ID: 1128160521

View in Genome Browser
Species Human (GRCh38)
Location 15:65420746-65420768
Sequence CTGTAGAAGGAGAATGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 489}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128160521_1128160526 21 Left 1128160521 15:65420746-65420768 CCATCATCATTCTCCTTCTACAG 0: 1
1: 0
2: 4
3: 46
4: 489
Right 1128160526 15:65420790-65420812 TACTACTCATCACTTTCTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128160521 Original CRISPR CTGTAGAAGGAGAATGATGA TGG (reversed) Intronic
900906279 1:5561848-5561870 CTGGAGTAGGAGAATGGTGGTGG + Intergenic
901189071 1:7393843-7393865 CTGGAGAGGGAGGATGAAGAGGG - Intronic
901824497 1:11851891-11851913 CTGAGGCAGGAGAATCATGAAGG + Intergenic
902180160 1:14682049-14682071 CTGGAGATGGATAGTGATGATGG - Intronic
902211463 1:14907756-14907778 CTGTTGAAGGAGCATGATGGGGG + Intronic
902466124 1:16619876-16619898 CTGCAGCAGGAGCATGACGAGGG - Intergenic
903374396 1:22856698-22856720 CTGTAAAATGGGAATGATAATGG + Intronic
903567226 1:24277234-24277256 CTGTAAAATGGGTATGATGATGG - Intergenic
903872308 1:26445136-26445158 CTGTAAAAGGGGAATAATAAGGG + Intronic
904279616 1:29409604-29409626 TTGTGGGGGGAGAATGATGAAGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905257219 1:36692597-36692619 CTGTAGGTGGAGAGTCATGAAGG + Intergenic
905300525 1:36983536-36983558 CTGTGAAATGAGAATGATGATGG - Intronic
905909597 1:41644744-41644766 CTGCAAAATGAGAATGATAAAGG - Intronic
906009972 1:42513820-42513842 CTGTACAAGAAGCATAATGATGG + Intronic
907858389 1:58326453-58326475 CTTGAGGAGGAGAAAGATGAAGG + Intronic
908082969 1:60600321-60600343 CTGTACAGGAAGCATGATGATGG + Intergenic
908532201 1:65044484-65044506 CTGTAGAAAAAGAATGCTTATGG + Intergenic
908897278 1:68914442-68914464 CTGTGGAATGAGAAAGATAAGGG - Intergenic
909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG + Intergenic
910719091 1:90265873-90265895 GTGTAGGAGGAGGATGAAGATGG + Intergenic
910959292 1:92744526-92744548 CTTAAGAAGGAGAATTATCAGGG - Intronic
911606015 1:99906075-99906097 CTGGAGATGGACAGTGATGATGG - Intronic
912753316 1:112303487-112303509 CGGGAGCAGGAGAATGATGGGGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
915262342 1:154686122-154686144 CTGCAAAAGGGGAATAATGATGG - Intergenic
916127357 1:161582993-161583015 CTGTAGAAGAAGATTCATGTGGG - Intronic
916137276 1:161664797-161664819 CTGTAGAAGAAGATTCATGTGGG - Intronic
916862690 1:168823675-168823697 CTGTACAGGGAGCATGATGCTGG + Intergenic
917811791 1:178665766-178665788 CTGGAGATGGATAGTGATGATGG + Intergenic
917814455 1:178693446-178693468 GTGTGGAAGGAGAATGCTGCTGG - Intergenic
918190345 1:182167891-182167913 CTGAAGATGGATAATGGTGATGG + Intergenic
918246337 1:182662936-182662958 CTGTAGATTGAGAATGGGGAGGG + Intronic
918708686 1:187700855-187700877 CTGTAGAATGAGAACAAAGAAGG + Intergenic
918966076 1:191350163-191350185 ATGAAGAAGGATAGTGATGATGG + Intergenic
919287418 1:195581755-195581777 CTGGAGATGGACAATGTTGATGG - Intergenic
919321637 1:196048101-196048123 CAGTAGCAGGAGAAAGAAGAGGG + Intergenic
919447266 1:197723247-197723269 CTCTATCAGGAGATTGATGAGGG - Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919745983 1:201009453-201009475 CTGTCGAAGGAGAAGATTGAGGG - Exonic
920213144 1:204343390-204343412 CTGTAAAATGTGAGTGATGATGG - Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922547524 1:226469500-226469522 CTGTACAAGCAGTATGATGCTGG - Intergenic
922911274 1:229219801-229219823 CTGTGGATGGATGATGATGATGG + Intergenic
923368607 1:233287839-233287861 CTGTAAAATGGGAATAATGATGG + Intronic
924442989 1:244102368-244102390 GTGCAGAAGGAGAATGCTGCTGG - Intergenic
1062964865 10:1599308-1599330 CTGCAAAATGAGGATGATGACGG + Intronic
1063224662 10:4004486-4004508 CTGTTGAATGAGAAGGCTGAAGG + Intergenic
1063475571 10:6325895-6325917 CGGCAGAAGGAGCATGAGGAAGG - Intergenic
1064824231 10:19376985-19377007 AAGTAAAAGGAGAATGATTAAGG + Intronic
1065119595 10:22515630-22515652 CTTTAGGAGGAGAATTAGGAGGG + Intergenic
1065961080 10:30734852-30734874 GTGTGGAAGGAGCATGATAAGGG + Intergenic
1067698121 10:48549931-48549953 CTGTGGCAGGAGAATGGTGTCGG - Intronic
1068197921 10:53743626-53743648 CTGTACAAGAAGCATGATGCCGG + Intergenic
1068413947 10:56692355-56692377 CTGTATAAGAAGCATGATGCTGG - Intergenic
