 0
2: 0
3: 1
4: 23
1128156908_1128156920 28 Left 1128156908 15:65396817-65396839 CCTTCGGCCCGCCTCACCCAGCA 0: 1
1: 0
2: 0
3: 12
4: 225
Right 1128156920 15:65396868-65396890 GTCGCGCGTGCGGGGCTTGTTGG 0: 1
1: 0
2: 0
3: 2
4: 32
1128156908_1128156918 19 Left 1128156908 15:65396817-65396839 CCTTCGGCCCGCCTCACCCAGCA 0: 1
1: 0
2: 0
3: 12
4: 225
Right 1128156918 15:65396859-65396881 AGTGGCGAAGTCGCGCGTGCGGG 0: 1
1: 0
2: 0
3: 0
4: 17
1128156908_1128156913 -8 Left 1128156908 15:65396817-65396839 CCTTCGGCCCGCCTCACCCAGCA 0: 1
1: 0
2: 0
3: 12
4: 225
Right 1128156913 15:65396832-65396854 ACCCAGCACACGGAGCTCAGCGG 0: 1
1: 0
2: 1
3: 10
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128156908 Original CRISPR TGCTGGGTGAGGCGGGCCGA AGG (reversed) Exonic
900102295 1:967025-967047 AGCTGGGCGGGGCGGGCCGCGGG + Intronic
900537757 1:3187254-3187276 GGCTGCGTGAGGCCGGCAGAAGG - Intronic
900752759 1:4409161-4409183 TCCTGGGTGAGGCGAGACGGTGG - Intergenic
900934233 1:5755316-5755338 TGGTGGGTCAGCCGGGCCAAGGG - Intergenic
901024455 1:6271776-6271798 TGCTGGGTGAGGGGAGCCCCTGG - Intronic
902624149 1:17667007-17667029 TACTGGGAGAGGCAGGCCAAGGG - Intronic
902649847 1:17829898-17829920 GGCTGGGTGGGGCTGGCAGAGGG + Intergenic
903656082 1:24949682-24949704 GGCTGGGTGAGGTGGGCTGCTGG - Intronic
905584386 1:39105472-39105494 GGCCGGGCGAGGCGGGCGGACGG + Intronic
906041056 1:42788063-42788085 TGGTGAGTGAGGCTGGCCCATGG + Intronic
906318057 1:44800663-44800685 TGTTGGGCAAGGTGGGCCGAGGG + Exonic
906753978 1:48291586-48291608 TACTGGGTGAGGGGGGCAGGTGG - Intergenic
907160676 1:52366479-52366501 TGCTCGGTGGGGCGGGGCGAGGG - Intergenic
907971919 1:59391324-59391346 TGCTGGGTCAGTCGGGCTGGAGG + Intronic
908114209 1:60925088-60925110 AGCTGGGTGAGGCGGGGTGGGGG - Intronic
908555622 1:65254422-65254444 TGCTGGGAGATGCGCGCCGGGGG - Intronic
912439507 1:109687749-109687771 TTCGGGTTGTGGCGGGCCGAGGG + Intronic
912659718 1:111516613-111516635 TGCTGGGTGAGTGGGGCCCAGGG + Intronic
917797277 1:178541613-178541635 TGGTGGGAGAGGCGTGCAGAAGG - Intronic
920333384 1:205228149-205228171 TGCGGGGCGAGGCGGGGCGCGGG - Intergenic
922899185 1:229123166-229123188 TGCTGGAGGAGCCAGGCCGAGGG - Intergenic
923673983 1:236064800-236064822 TGCAGGGCGCGGCGGGCCGGGGG - Intronic
1063615589 10:7597280-7597302 TGCTGGGTCAGGAAGGCCCAAGG - Intronic
1066094239 10:32057096-32057118 TGCTGTGTGATGGGGGCTGAGGG - Intergenic
1067221717 10:44348658-44348680 GGGTGGGTGAGGCTGGCCCAGGG + Intergenic
1071690850 10:87818195-87818217 TCCTGTGTGAGGCCGGCTGAGGG - Intronic
1074434684 10:113424095-113424117 TGCTGGGGAAGGCTGGCCAATGG + Intergenic
1074729007 10:116348732-116348754 TGCTGGGTGAGGCTGGAAGGTGG - Intronic
1075498860 10:122953998-122954020 TCCAGGGTGCGCCGGGCCGACGG - Exonic
1076317513 10:129552704-129552726 GGCAGGGAGAGGCTGGCCGAGGG + Intronic
