ID: 1128158142

View in Genome Browser
Species Human (GRCh38)
Location 15:65404732-65404754
Sequence GCTATTGCTGCAGCCAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128158138_1128158142 -5 Left 1128158138 15:65404714-65404736 CCTTTCCCCAGATATGGTGCTAT 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1128158142 15:65404732-65404754 GCTATTGCTGCAGCCAATAGAGG 0: 1
1: 0
2: 0
3: 5
4: 69
1128158139_1128158142 -10 Left 1128158139 15:65404719-65404741 CCCCAGATATGGTGCTATTGCTG 0: 1
1: 0
2: 0
3: 13
4: 118
Right 1128158142 15:65404732-65404754 GCTATTGCTGCAGCCAATAGAGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128158142 Original CRISPR GCTATTGCTGCAGCCAATAG AGG Intronic
910074269 1:83258973-83258995 GCTATTGCCTCAGCCCATGGTGG + Intergenic
913048284 1:115091804-115091826 GCCATTTCTGAAGCCAATTGAGG + Intergenic
918398930 1:184144472-184144494 GCTATTGCTGGGGCCAATCTAGG - Intergenic
921669990 1:217914613-217914635 GCCATTGCTGCAGTCTCTAGAGG - Intergenic
922337524 1:224629814-224629836 GCTGTTGCTCCAGCCGAGAGAGG - Intronic
1063366655 10:5494817-5494839 CCTTTTTCTGCAGGCAATAGGGG - Intergenic
1068680106 10:59810182-59810204 GCCATAGCTGCATCCAAAAGAGG + Intronic
1072926437 10:99620782-99620804 GCTCTTTCTGTAGCCAATCGGGG - Intergenic
1074185448 10:111096706-111096728 GATATGGCTGCAGACAGTAGAGG - Intergenic
1074663384 10:115689919-115689941 GCCATTGCTGCTGCCACTGGAGG - Intronic
1074780222 10:116797097-116797119 GCACTTGCTGCAGCCACCAGGGG + Intergenic
1075080723 10:119381810-119381832 GGGATGGCTGCAGCCAATGGTGG - Intronic
1075094540 10:119462176-119462198 GCTGCTGCTGCAGCCTGTAGTGG - Intergenic
1083350051 11:62021436-62021458 GCAATATCTGCAGCCAAAAGGGG + Intergenic
1088303501 11:108384237-108384259 GCTATTGCAGAAGCCTGTAGAGG + Intronic
1090077849 11:123590712-123590734 CCTGTTGCTGCAGCCAGTGGTGG + Intronic
1093098781 12:15002320-15002342 CCAATTGCTGCTGCCAAGAGAGG - Intergenic
1100673379 12:96840104-96840126 ACTATTGTTGCAGCCATTTGGGG + Intronic
1103712852 12:122925782-122925804 GCTATTAGTGCTGCTAATAGTGG - Intronic
1104872169 12:132007715-132007737 GCTATTGCTGCAGAGAAGAGGGG + Intronic
1111555533 13:89876520-89876542 AGTATTGCTGAAGCAAATAGTGG - Intergenic
1113012522 13:105786530-105786552 GATATTGCTTCAGCCAAGAATGG - Intergenic
1113126549 13:106985453-106985475 GCTATTGTTGCTGTCGATAGAGG + Intergenic
1119253584 14:73179102-73179124 TCCATTCCTGCAGCCAAAAGTGG + Intronic
1121829458 14:97037096-97037118 CCTCTTGCTGCAGTCAAAAGTGG - Intergenic
1122697258 14:103562259-103562281 GCGGCTGCTGCAGCCAGTAGCGG - Exonic
1128158142 15:65404732-65404754 GCTATTGCTGCAGCCAATAGAGG + Intronic
1130437332 15:83914198-83914220 GCTCTTGATCCAGCCAATGGTGG + Intronic
1131814754 15:96211088-96211110 CCTAATACTGCAGCCAAAAGTGG + Intergenic
1132768275 16:1546193-1546215 GCTGTGGCTGCAGCCATCAGAGG - Intronic
1133387753 16:5384154-5384176 GCAATTCCTGCAGCCAAGGGTGG + Intergenic
1136656650 16:31713259-31713281 GCTCTTACTGCAGCCAACAAAGG - Exonic