1068430992 10:56931960-56931982 TTGTACAAGGGGAAGGATGAGGG + Intergenic
1069965572 10:72112474-72112496 CTGGAGATGGATAGTGATGATGG + Intronic
1070402743 10:76067787-76067809 GAGTAAAAGGAGAATCATGATGG + Intronic
1072173450 10:92891075-92891097 CTGGAGAAGGAGAATAGTCAAGG + Intronic
1072688131 10:97550894-97550916 CTGGAGGAGGATAATGATGGTGG - Intronic
1074202938 10:111256058-111256080 CTCTAGAAGGAGGAGGAAGAGGG + Intergenic
1074481170 10:113822352-113822374 CTGCGGAAGGAGAATGGTGTGGG - Intergenic
1074905689 10:117861602-117861624 CTGTACAAGAAGCATGATGCTGG + Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1077679865 11:4228860-4228882 CTACAGAAGAAGAATGATGCTGG + Intergenic
1077681620 11:4247053-4247075 CTACAGAAGGAGAAGGATGCTGG - Intergenic
1077826577 11:5816236-5816258 CTGGAGATGGAGAGTGGTGATGG + Intronic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1078646225 11:13143248-13143270 GTGATGAAGCAGAATGATGAAGG + Intergenic
1079522500 11:21344855-21344877 CTGGAGAAGCAGAATAATTAAGG - Intronic
1082644814 11:55709523-55709545 CTGTACAGGAAGCATGATGATGG - Intergenic
1082673697 11:56069090-56069112 TTACAGAAGGAGGATGATGAAGG + Intergenic
1082891998 11:58149544-58149566 CTGGAGAAGGATAGTGGTGATGG - Intronic
1084416746 11:69036843-69036865 CTGTAGAATGGGGATAATGATGG - Intergenic
1085573030 11:77576090-77576112 CTGTAGATGGATAGTGGTGATGG - Intronic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1086806835 11:91254350-91254372 CTGGAGATAGAGAGTGATGATGG - Intergenic
1087026302 11:93653233-93653255 CTGTAGAATGGGCATGATGGTGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1088213060 11:107477393-107477415 CTGTAAAATGAGGATGATGATGG - Intergenic
1088716453 11:112553844-112553866 CTGTAAAATGAGAAAGATAAAGG + Intergenic
1090030559 11:123202634-123202656 CTCTAGAAGGAGAATGGAGCTGG - Intergenic
1090162770 11:124512905-124512927 CTTTAAACGGTGAATGATGATGG + Intergenic
1090725657 11:129524967-129524989 TTGTTGAAGGCCAATGATGAAGG + Intergenic
1090979462 11:131704463-131704485 CTGTAGAAGCTGACTGGTGAAGG + Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091919359 12:4292018-4292040 CTGTAGATGGAGAGTTCTGATGG + Intronic
1092231515 12:6778189-6778211 CGGAAGGAGGAGAAGGATGAAGG - Intronic
1092788671 12:12053049-12053071 CCTTAGAATGACAATGATGATGG + Intronic
1093224682 12:16467642-16467664 ATGTTGAAGGTGAATGATTATGG - Intronic
1093550998 12:20411222-20411244 CTGAAGATGGATATTGATGATGG - Intronic
1094366014 12:29681907-29681929 TTGTTGAAGGTGAAAGATGAGGG + Intronic
1094749084 12:33384487-33384509 CTGTGGAAGAAAAATGATAAGGG - Intronic
1095922982 12:47549496-47549518 GCCTAGAAGGAGAGTGATGAGGG + Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096320584 12:50609041-50609063 CTGAAGCAGGAGAATCATGGAGG + Intronic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1097313127 12:58143037-58143059 CTGTAAAATGAGGATAATGATGG - Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097736918 12:63192694-63192716 CTTTAGCAGGAGAATCATCAAGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1099198874 12:79652153-79652175 CTGGAGATGGATAATGGTGATGG + Intronic
1099272913 12:80535629-80535651 CTCTAGGATGTGAATGATGATGG + Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100376579 12:94021696-94021718 CTGGAGATGGATGATGATGATGG + Intergenic
1101618002 12:106356811-106356833 CTGTAAATGGAGAATGGTGATGG - Intergenic
1102090832 12:110185989-110186011 CAATAGAAGAACAATGATGAAGG - Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102246015 12:111356317-111356339 CTGGAGATGGAGGGTGATGATGG - Intergenic
1103200508 12:119084191-119084213 CTGTAGAAGGTGAATATTGGAGG + Intronic
1104647828 12:130509589-130509611 CTGTAGAAGGACACTGTTGGGGG - Intronic
1105601171 13:21888760-21888782 CTGTAGAAGGAGTTGGATCAAGG + Intergenic
1105939774 13:25137373-25137395 CAGTCAAAGGAGAATGCTGATGG + Intergenic
1106417962 13:29561637-29561659 CTGTTCAAGGAGAGTGATGGAGG + Intronic
1106790522 13:33151289-33151311 CTGTACAAGGAGCATGGTGTTGG + Intronic
1106940542 13:34774009-34774031 CTATAAAATGGGAATGATGAAGG + Intergenic
1107095789 13:36533652-36533674 CTGTAGCAAGGGAATCATGACGG + Intergenic
1109167937 13:59058960-59058982 ATGTAGAATGGGAATGAAGACGG + Intergenic