1076684980 10:132194481-132194503 GGCTGGGTGAGGCACCCCGAGGG - Intronic
1076759084 10:132591352-132591374 GGCTGGGCGGGGCGGGCCGCTGG + Intronic
1076878854 10:133230399-133230421 CGCTGGGCGAGGCGGGCCTCCGG - Exonic
1077065646 11:639994-640016 TCCTGGGGGAGGCGGGGCGCGGG - Exonic
1077115027 11:880291-880313 TGCTGGCTGAGGTGGGCCTGGGG - Intronic
1077414337 11:2417851-2417873 TCCTGGCTGAGGCGGCCCCATGG - Intronic
1078743791 11:14091912-14091934 TGCTGGGGGTGGCGGGGCGGGGG + Intronic
1080879011 11:36301664-36301686 TGCTGGGAGAGGAGAGCAGAGGG + Intronic
1081469763 11:43359037-43359059 TGCTGAGTGTGGCGGCACGAGGG + Exonic
1081591127 11:44423916-44423938 TGGTGAGTGAGGCGGGGGGAGGG - Intergenic
1081703895 11:45169051-45169073 TTCGGGGTGAGGCAGGCAGAGGG - Intronic
1084091413 11:66881514-66881536 TGCAGGCTGAGGCAGGGCGAGGG + Intronic
1084184669 11:67465162-67465184 TGGTGGGTGAGCCGGGCTGGGGG - Intronic
1084692538 11:70735382-70735404 TGCTGGGTGAGGCTGGCTTGCGG - Intronic
1084765871 11:71308054-71308076 TGCTGGCTGGGGCGGGCAGAGGG - Intergenic
1084891793 11:72240328-72240350 GGCTGCGTGCGGAGGGCCGAAGG - Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088707270 11:112475027-112475049 TGCTGGGAGAGGGTGGCAGAAGG - Intergenic
1089744995 11:120610458-120610480 TGCTGGGAGAGGGTGGCCGCAGG + Intronic
1090627294 11:128618159-128618181 GGCTGGGGGAGGCGGGGAGAGGG + Intergenic
1091166174 11:133478235-133478257 TGCTGGGAGAGGCAGGCAGGAGG - Intronic
1091393815 12:141647-141669 TCCTGGGGGAGGGGGGCTGAGGG - Intronic
1091445334 12:541804-541826 GGCAGGGAGAGGAGGGCCGAGGG - Intronic
1091581863 12:1795275-1795297 TGCGGGTTGAGGCGGATCGAGGG - Intronic
1091715832 12:2775539-2775561 TGGTGGGTGCGGCAGGCCGGAGG - Intergenic
1092698346 12:11199453-11199475 TGCTTGGTGAGGAGGTCAGATGG - Intergenic
1096970033 12:55658196-55658218 TGCTAGGAGAGGGGGCCCGAAGG + Intergenic
1096974875 12:55694239-55694261 TGCAGGGTGAGCCTGGCCCAAGG - Exonic
1102345896 12:112161321-112161343 TGCTGGGTGGGGCTGGCCAGAGG + Exonic
1106169105 13:27273401-27273423 TGTTGGGAGAGCGGGGCCGAGGG - Exonic
1110712023 13:78660323-78660345 GGCTGGCTGAGGCAGGCGGATGG - Intergenic
1112332525 13:98487479-98487501 TGCTGGGTAATGGGGGCCCAGGG - Intronic
1118851577 14:69587695-69587717 TCCTGGGCGAGGCTGGCCAACGG + Intergenic
1122397497 14:101443772-101443794 TGCTGGGTGAGCGGGACAGAAGG + Intergenic
1123067766 14:105627004-105627026 TGCAGGGTGGGGAGGGCCAAGGG - Intergenic
1123091449 14:105744005-105744027 TGCAGGGTGGGGAGGGCCAAGGG - Intergenic
1123467834 15:20529374-20529396 TGCTGGGTCAGGGGAGCGGATGG - Intergenic
1123650278 15:22471668-22471690 TGCTGGGTCAGGGGAGCGGATGG + Intergenic
1123728147 15:23124583-23124605 TGCTGGGTCAGGGGAGCGGATGG - Intergenic
1123740686 15:23280510-23280532 TGCTGGGTCAGGGGAGCGGATGG + Intergenic
1123746312 15:23322048-23322070 TGCTGGGTCAGGGGAGCGGATGG - Intergenic