1137829668 16:51532007-51532029 GGTCTTGCTGCAACCAATATGGG - Intergenic
1139323804 16:66135911-66135933 GCTATTGCTGCACCCAGTTAGGG + Intergenic
1150540667 17:66095197-66095219 GCTATTGCTGCAGTGAACATGGG - Intronic
1151399442 17:73846324-73846346 GCTGTTGTTCCAGCCAATAGTGG + Intergenic
1155522308 18:26680901-26680923 GTTATAGCTGCAGCAATTAGGGG - Intergenic
1163252664 19:16135507-16135529 GCTATGGCTGCAGCGTGTAGAGG - Intronic
926806258 2:16714711-16714733 GTCATTGGTGCAGCCAATGGAGG + Intergenic
934886965 2:98033286-98033308 GCCATTACTGAAGCCAAAAGTGG - Intergenic
937355595 2:121196311-121196333 GCAATTGGAGCAGCCAAGAGAGG + Intergenic
948622289 2:239243941-239243963 GATACTGTTGCAGCCAAGAGAGG - Intronic
1170530749 20:17288468-17288490 GGCATTGCTGCAGCCATTAGTGG - Intronic
1170656676 20:18293252-18293274 GCTATGGCTGCAGTCATTTGGGG + Intronic
1171237493 20:23539407-23539429 GCCATTGGAGCAGCCCATAGAGG + Intergenic
1173943442 20:46931781-46931803 GCTACTCCTGCAGCCCAGAGGGG - Intronic
1183266159 22:36826971-36826993 GGTGTTCCTTCAGCCAATAGGGG + Intergenic
951516871 3:23569551-23569573 GCTCTAGCTGCAGCAAGTAGTGG - Intronic
960501360 3:118442780-118442802 GCTATTGTTGGAGGCAGTAGAGG - Intergenic
960698971 3:120422554-120422576 GTTAGTGCAGCAGCCAACAGTGG + Intronic
961390536 3:126550117-126550139 GCAATGGCTGCAGCCAGCAGGGG - Intronic
966275222 3:178157207-178157229 GCTTTTGCTTCAGCCTAGAGGGG - Intergenic
972157846 4:36186633-36186655 GCTATAGATGCAGCCAGGAGTGG - Intronic
986343955 5:6817238-6817260 GGTATTGCTGGAGCCAAGAAAGG - Intergenic
993023358 5:82618446-82618468 CCTATTGCTGCATCCTCTAGAGG + Intergenic
993412925 5:87594444-87594466 GCTGTTTCTTCAGCCAAAAGAGG + Intergenic
994598960 5:101877294-101877316 GAAACTGCTGCAGCCAATAGGGG - Intergenic
1002392010 5:178921513-178921535 GCTGTTGCAGCAGCCACCAGAGG + Intronic
1004910676 6:20279897-20279919 ACTAATGCTGGAGACAATAGAGG + Intergenic
1006700871 6:35972047-35972069 GGTTTTGCTGCAGCCACTGGAGG + Intronic
1008484024 6:52015851-52015873 GCTATTGCAGTAGGCAAAAGTGG - Intronic
1010523041 6:76864617-76864639 TATATTACTGCAGCCAACAGTGG + Intergenic
1011557752 6:88587605-88587627 GCTATGGCAGCAGCTAAAAGTGG - Intergenic
1013071556 6:106733663-106733685 GCTATAGGTGCAGACAGTAGAGG + Intergenic
1027291966 7:76723835-76723857 GCTATTGCCTCAGCCCATGGTGG + Intergenic
1028878937 7:95857214-95857236 GCTATTGCTGCAACTAAAGGAGG - Intronic
1035297471 7:157875653-157875675 GCTGCTGCTGCAGCCACCAGGGG - Intronic
1038528915 8:28300952-28300974 GCCAATGCTGCCTCCAATAGCGG + Intergenic
1042702783 8:71635034-71635056 GCAAATTATGCAGCCAATAGAGG - Intergenic
1045937226 8:107694710-107694732 TCTCTTCCTGCAGCCAATAGAGG - Intergenic
1046454071 8:114436355-114436377 GCCATTGCTGCAGGCAAATGAGG - Intergenic
1046628275 8:116598296-116598318 GATATTGCTGCAGCCAAGTTTGG + Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1058732992 9:107868321-107868343 ACTATTGGGGCAGCAAATAGAGG + Intergenic
1194003251 X:88458007-88458029 GCTATTGATGGAGCCATTATTGG + Intergenic