1110048684 13:70864890-70864912 CTGGAGATGGATAATGGTGATGG - Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1112810846 13:103216842-103216864 AAATAGGAGGAGAATGATGAAGG - Intergenic
1114196827 14:20485499-20485521 CTGAACAAGGGGAATGGTGATGG + Intergenic
1114437970 14:22723826-22723848 CTGTAGAGGGTGGATGATGGGGG - Intergenic
1115688514 14:35821338-35821360 CTTTAGAACAAGAATGTTGAGGG + Intergenic
1117054675 14:51899535-51899557 CTGTAGATGGATGATGATCATGG - Intronic
1119378440 14:74213727-74213749 CTGTAGAATGGGAATAATAATGG - Intergenic
1119544606 14:75462486-75462508 CTGTAGAAAGAGACTAATGAAGG - Intronic
1120120522 14:80674330-80674352 CTCTATAATAAGAATGATGATGG - Intronic
1120230950 14:81840538-81840560 CTCTAAAATGAGAATGATGCTGG + Intergenic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1120929233 14:89831647-89831669 CTGGAGAATGAGAATGGTGAAGG + Intronic
1121217727 14:92261600-92261622 CTGGAGAAGGACAGTGATCAGGG - Intergenic
1121490765 14:94358580-94358602 CTGTACAAGAAGCATGATGCTGG - Intergenic
1121978166 14:98425691-98425713 CTGTTGCAGGAGAAGAATGAAGG - Intergenic
1121979195 14:98439480-98439502 CTGTTGAAGGAAATTCATGAAGG - Intergenic
1202830767 14_GL000009v2_random:26907-26929 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1124610073 15:31202102-31202124 CTGTAGAATGGGAATGATAGTGG - Intergenic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1125986947 15:44062832-44062854 TTGTATAAGGAGTATGATAAAGG + Intronic
1126394349 15:48197344-48197366 AAGTAGAAAGAGAATGATGGTGG - Intronic
1127185865 15:56480090-56480112 CTGGAGATGGACAATGGTGATGG + Intergenic
1128159961 15:65417150-65417172 CTGGGAAAGGAGAATGGTGATGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128773975 15:70304662-70304684 ATGTAGAAAGAGAATTATAAAGG - Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129108329 15:73323517-73323539 ATGTGGAAGGAGGATGAAGACGG + Exonic
1129432346 15:75508935-75508957 CTTCAGGAGGAGACTGATGATGG + Exonic
1129459173 15:75691526-75691548 CTGTTGAAGGGGACTGATCAAGG - Intronic
1129750308 15:78058335-78058357 CTGTAGAAGGGCAATGGTGTTGG - Intronic
1131710191 15:95045537-95045559 CCGTACATGGAAAATGATGATGG + Intergenic
1132624493 16:884865-884887 AGGTAGAGGGAGAATGATCACGG + Intronic
1133489284 16:6251337-6251359 CTGTAACAGGAGAATAATAATGG - Intronic
1135343871 16:21671240-21671262 CTGTAAAATGAGATTAATGATGG - Intergenic
1136542682 16:30937057-30937079 CTGTAGAAAGGAGATGATGATGG + Intronic
1137381821 16:48006546-48006568 CTGTATAAGAAGCATGATGCTGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137929854 16:52576488-52576510 CAGTAGCAGGCAAATGATGATGG - Intergenic
1138321211 16:56113630-56113652 CTGAAGAGGCAGAATCATGAAGG - Intergenic
1139132890 16:64167778-64167800 CAGGAGGAGGACAATGATGAAGG - Intergenic
1139228698 16:65259097-65259119 ATGAAGAAGGAGAGTGTTGAGGG + Intergenic
1140251803 16:73300912-73300934 GTGGAGAAGGAGACTGATGTTGG + Intergenic
1141137302 16:81474638-81474660 CTGTGGAAGGGGAATGATGGGGG + Intronic
1141148019 16:81545554-81545576 CTGTAGATGGAGGAGGATGCTGG - Intronic
1141167694 16:81671464-81671486 CTTTGGAAGAAAAATGATGAGGG - Intronic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142893855 17:2962339-2962361 CTGTAAAATGGGAATGATGATGG - Intronic
1143481637 17:7230561-7230583 CTCCAGAAGGAGAAGGCTGAGGG + Intronic
1145822552 17:27850722-27850744 CTGTGGAAGGAGAGTGATGCTGG + Intronic
1146313491 17:31789181-31789203 CTTTAGGAGAAGAATGCTGATGG - Intergenic
1146448763 17:32954887-32954909 ATGTAAAAGGAGGGTGATGAGGG - Intergenic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1147800696 17:43084616-43084638 GTGTAGCAGGAGAAAGAAGATGG - Intronic
1147849080 17:43427324-43427346 CTGTAGAATGGGGATGATTAAGG - Intergenic
1148123610 17:45225841-45225863 CTGTAAAAAGAGAATAATAATGG + Intronic
1149316435 17:55443360-55443382 CTTCAGAAGGAGACTGATCAGGG - Intergenic
1149456242 17:56790975-56790997 CTGTACAGGAAGCATGATGATGG - Intergenic
1149666423 17:58367974-58367996 CTGTAAAAGGGGAATAATAATGG - Intronic
1151341999 17:73477529-73477551 CTGTAAAATGGGAATAATGATGG + Intronic
1151644509 17:75420902-75420924 CTGGAGATGGACAATGGTGATGG + Intergenic
1151649946 17:75460897-75460919 CTGGAGATGGATAGTGATGAGGG - Intronic
1153580859 18:6571959-6571981 CTGTCTAGGGAGAAAGATGATGG - Intronic
1153709374 18:7782516-7782538 CTGGAGAAGGACAATGGTGATGG - Intronic