1124278579 15:28345365-28345387 TGCTGGGTCAGGGGAGCGGATGG - Intergenic
1124304121 15:28566243-28566265 TGCTGGGTCAGGGGAGCGGATGG + Intergenic
1124533002 15:30522713-30522735 TGCTGGGTCAGGGGAGCGGATGG + Intergenic
1124632299 15:31344787-31344809 TGCTGGGTGGGGCAGGATGAGGG + Intronic
1124765655 15:32484931-32484953 TGCTGGGTCAGGGGAGCGGATGG - Intergenic
1124883307 15:33661541-33661563 TGGTGGGTGAGGCTGGGGGAGGG + Intronic
1125503612 15:40253915-40253937 TTCTGGGTGAAGGGGGCAGAGGG + Intronic
1126100660 15:45116492-45116514 TGTGGGGTGAGGCGGGCTCATGG - Intronic
1128156908 15:65396817-65396839 TGCTGGGTGAGGCGGGCCGAAGG - Exonic
1129827211 15:78641623-78641645 TGCTGGGTGAGCCGACGCGAGGG + Intronic
1130061817 15:80575809-80575831 TGCTGGGTGAGGGTGGCCAGGGG + Intronic
1130099107 15:80878669-80878691 TGCTTGGTGAGGCTGGTAGATGG + Intronic
1132623646 16:879850-879872 TGCAGGGCCAGGCGGGCCGGGGG - Intronic
1133341144 16:5037025-5037047 TGGTGGGAGAGGAGGGCCGTGGG + Intronic
1133732700 16:8590216-8590238 GGCTGGGCGTGGAGGGCCGAGGG - Intergenic
1133807721 16:9138307-9138329 TGTTGGGTGAGGGGGGACGTTGG - Intergenic
1134468768 16:14503057-14503079 AGCGGGGTGAGGGGGGCAGAAGG - Intronic
1136344369 16:29665410-29665432 TGCTGGGTGAGGATGGCAGCAGG - Exonic
1137660898 16:50205197-50205219 TTCTGTGTGGGGCGGGCAGAGGG + Intronic
1138187090 16:54985110-54985132 TGCTGGGTGAGGAGGGCTCCTGG - Intergenic
1138528790 16:57623657-57623679 GGGTGGGGGAGGCGGGCCTAGGG + Intronic
1140387996 16:74559462-74559484 GGCTGGGGGAGGAGGGGCGATGG + Intronic
1141183856 16:81773157-81773179 TGCTGGGTGTGGGGGGGCGTTGG + Intronic
1141244264 16:82291642-82291664 GGGAGGGTGAGGCGGGCAGATGG - Intergenic
1141558899 16:84853856-84853878 GGCTGGAGGAGGCTGGCCGAGGG + Intronic
1141764487 16:86049462-86049484 TGCTGGGTGATGCTGCCCCAGGG + Intergenic
1142943329 17:3402230-3402252 TGCTGGGTGAGTTGGGCAGAAGG - Intergenic
1143493343 17:7296362-7296384 TGGTGGGGGAGGCGGCCCTAGGG - Intergenic
1143863034 17:9905041-9905063 TGCTGGGTGATGCGGCCGGTGGG + Exonic
1144586603 17:16491516-16491538 GGCCGGGTGAGGCCCGCCGAAGG - Intronic
1147167683 17:38602138-38602160 TTCTGGGGGAGGTGGGCAGAGGG - Intronic
1147949528 17:44099279-44099301 AGCTGGGTGCGGGGGGCCCAAGG - Intronic
1155242013 18:23872794-23872816 TGCAGGGTGAGGTGGGTGGAAGG + Intronic
1159997610 18:74981239-74981261 TGCAGGGTGAGGCGGGGCACGGG + Intronic
1160684236 19:426215-426237 TGCTGGGTGACGAGGGCAGAGGG + Intronic
1160867505 19:1262377-1262399 TGCTGGGAGAGGAGGGCGGGTGG - Intronic
1161057007 19:2195667-2195689 TGCTGGGTGGGGCGGGCACCAGG + Intronic
1161060915 19:2214372-2214394 TGTTGGCTGAGGCAGGCCCAGGG + Intronic
1161690025 19:5726768-5726790 TGCTGGGGGAAGCTGGCAGAAGG - Intronic
1162440022 19:10687143-10687165 TGCTGGGTGAGTGGAGCTGAAGG + Intronic
1163580362 19:18135117-18135139 TGCTGAGTGAGGCGGGTGGCTGG + Intronic
