ID: 1128157762

View in Genome Browser
Species Human (GRCh38)
Location 15:65402451-65402473
Sequence CAGGATCTGAAGGACGCCGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128157757_1128157762 0 Left 1128157757 15:65402428-65402450 CCTGCATCACTCTCCTGAACATC 0: 1
1: 0
2: 0
3: 52
4: 1057
Right 1128157762 15:65402451-65402473 CAGGATCTGAAGGACGCCGTTGG 0: 1
1: 0
2: 0
3: 5
4: 76
1128157756_1128157762 17 Left 1128157756 15:65402411-65402433 CCACGCAGCGGTAGGGGCCTGCA 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1128157762 15:65402451-65402473 CAGGATCTGAAGGACGCCGTTGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128157762 Original CRISPR CAGGATCTGAAGGACGCCGT TGG Exonic
900875951 1:5342768-5342790 CTGGATCTGAAGGATTCAGTAGG - Intergenic
901049065 1:6417227-6417249 CAGGATATGAAGGAAGCTGTAGG - Exonic
901493956 1:9610784-9610806 CAGGACGTGAAGCACGCCCTGGG + Exonic
902116318 1:14124654-14124676 CAGGAACTGAGAGAGGCCGTTGG - Intergenic
904410367 1:30321435-30321457 CAGAATCTGCAGGAGGACGTTGG + Intergenic
904651975 1:32012816-32012838 CAGGATGTGGAGAACGTCGTAGG + Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
908474601 1:64475039-64475061 CAGGAACTGAAGGACTCAGCTGG + Intronic
908475854 1:64487341-64487363 CAGGCTTTGAAGGATGCCTTGGG + Intronic
913354714 1:117907051-117907073 CAGGGTCTGAAGGACTGGGTAGG - Intronic
914414493 1:147467667-147467689 TAGGAGCTGAAGGACGAAGTAGG - Intergenic
919186822 1:194161728-194161750 CAAGATCTGAAGGACACAGCTGG + Intergenic
919802278 1:201361151-201361173 CAGGAGCTGAAGGGGGCTGTTGG + Intronic
1066290371 10:34008854-34008876 CAGGATGTGAGGGAGGCCTTGGG - Intergenic
1072764937 10:98087695-98087717 CAGAATCTGCAGGACCCTGTGGG - Intergenic
1073763697 10:106658586-106658608 CAGGAAATGAAGGAAGCCTTGGG + Intronic
1075778558 10:125003085-125003107 CAGGTTCTAAACGAAGCCGTGGG - Exonic
1077200844 11:1306782-1306804 CAGGAGCTGGAGGCCGCCGGAGG - Intronic
1077305192 11:1865785-1865807 CAGGATCCGAAGGACCCCACGGG - Intronic
1083229560 11:61307555-61307577 CAGGATCTGAAGATAGCCCTAGG - Intronic
1101964091 12:109270249-109270271 GAGGATCTGAATGATGCCATTGG - Intergenic
1104735627 12:131134292-131134314 CTGGATCTGAAGGAGGCTCTAGG - Intronic
1104834008 12:131775394-131775416 CAGGGGCTGAAAGACGCCATTGG - Intronic
1113759233 13:112835983-112836005 CTGGATTTGAAGGACGCAGCAGG - Intronic
1113924752 13:113935241-113935263 GAGGAGCTGAAGGGCGCCGGGGG - Intergenic
1118200615 14:63668641-63668663 CAGGATGTTAAGGCTGCCGTGGG - Intergenic
1121312611 14:92943386-92943408 TGGGATCTGAAGGACGCCCTTGG + Intronic
1128157762 15:65402451-65402473 CAGGATCTGAAGGACGCCGTTGG + Exonic
1130915234 15:88299708-88299730 CAGAATCTGCAGGAGGCCGGGGG - Intergenic
1132959589 16:2614419-2614441 CAGGCCCTGAAGCACGCCGTGGG - Intergenic
1132972650 16:2696394-2696416 CAGGCCCTGAAGCACGCCGTGGG - Intronic
1136406595 16:30051734-30051756 CAGTATCTGTAGGATGCTGTGGG + Intronic
1140056073 16:71526786-71526808 CAGGATCTGAACGAGTCAGTTGG - Intronic
1145366271 17:22269092-22269114 AAGGATCTGAAGGATGCCTCAGG + Intergenic
1147987224 17:44313581-44313603 CAGGAACTGAAGGATGCTGCAGG - Intronic
1149356585 17:55845697-55845719 CAGGTGCTGAAGGAGGCCGCAGG - Intergenic