1155670258 18:28362097-28362119 CTGTGGAAGGAGAAAGGTAATGG - Intergenic
1156580297 18:38367193-38367215 CTGAAAAAGGAGATAGATGAGGG + Intergenic
1157543338 18:48528838-48528860 CTGTAAAATGAGAATGATGATGG + Intergenic
1157724130 18:49950412-49950434 TTTTAGAAGCAGATTGATGATGG - Intronic
1158125215 18:54093478-54093500 CTGTACAAGAAGCATGATGCTGG + Intergenic
1158205261 18:54985656-54985678 CAGTAGAAGGAGAGAGATAATGG - Intergenic
1158994105 18:62899692-62899714 CTGTAGAAGGGCTATGGTGATGG - Intronic
1159854503 18:73568100-73568122 CTGCAATAGGAGATTGATGATGG - Intergenic
1160191704 18:76719995-76720017 CTGGAGATGGATAATGTTGATGG + Intergenic
1161509589 19:4663113-4663135 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161509719 19:4663640-4663662 CTGTAGAATGAGGATGAGGTGGG - Intronic
1162827380 19:13261697-13261719 CTGTAAAATGGGAATGATCATGG - Intronic
1163142860 19:15362252-15362274 CTGTAGAAGGAAAACAAGGAGGG + Intronic
1165333516 19:35154396-35154418 CTGGGGGAGGAGAATGAAGAGGG - Intergenic
1165912602 19:39238217-39238239 CTCTAGAAGGAGACTGCTTAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1202641926 1_KI270706v1_random:100869-100891 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
925332446 2:3069231-3069253 CTGGAGATGGATGATGATGATGG + Intergenic
925482647 2:4293224-4293246 GTGGAGAAGGATAAGGATGAGGG - Intergenic
925696242 2:6582872-6582894 GTGTTGAAGCAGAATGTTGAAGG + Intergenic
925877428 2:8324935-8324957 CTGTAAAAGGAGGATAATAATGG - Intergenic
926206936 2:10840473-10840495 CTGTGGAAGGAGACTGTAGATGG + Intergenic
928150396 2:28823065-28823087 ATGTAAAAGGGCAATGATGATGG - Intronic
928221773 2:29409312-29409334 CAGTAGAAGGAGAAAAAGGAAGG - Intronic
928407200 2:31023801-31023823 CTGGAGGAGGAGAGTGATGAGGG - Intronic
929185355 2:39088406-39088428 CTGGAGATGGATAATGGTGATGG - Intronic
929209771 2:39342429-39342451 CGGTAGAAAAAGGATGATGAAGG - Intronic
929220495 2:39459868-39459890 CTGTATAATGATTATGATGATGG + Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
931292273 2:60883140-60883162 CTGTACTAAGAGAATGAAGAGGG + Intronic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931811036 2:65855353-65855375 CTGTAGAAGGAAAATTTTGTGGG - Intergenic
932460755 2:71880435-71880457 ATGTAGAGGGAGCATGAGGAAGG - Intergenic
933819930 2:86101724-86101746 CTGCAGATGGAGAGTGGTGATGG - Intronic
935192573 2:100790808-100790830 CTGGAAAAGGAGTATGATGATGG - Intergenic
936502215 2:113075108-113075130 CTGCAGAATGAGAGTGCTGATGG - Intronic
936634696 2:114242627-114242649 CTGTAGAGGAAGCATGATGCTGG + Intergenic
936990322 2:118357120-118357142 CTGGAGATGGATAGTGATGATGG - Intergenic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
939243503 2:139593555-139593577 CTGTAGAGGAAGCATGATGCTGG - Intergenic
939403107 2:141720493-141720515 CTGTAAAAGGTGCAAGATGATGG - Intronic
940412176 2:153377654-153377676 CTGTACAAGAAGCATGATGCTGG - Intergenic
940555609 2:155224410-155224432 CTGTAGAAAAAGAAGCATGATGG + Intergenic
940716574 2:157232037-157232059 CTGGAGATGGATAGTGATGAAGG - Intergenic
941294785 2:163723415-163723437 CTATAGTAGGAGAAAGATGATGG + Intronic
941783407 2:169473762-169473784 CTGTAGAAGGCAAAATATGAAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942248621 2:174029174-174029196 CTGCAGAAGGTGATTGAAGAGGG + Intergenic
943725903 2:191251088-191251110 CTGGGGAAGGAGAATGACGCAGG - Intronic
944117366 2:196203793-196203815 CTGGAGATGGATAGTGATGATGG - Intronic
944992610 2:205255042-205255064 CTGTAGATGGAGGGTGATGGTGG - Intronic
945109007 2:206344875-206344897 CTGTACAAGAAGAATGACGCTGG - Intergenic
945365848 2:208952876-208952898 TTATAGAAAGACAATGATGATGG + Intergenic
945413535 2:209542144-209542166 ATGTACAAGGAGATTGATGTTGG - Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
945869053 2:215207166-215207188 GTGTAGAAGGAGATTAAAGATGG - Intergenic
945938463 2:215925402-215925424 CTGTAGCAGGCGAGTGATAACGG - Intergenic
946147513 2:217742132-217742154 CTGGAAAAGGAGGATGGTGATGG - Intronic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
947341177 2:229141371-229141393 CTCTGGAAGGAGAATAAAGAGGG + Intronic
947925202 2:233915100-233915122 CTGTAGGTGGATGATGATGATGG - Intergenic
947932943 2:233978979-233979001 CTGAAGAAGCAGAGTGATGTGGG + Intronic