1164452091 19:28375206-28375228 AGCTGGGTGAGGCCGGCCTTCGG - Intergenic
1164646733 19:29863756-29863778 TGCTGGGTGAGGCCAGCTCACGG + Intergenic
1165427226 19:35752915-35752937 TGGTGGGGGAAGCGGGCAGATGG - Exonic
1166120634 19:40684382-40684404 GGCAGGGTGCGGCGGGGCGAGGG - Intronic
1166702648 19:44891207-44891229 GGCTAGGTGGGGCGGGGCGACGG + Intronic
1168724852 19:58575507-58575529 TGCACTGTGAGGCGGGGCGATGG + Intergenic
929666671 2:43838920-43838942 TGCTGGGAGAGACGGGCCCAGGG + Intergenic
929714570 2:44297288-44297310 TGCTGGGAGAGGCTGGCTGTGGG + Intronic
932446145 2:71782740-71782762 TGCTGGGTGAGGCCAGGCTAGGG - Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938295023 2:130172583-130172605 TGCTGGGAGAGGTGGGGCCACGG - Intronic
938461604 2:131501253-131501275 TGCTGGGAGAGGTGGGGCCACGG + Intergenic
938500512 2:131829514-131829536 TGCGGGGCGGGGCGGGCCCAGGG + Intergenic
938572073 2:132570130-132570152 AGCTGGGTGGGGAGGGCCAAGGG - Intronic
940673442 2:156698903-156698925 TGCTGGCTGAGGCAGACCAAAGG - Intergenic
942218581 2:173746921-173746943 TGATGGGAGAGGCGAGCCCAGGG - Intergenic
943533392 2:189116052-189116074 TGCTGGGTCAGGAAGGCTGAAGG - Intronic
945039627 2:205733227-205733249 AGCTGGGTGACGCTGGCCGCGGG - Intronic
948966083 2:241381425-241381447 TGATGGATGAGGCAGGCTGAGGG - Intronic
1170924687 20:20712358-20712380 TGCTGGGTGAGGCGCGCGCCGGG - Exonic
1171411769 20:24952642-24952664 CTCTGGGTGATGGGGGCCGATGG + Intronic
1172057522 20:32164889-32164911 TGGAGGCTGAGGCGGGCTGATGG + Intronic
1173143175 20:40502616-40502638 TGCTGGGTGAGGAAGGAGGAGGG - Intergenic
1175678511 20:60967470-60967492 TGCGGGGTTGGGCGGGCGGAGGG + Intergenic
1175678523 20:60967510-60967532 TGCGGGGTTGGGCGGGCGGAGGG + Intergenic
1175678535 20:60967550-60967572 TGCGGGGTTGGGCGGGCGGAGGG + Intergenic
1175678547 20:60967590-60967612 TGCGGGGTTGGGCGGGCGGAGGG + Intergenic
1175678568 20:60967670-60967692 TGCGGGGTTGGGCGGGCGGAGGG + Intergenic
1175802775 20:61810568-61810590 GGCAGGGTGAGGCGGGCACACGG - Intronic
1176141940 20:63548681-63548703 TGCTGGGGGAGGCCGGCAGGAGG - Intronic
1176148826 20:63578650-63578672 CGCTGGGTGAGGAGGACCTAGGG - Intergenic
1179780393 21:43696445-43696467 AGCTGGGTGAGGCGGGCACAGGG + Intergenic
1180109920 21:45643030-45643052 TGGTGGGCGGGGCGGGCCGTTGG - Intergenic
1180853593 22:19033417-19033439 TGCTGGGTGTGGGGGGGGGAAGG - Intergenic
1183452809 22:37906092-37906114 TGCTGGGTGGGGCGCGCCTCCGG + Intronic
1185292546 22:50034545-50034567 TGGTGGGTGAGGCGGGGCCCAGG - Intronic
1185391072 22:50562146-50562168 TGAGGGGTGAGGCGGGGTGAGGG + Intronic
1185391079 22:50562163-50562185 TGAGGGGTGAGGCGGGGTGAGGG + Intronic
1185391120 22:50562288-50562310 TGAAGGGTGAGGCGGGGTGAGGG + Intronic
1185391129 22:50562312-50562334 TGAAGGGTGAGGCGGGGTGAGGG + Intronic
1185391139 22:50562336-50562358 TGAGGGGTGAGGCGGGGTGAGGG + Intronic