1154379834 18:13838978-13839000 AAGGATGTGAAGGACGCTGCCGG + Intergenic
1158535270 18:58302842-58302864 GGAGATCTGAAGTACGCCGTGGG - Intronic
1160541211 18:79624140-79624162 CAGGAACTGCAGGACACCCTGGG + Intergenic
1162180583 19:8866063-8866085 CAGGTGCTGAAGGACCCCCTCGG + Exonic
1163446493 19:17349717-17349739 CAGGAGCTGAAGGCTGCAGTGGG - Intergenic
1165495234 19:36148838-36148860 CAGGGTGTGCAGGACGCTGTGGG + Intronic
1166395958 19:42441314-42441336 GAGGAACTGAAGGAAGCTGTGGG + Intronic
1167487750 19:49773060-49773082 GAGGATCTGAAGGGCACAGTGGG + Intronic
1167649994 19:50723902-50723924 CAGCATCTGCAGGAAGCCCTAGG + Exonic
925228469 2:2207696-2207718 CAGGATCTGATGCAGGCTGTGGG + Intronic
925410794 2:3638762-3638784 CAGGATCTGGAGGGAGGCGTGGG + Intronic
929443939 2:41988396-41988418 CAGGATCTGAGGCACACAGTGGG - Intergenic
930713862 2:54574397-54574419 CAGGATCTGGAGGGAGCAGTTGG + Intronic
937600774 2:123729110-123729132 AAGGATCTGAAGGCAGCCTTTGG + Intergenic
1171253534 20:23668639-23668661 CAGGCTCTGAAGGTGGCCCTGGG + Intergenic
1178875105 21:36408252-36408274 CAGGTTCTGAAGGAGGCTGGAGG + Intronic
1181668382 22:24413801-24413823 CAGGATCAGGAGGGCGCCCTTGG - Intronic
1182323613 22:29494733-29494755 AAGGAACTGAAGGAAGCCTTTGG + Intergenic
1182743209 22:32583923-32583945 CAGGATCTGAAGAACATCTTAGG - Intronic
950900291 3:16491416-16491438 CAGGATCTGTAGGAGGACGAGGG + Intronic
953873034 3:46644247-46644269 CAGGGTCTGTAGGAAGCCATGGG - Intergenic
954712898 3:52513766-52513788 GAGGATGTGTAGGACACCGTTGG - Exonic
955043549 3:55338845-55338867 CAGGTTCTAAAGGGCGCTGTCGG + Intergenic
961536170 3:127572307-127572329 CAGGCTCTGAAGCATGCAGTTGG + Intergenic
966930865 3:184674634-184674656 CAGGAGCTGAGGGAGGCAGTAGG + Intronic
973115316 4:46450331-46450353 CAGGAGGTGGAGGTCGCCGTGGG + Intronic
983722813 4:170878169-170878191 CAGAATCTGAAGGACATCATAGG + Intergenic
985764792 5:1771566-1771588 CAGGATCAGAAGGACCTCATGGG + Intergenic
987126020 5:14813639-14813661 CAGCCTCTGATAGACGCCGTGGG - Intronic
997035824 5:130190107-130190129 CAGCATGTGAAGGAGGCTGTGGG - Intergenic
1002184593 5:177448118-177448140 CTGGATCTGAAGCCCGCGGTCGG - Intronic
1015863703 6:137706669-137706691 CAGGAACTGAAATACGACGTTGG - Intergenic
1026084765 7:67254044-67254066 CTGGAGCTGAAGGACGATGTGGG + Intergenic
1035930787 8:3777694-3777716 CTGCATCTGAAGGAGGCCGCAGG - Intronic
1037442599 8:18931763-18931785 CAGGCTCTGAGGGAGGCCTTCGG - Intronic
1038583390 8:28769486-28769508 CAGGATTTGCAGGAGGCAGTCGG - Intronic
1045395531 8:101757151-101757173 CAGGATCTGAAGGCCATGGTGGG - Intronic
1046064477 8:109180589-109180611 CTGGATCTGAAGGAGGTGGTGGG - Intergenic
1060153030 9:121300705-121300727 CAGGGTCTGCAGGAGGCTGTTGG - Intronic
1060218710 9:121753386-121753408 CAGGGTCGGGAGGATGCCGTGGG + Intronic
1060286196 9:122255042-122255064 CAGGTTGTGAAGGATGTCGTAGG + Intronic
1061645064 9:131994447-131994469 AAGGATCTAAAGGACGCAGGGGG + Intronic
1187135814 X:16546198-16546220 CAGGATCTGAAGGCCCCCAGGGG - Intergenic
1189979037 X:46490570-46490592 CAGGATCTGAAAGTAGCCCTTGG + Intronic
1200917747 Y:8586152-8586174 AAGGATCTGCAGGATGCCTTAGG + Intergenic
1202130524 Y:21604888-21604910 AAGGATCTGCAGGACGCCTCAGG - Intergenic