948104456 2:235401888-235401910 CTGGAGAAGGAGAAAGTTGTAGG - Intergenic
1170321950 20:15109993-15110015 ATGTACAAGGAACATGATGATGG + Intronic
1172951888 20:38727569-38727591 CTGTACGAGGAGAATGAAGACGG + Exonic
1173456480 20:43206512-43206534 CTGTACAGGGAGCATGATGCTGG + Intergenic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1174354792 20:49990493-49990515 CTGAAGGAGGAGAAAGATGCCGG + Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174740123 20:53004872-53004894 CTGTAAAATGGGAATAATGATGG - Intronic
1175867324 20:62186231-62186253 CTTTAAAATGAGGATGATGAAGG + Intronic
1176609954 21:8871745-8871767 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1176900637 21:14437651-14437673 CTTGAGAACAAGAATGATGAAGG + Intergenic
1177089410 21:16748245-16748267 CTGTATAAGAAGTATGATGCTGG - Intergenic
1178213089 21:30559860-30559882 CTGTACAGGAAGAATGATGCAGG - Intronic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1178897878 21:36575395-36575417 CTGTAAAATGGGAATAATGATGG - Intronic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1180360019 22:11880996-11881018 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1181283771 22:21737575-21737597 CTGGAGAGGGATGATGATGATGG - Intergenic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182873889 22:33673615-33673637 CTGGAGATGGATAGTGATGATGG - Intronic
1182953778 22:34401896-34401918 CAGCAGAAGGATACTGATGAGGG - Intergenic
1183247776 22:36707134-36707156 CTGTAAAATGGGAATAATGATGG - Intergenic
1184006223 22:41711437-41711459 GCCTAGAAGGAAAATGATGAAGG - Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG + Intergenic
1184487578 22:44790148-44790170 CTGGGGTTGGAGAATGATGACGG + Intronic
1184574959 22:45356273-45356295 CTGTAGAGGGAGGAGGATGGTGG - Intronic
1184756796 22:46520814-46520836 CTGGAGATGGAGGGTGATGATGG - Intronic
949161442 3:887901-887923 TTGTAGAAGGACAGTGATGTTGG + Intergenic
949347769 3:3092782-3092804 CAGTAGAAGGAAAAAGAAGAAGG - Intronic
951074496 3:18373150-18373172 CTTTAGAAAGTGAATGAAGAAGG + Intronic
951276447 3:20692180-20692202 CTGGACAAGGATAATGATAATGG + Intergenic
952153325 3:30616324-30616346 CTAAAGTAGGAAAATGATGAAGG - Intronic
953706384 3:45234188-45234210 CTGTAAAATGAGAATAATAATGG + Intergenic
954111670 3:48437009-48437031 CAGTAGAAGGAAGAGGATGAGGG - Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954369906 3:50164746-50164768 CTGTGGAAGCAGCATCATGAGGG + Intronic
954893837 3:53958336-53958358 CTGTTGAAGAAGACTGAGGAGGG - Intergenic
955118634 3:56032169-56032191 CTGTACAAGAAGCATGATGCTGG - Intronic
955130303 3:56159204-56159226 CTGTAGAGGAAGCATGATGCTGG - Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956000367 3:64723584-64723606 CTGGAGAAGGATGATGCTGATGG + Intergenic
956064284 3:65380433-65380455 CTGGAGATGGATGATGATGATGG - Intronic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
958735755 3:98007628-98007650 CTGTAAAAGGAGAGGAATGATGG + Intronic
958788309 3:98623054-98623076 CTGTACAAGAAGCATGATGAGGG + Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959658041 3:108832447-108832469 CTGTAGAAGATGTTTGATGATGG - Intronic
961131126 3:124468089-124468111 CTGTTGAGGGAGAATGAGCAAGG + Intronic
961207059 3:125092668-125092690 CTGATGAAGGAGAAAGATGGAGG + Intronic
961565721 3:127762041-127762063 CTGTAAAATGAAAATGACGATGG + Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961779531 3:129313616-129313638 GTGGAGATGGTGAATGATGAGGG - Intergenic
961935986 3:130584444-130584466 TTCTAGAATGAGAATGAGGAGGG - Intronic
965043947 3:163551167-163551189 ATGTAGAAAGAGAAAAATGAAGG - Intergenic
965338335 3:167455697-167455719 CTGTACAGGGAGCATGATGCTGG + Intronic
965888840 3:173484607-173484629 CTCTAAAAGGAGAATGAAGATGG + Intronic
966275689 3:178164663-178164685 CTGTAGAAGGAGAATAAAATAGG + Intergenic
966389608 3:179438238-179438260 CTGTGGAATGAGAATGATACTGG - Intronic
966550677 3:181200880-181200902 CTTTACAAGCAGCATGATGATGG + Intergenic
967132481 3:186485315-186485337 GGGTAGCAGGAGAATGATGGGGG + Intergenic
967157697 3:186708559-186708581 CTGTAGAATTAGAGTCATGAGGG - Intergenic
1202736640 3_GL000221v1_random:6535-6557 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
969135085 4:5022836-5022858 CTCTCGGAGGAGATTGATGAGGG + Intergenic
969435078 4:7184554-7184576 CTGTTCAATGAGAATGATGATGG - Intergenic