1185391148 22:50562360-50562382 TGAAGGGTGAGGCGGGGTGAGGG + Intronic
1185391157 22:50562384-50562406 TGAAGGGTGAGGCGGGGTGAGGG + Intronic
1185391164 22:50562401-50562423 TGAGGGGTGAGGCGGGGTGAGGG + Intronic
1185391171 22:50562418-50562440 TGAGGGGTGAGGCGGGGTGAGGG + Intronic
1185391208 22:50562512-50562534 TGAGGGGTGAGGCGGGATGAGGG + Intronic
1185391217 22:50562536-50562558 TGAGGGGTGAGGCGGGATGAGGG + Intronic
1185391227 22:50562560-50562582 TGAGGGGTGAGGCGGGGTGAGGG + Intronic
1185391234 22:50562577-50562599 TGAGGGGTGAGGCGGGGTGAGGG + Intronic
1185391257 22:50562656-50562678 TGAAGGGTGAGGCGGGGTGAGGG + Intronic
950683414 3:14601036-14601058 AGATGGGTGAGGCGGGTGGATGG - Intergenic
953982324 3:47418947-47418969 TGCTGGGAGAGTCTGGCCGGTGG - Intronic
954395662 3:50292097-50292119 AGCTGCGTGGGGCTGGCCGAGGG + Intronic
955827578 3:62964723-62964745 TGCTTGTTGAGGAGGGCCTATGG + Intergenic
957038899 3:75321008-75321030 TGCTGGGTCAGGCTGGCCAGAGG + Intergenic
958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG + Intronic
959081332 3:101804370-101804392 TCCTGGGTGAGGCTGGTTGATGG + Intronic
962269139 3:133965365-133965387 TTCTGGGTGACGCTGGCCCACGG - Intronic
966923848 3:184631758-184631780 TGCAGGCTGAGGCGGGCGGCTGG + Intronic
968077600 3:195825033-195825055 TGCTGGGTGGGAAGTGCCGAGGG + Intergenic
968451448 4:677820-677842 TGCGGGGTGAGGCAGGGCAAGGG + Intronic
968909310 4:3469480-3469502 GGGTGGGTGAGCAGGGCCGATGG + Intronic
969261261 4:6035633-6035655 TGCTGGAGAAGGAGGGCCGAGGG + Intronic
969718114 4:8878116-8878138 TCCTGGGTGAGGGGGGCAGGCGG - Intergenic
969929135 4:10613244-10613266 TGCTGGGTGGGGTGGGCAGGTGG + Intronic
970816079 4:20157355-20157377 TGCTGGCTGAGGCTGGGGGAAGG - Intergenic
971030603 4:22633744-22633766 GGCTGGGTTAGGGGGGCTGAAGG - Intergenic
973631248 4:52822991-52823013 TGATGTGTGAGGCTGGCAGAAGG + Intergenic
976303326 4:83535951-83535973 TGCTGGGGGAGGCGGGGCGCGGG + Exonic
979468960 4:121072443-121072465 TGCTGGGAGAGCCGGGCGCACGG + Exonic
985043381 4:185915696-185915718 TGCTGGGGGTGGGGGGCAGAAGG - Intronic
985250891 4:188023367-188023389 AGCTGGGTGAGGAGGGGGGATGG + Intergenic
985489487 5:171140-171162 GGCTGTGGGGGGCGGGCCGAGGG - Intronic
985676505 5:1234271-1234293 TGCTGGATGAGGCTGGCCTCAGG + Intronic
990545265 5:56815701-56815723 TGCTGCGGGAGGCGGGCAGCGGG + Exonic
998254650 5:140575372-140575394 TGATGGGTGAGGCAGGCCTAAGG + Intronic
1000622903 5:163505586-163505608 GCCTAGGGGAGGCGGGCCGAGGG + Exonic
1002409194 5:179060670-179060692 AGCTGGGTGCGCCGGGCCGCTGG + Intronic
1002638950 5:180621525-180621547 TGCAGGGTGAGGCTGGCCGCGGG - Exonic
1003612399 6:7625723-7625745 TGCTGGGGGAGGCGGGGTGCTGG + Intergenic
1003840062 6:10111049-10111071 TGCTGGGTGAGTTTGGCCAAGGG + Intronic
1004938833 6:20534569-20534591 TTCTGGGTAAGGGTGGCCGATGG + Exonic
1005520585 6:26597392-26597414 TGCTGGGGTGGGCGGGCGGAGGG + Intronic