970119907 4:12741965-12741987 CTGAGGAAGTAGAATAATGAAGG - Intergenic
970166364 4:13242474-13242496 GTGAAGCAGGACAATGATGAAGG - Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
971226825 4:24761825-24761847 CTGAAGAAGGAGAAAGATAAAGG + Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971894032 4:32566775-32566797 ATGTTGAAGGAAAATGATGATGG + Intergenic
972053113 4:34764993-34765015 CTAAAGAAGGACAGTGATGAAGG + Intergenic
972139258 4:35936491-35936513 CTGTAAAATGGGAATAATGATGG + Intergenic
972401308 4:38706316-38706338 CTGTAAAAAGAAAATGATAATGG - Intergenic
972452454 4:39216003-39216025 CTGTTGAAGGAGTATGAAAATGG + Exonic
972900550 4:43677014-43677036 CTGTAAAATGAGAATCATGTTGG + Intergenic
973802040 4:54487792-54487814 GTGAAAAAGGAGAATGATTATGG - Intergenic
974199337 4:58619111-58619133 CTGTAGAATGACAATGATTCTGG + Intergenic
974583164 4:63833390-63833412 CTCAAGAAAGAGAATGATGAGGG - Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975549330 4:75594957-75594979 GTTTAGCAGAAGAATGATGAGGG + Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976315714 4:83656724-83656746 CTATAGAAAGTAAATGATGACGG + Intergenic
976569781 4:86594618-86594640 CTGTAGAAGGAGCCTGGGGAGGG - Exonic
976984095 4:91271147-91271169 CAGTAGAAGGAAAATTATGTGGG + Intronic
977277084 4:94991164-94991186 CAGTAGAAGGAGAATGAAAAAGG - Intronic
978827316 4:113041052-113041074 CTGTAGAGAGATGATGATGAGGG - Intronic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979435136 4:120679294-120679316 TTGTATAAGGTGAAAGATGAAGG - Intergenic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
980122724 4:128744284-128744306 CTGGAGATGGACAATGGTGAGGG - Intergenic
980174802 4:129331749-129331771 TTGTAAAATGAGAATGATAATGG - Intergenic
980575490 4:134680597-134680619 CTGTAGCAGGCGAGTGATAACGG + Intergenic
980640875 4:135577430-135577452 CTTTAGAAGGCCAAGGATGAAGG + Intergenic
980848548 4:138353573-138353595 CTGAAGCAGGAGAATCCTGAAGG + Intergenic
981655212 4:147105086-147105108 CTGTAAAAGGAGAAGGGTAAGGG - Intergenic
982306875 4:153941775-153941797 CTGCAGAAGGGGAGTGATCAGGG - Intergenic
982643554 4:157993383-157993405 CTGTAGAAGGAAAAAGATATTGG + Intergenic
982918266 4:161242100-161242122 GTGCTGCAGGAGAATGATGATGG - Intergenic
983580458 4:169304687-169304709 CTGTTGAAGGAGATTAATAATGG + Intergenic
983815429 4:172120694-172120716 CCATAGAAAGAGAATGATAATGG + Intronic
983872739 4:172841023-172841045 CTATGGAAGGAGAATGGTGGAGG - Intronic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984406255 4:179334956-179334978 CAGGAGAAAGAGAATAATGATGG + Intergenic
1202769294 4_GL000008v2_random:186734-186756 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
985992821 5:3577428-3577450 CTGTAGAGGAAGCATGATGTTGG - Intergenic
986321500 5:6635529-6635551 CTGTAGAATGGGCATGGTGATGG + Intronic
988000914 5:25347167-25347189 AGGAAGAAAGAGAATGATGAAGG - Intergenic
988213429 5:28239467-28239489 CTGTAAAATGGGAATCATGATGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
991613279 5:68469979-68470001 CTGAAAATGGAGAATCATGAAGG - Intergenic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
994045460 5:95304415-95304437 GTGTAGAAGGAAAATGAAAAAGG + Intergenic
995214309 5:109577402-109577424 ATGTACAAGGAGATTGATGTTGG - Intergenic
995316660 5:110782353-110782375 CTGTACAAGAAGCATGGTGAGGG + Intergenic
995674913 5:114652589-114652611 TTGTAGCAAGAGAATGTTGACGG - Intergenic
995838512 5:116421696-116421718 CTGTACAAGAAGCATGATGCTGG + Intergenic
995857415 5:116607915-116607937 CTGTACAAGAAGCATGATGCTGG + Intergenic
996235972 5:121129141-121129163 CTGTACAGGAAGCATGATGATGG - Intergenic
996460603 5:123736576-123736598 CTGTAAAATGGGAATGATTATGG - Intergenic
996546092 5:124680196-124680218 CCGTAGAAGGATAATTATGATGG + Intronic
997354925 5:133256245-133256267 ATTTAGAAGGAGAATAATGTGGG - Intronic
997447853 5:133954652-133954674 CTGTGGAGGGAGCATGATGCTGG - Intergenic
998181404 5:139947993-139948015 CTGGAGATGGAGAATGGTGATGG - Intronic
998204663 5:140149943-140149965 CTTTAGGATGAGACTGATGAGGG + Intergenic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
999564046 5:152837980-152838002 CTGTAGAAGATGAATAATGAGGG + Intergenic
999706022 5:154273004-154273026 CTGCAGATGGGGAATGCTGAGGG + Intronic
1000060780 5:157653105-157653127 CAGTAGAAAGAGAATGATGATGG - Intronic
1000065786 5:157691934-157691956 CAGTAGAAAGAGAATGATGATGG - Intergenic
1000898953 5:166890194-166890216 CCACAGAATGAGAATGATGATGG + Intergenic
1001237615 5:170043384-170043406 GTGGAGTAGGATAATGATGACGG - Intronic
1001714427 5:173803147-173803169 CTGTAAAAGGAGGATAATAACGG + Intergenic
1001719413 5:173844296-173844318 CTGAAAAAAGAGAATGCTGAGGG + Intergenic
1001883713 5:175269531-175269553 CTGGAGATGGATAATGGTGATGG + Intergenic
1002454955 5:179340662-179340684 CTGTAGAAGGGGGATGATGTCGG + Intronic
1003215650 6:4107713-4107735 CTGGAGAAGGATAGTGACGATGG - Intronic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004891848 6:20108489-20108511 CTATAGAAAGAGAAGGTTGAGGG - Intronic
1005279163 6:24252622-24252644 AAGTAGAAAGAGAATGGTGAGGG + Intronic
1005599929 6:27416227-27416249 CTATAAAATGAGAATGGTGATGG + Intergenic
1006090543 6:31626132-31626154 TTGGATCAGGAGAATGATGATGG + Exonic
1006332641 6:33403412-33403434 GTGTAAAGGGAGAATGATGGAGG + Intronic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006770185 6:36546927-36546949 CTGCAAAAGGAGAAAGATAAAGG + Intronic
1007148930 6:39668118-39668140 CTGTACAGGGAGTATGGTGACGG - Intronic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1009911271 6:69931291-69931313 CTTTAGAAGGAGAATGCTTAAGG - Intronic
1010009888 6:71037576-71037598 CTGTATAAGAAGCATGATGCTGG + Intergenic
1010057298 6:71581622-71581644 CTTTAAAATGAGAATGATGATGG - Intergenic
1010288830 6:74112046-74112068 AGGGAGAAGGAGAAAGATGAAGG - Intergenic
1010582860 6:77620857-77620879 CTGGAGATGGATAGTGATGATGG - Intergenic
1011002583 6:82607586-82607608 CTGTAAAATGGGAATAATGATGG - Intergenic
1011009139 6:82684169-82684191 CTGTAAAATGGGAATGATAATGG - Intergenic
1011140546 6:84150875-84150897 CTGTAGGAGGAGAATGAGCATGG - Intronic
1011245475 6:85317169-85317191 CTGTATAGGGAGTATGATGCTGG - Intergenic
1011350205 6:86414714-86414736 CTGTAGAAGGAGACTGTGGCAGG + Intergenic
1011647080 6:89469924-89469946 CTGTAGAAGGAGAAGAATCTGGG - Intronic
1011934729 6:92761891-92761913 CTATAAAATGAGAATGATGATGG - Intergenic
1012238011 6:96839667-96839689 CAGAAGAATGAGAATGCTGATGG + Intergenic
1012981969 6:105840660-105840682 CTGTAGAAGGAGGGAGATGAGGG - Intergenic
1013003874 6:106052082-106052104 CTGGAGATGGATACTGATGATGG + Intergenic
1013007824 6:106090558-106090580 CTTTAGAAGGTGAAAGAGGATGG + Intronic
1013573504 6:111454477-111454499 CTGGAGATGGATAGTGATGATGG - Intronic
1013795997 6:113889601-113889623 CTGGATAAGGAGAAAGATGCTGG + Intergenic
1013899317 6:115133956-115133978 CTTGTCAAGGAGAATGATGATGG - Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014748375 6:125226972-125226994 CTGTAAAAGGAGTATGTTTAGGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015370589 6:132447379-132447401 ATTTAGAAGGAAAATGATAAAGG - Exonic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017203323 6:151778302-151778324 CTGGAGATGGACAATGGTGATGG + Intronic
1017293335 6:152766203-152766225 CAGCAGTAGGAGAAAGATGAAGG + Intergenic
1017582757 6:155884530-155884552 GTGTATAAGGAGAAAGATGGTGG - Intergenic
1017784241 6:157741716-157741738 TTGTGCAAGGAGAATGCTGATGG - Intronic
1018020135 6:159754761-159754783 CTGTAGAAGGAAAATATTCAAGG - Intronic
1018721224 6:166574043-166574065 CTGTAGAGAGAGAATGACCACGG - Intronic
1019574658 7:1731345-1731367 CAGAAAAGGGAGAATGATGAAGG + Intronic
1019701362 7:2476331-2476353 CTGGAGAAGGAGAACGGTGCAGG - Intronic
1020538544 7:9431159-9431181 TTGAAGAAGGATGATGATGAAGG - Intergenic
1022063592 7:26826659-26826681 ATATAGAAGGAGAAAGAAGACGG - Intronic
1022166359 7:27766794-27766816 CTTTAGAAAGAGAATGCTCATGG - Intronic
1022325038 7:29323413-29323435 CTGTGGTAGCAGAATAATGAGGG - Intronic
1022801443 7:33780877-33780899 CTGTAGAAGGGGGGTGATGGTGG - Intergenic
1023171550 7:37394523-37394545 CTGCAGAAGGAGAATAATTGGGG + Intronic
1023762162 7:43475042-43475064 CTGGGGAAGGAGAGTGGTGATGG + Intronic
1023905218 7:44517003-44517025 CTTCAGAAGGAGAATGCTGAGGG + Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024782474 7:52867005-52867027 CTGTTTAAGGAGATTGAAGATGG - Intergenic
1026389714 7:69888237-69888259 CTGTACAAGAAGAATGGTGCTGG + Intronic
1026975521 7:74495457-74495479 ATGAAGAAGGTGAATGGTGAGGG - Intronic