1006743118 6:36323299-36323321 TGCTGGAGGTGGAGGGCCGATGG + Exonic
1007751777 6:44075566-44075588 TGCTGGGTGAGGGAGGCAGCAGG + Intergenic
1017446617 6:154511782-154511804 TGCTGGGCGGGGCGGGGCGGGGG - Intergenic
1017523141 6:155219728-155219750 TGCTGGGTGTGGCAGGAAGACGG + Intronic
1019270448 7:144151-144173 TGCTGGGTCAGGCCAGCCCAGGG - Intergenic
1019997640 7:4734853-4734875 CGCTGGGAGAGACGGGGCGAGGG + Intronic
1022396027 7:29989152-29989174 CGCTGGCAGAGCCGGGCCGAAGG + Intronic
1022528107 7:31051353-31051375 GGCTGGGTGGGGTGGGCAGAGGG + Intergenic
1026952184 7:74354964-74354986 TGCTGGGTTAGGAGGGTCTAAGG + Intronic
1032125389 7:129189216-129189238 TGCTGGGGGACCCGGGCCGGGGG + Exonic
1033345295 7:140521647-140521669 TTCTGGGAGAGGCTGGCAGAGGG + Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1036767650 8:11558895-11558917 TACTGGGTAAGGCTGGGCGAGGG - Intronic
1037817085 8:22118016-22118038 GGCTGGGTGTGGCTGGCCGTGGG - Intronic
1038283874 8:26190023-26190045 TGCTGGGTGAGCCAGGCTGTTGG - Intergenic
1038479325 8:27890949-27890971 TGGTGGGTGAGGGGAGCCCAGGG + Intronic
1039056152 8:33538499-33538521 AGCTGGGTGTGGTGGGCCCATGG - Intergenic
1040006048 8:42621687-42621709 TGCTGGGTGAGGAGGCCTGGAGG + Intergenic
1042225572 8:66512235-66512257 TGCTGGGTGAGATTGGCCTAAGG + Intronic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1044742714 8:95343974-95343996 TGCAGGGTGAGGCGGGGAGCAGG - Intergenic
1045432182 8:102124302-102124324 TCCAGGGGGAGGCGGGCGGAGGG - Intronic
1048209678 8:132444268-132444290 GGCTGGGTGAGGAGGGCAGGAGG - Intronic
1048885283 8:138904471-138904493 TGATGGGTGAGGCAGGCTGAGGG - Intronic
1049389837 8:142362003-142362025 TGATGGATGAGGCGCCCCGATGG + Intronic
1049446262 8:142632929-142632951 TGCTGGATGAGGCGGGGCCATGG - Intergenic
1049541700 8:143211700-143211722 GCGTGGGGGAGGCGGGCCGAGGG + Intergenic
1049674858 8:143884904-143884926 TGGTGAGTGAGGGGGGCAGATGG - Intergenic
1052885174 9:33639465-33639487 TGTTGGGTGAGCAGGGCTGAGGG - Intergenic
1053058026 9:35005729-35005751 TCCTGGGGGAGGCGGGCCTGGGG - Intergenic
1057827779 9:98383937-98383959 TGCTGGATGATGAGGGCTGAAGG - Intronic
1060750589 9:126165901-126165923 TGCTGGGGGAGCCCGGCCCAGGG + Intergenic
1061363606 9:130158766-130158788 TGCCGGGAGCGGAGGGCCGAGGG + Intergenic
1062461313 9:136663658-136663680 TGCTGGGTGCGGTGGGCAAATGG + Intronic
1190010786 X:46782965-46782987 TGGAGGCTGAGGCGGGCAGATGG - Intergenic
1190126577 X:47710688-47710710 TGCTGGGGGATGCGGGGAGAGGG + Intergenic
1190303191 X:49067961-49067983 GGGTGGGTGTGGCGGGCCCACGG - Exonic
1190873887 X:54446229-54446251 TGCTTGGCCGGGCGGGCCGAGGG - Exonic
1199086623 X:143635589-143635611 GCCTGGGGGAGGGGGGCCGAGGG + Intronic
1199600181 X:149537018-149537040 TCCTGGGGGAGGCAGGCAGAGGG + Intergenic
1199650402 X:149942922-149942944 TCCTGGGGGAGGCAGGCAGAGGG - Intergenic