1027880479 7:83829127-83829149 TGGTAGAAGTAAAATGATGAGGG - Intergenic
1028155269 7:87422445-87422467 CTGTAGATGGATACTGGTGAAGG - Intronic
1028519931 7:91718626-91718648 CTGAAGAAGAAGAAGGATAATGG - Intronic
1029763657 7:102613736-102613758 CTGTGGAAGGAGGAGGATCAGGG + Intronic
1030131865 7:106208291-106208313 CTGGAGATGGATAGTGATGAGGG + Intergenic
1031878089 7:127164249-127164271 CTGTACAAGAAGCATGATGCTGG - Intronic
1032172337 7:129595539-129595561 AGGTAGAAGGAGAATATTGAAGG + Intergenic
1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG + Intronic
1032606283 7:133357862-133357884 CTGTGGCAGGAGAAGGATAAAGG - Intronic
1033063282 7:138128505-138128527 CTGTACAGGAAGAATGATGCTGG + Intergenic
1033536812 7:142320363-142320385 CCGAAGAGGGAGAATGAAGATGG + Intergenic
1033787776 7:144754646-144754668 CTGTAGAATGAGGATGATAATGG + Intronic
1034382914 7:150714566-150714588 CTGTACAGGGAGCATGATGCTGG - Intergenic
1035344522 7:158189352-158189374 CCGAAGGAGGAGCATGATGATGG + Intronic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1037048558 8:14340866-14340888 CTTAAGATGGAGAGTGATGATGG - Intronic
1037626920 8:20616172-20616194 CTGTATAAGGAGAATAGTGAAGG - Intergenic
1037683694 8:21119621-21119643 CTGTGGAAGGAGGATGAAGTTGG + Intergenic
1038526449 8:28278130-28278152 CTGGAGAAGGATCATGATGATGG + Intergenic
1038538383 8:28371058-28371080 CTGTAAAATGGGAATGATGATGG - Intronic
1038541827 8:28396186-28396208 CTATAGAAGGATAAGGAAGAAGG - Intronic
1038552227 8:28480179-28480201 CTGAAAAAGGAAAATGATAAAGG - Intronic
1038893492 8:31754495-31754517 CTGTAGAGGAAGCATGATGCTGG - Intronic
1039261995 8:35781902-35781924 AGGTAAAAGGATAATGATGAGGG + Intronic
1039400778 8:37267132-37267154 CTGTCCCAGGAGAATGATGGAGG - Intergenic
1039598313 8:38810881-38810903 CTGAAGTAGGAGGATGATGTGGG + Intronic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039772419 8:40700790-40700812 CTGTAGAAGAAGAATGTACAAGG - Intronic
1041438234 8:57865025-57865047 CTGGAGAAGGATGATGGTGATGG - Intergenic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1042976388 8:74474779-74474801 CTTTTGTAGCAGAATGATGATGG + Intronic
1043035964 8:75199689-75199711 CTGAAGAAGGAAATTGAAGAGGG - Intergenic
1043823935 8:84902165-84902187 CTGTACAGGGAGCATGATGCTGG + Intronic
1044221188 8:89672203-89672225 CTGTACAAGAAGCATGATGCTGG + Intergenic
1044298059 8:90551355-90551377 TTGTAAAACAAGAATGATGATGG - Intergenic
1045803403 8:106127945-106127967 CTGTAGAAGAAGCATGGTGCTGG - Intergenic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046657191 8:116907655-116907677 CTGTAAAATGGGAATGATGATGG - Intergenic
1046743113 8:117849006-117849028 CTGTAGATGGTGACTGAGGATGG - Intronic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1046840249 8:118848235-118848257 CAGTAGAATGAGGATGATGTAGG + Intergenic
1047783933 8:128135427-128135449 CTGGAGAAGAAGTGTGATGAAGG - Intergenic
1048506661 8:135027765-135027787 CTGTACAAGAAGAATGAAGTGGG - Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052512917 9:29444661-29444683 CTGTACAGGGAGCATGATGCTGG - Intergenic
1054360419 9:64108905-64108927 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1055661404 9:78507402-78507424 CTCTAGCAGGAGAATGAAAAAGG + Intergenic
1057102953 9:92381057-92381079 CTGGAGAAGGACAGTGGTGATGG - Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058584056 9:106487737-106487759 CTGAACAAGGAGCATGATGGTGG + Intergenic
1058991378 9:110257247-110257269 CTGTAGAACGGGAATCATGATGG + Intergenic
1059266032 9:113031470-113031492 ATGGAGATGGAGAATGGTGATGG + Intergenic
1059619253 9:115985252-115985274 ATGTAGAAGGAGAAAACTGAGGG - Intergenic
1059744451 9:117186446-117186468 CTGAAGCAGGAGAATGGTGCGGG + Intronic
1060438268 9:123615047-123615069 CTGGAGAATGCGAATGATCATGG + Intronic
1060709678 9:125846641-125846663 ATGTAGAAGGAGAAAGCTGATGG - Intronic
1060991621 9:127853030-127853052 CTGTAAAATGGGGATGATGATGG + Intronic
1203694182 Un_GL000214v1:80450-80472 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
1203705372 Un_KI270742v1:36975-36997 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1203558637 Un_KI270744v1:28830-28852 CTGCAGAAGAGGAATGGTGAGGG + Intergenic
1203642091 Un_KI270751v1:23613-23635 CTGCAGAAGAGGAATGGTGAGGG - Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1186806342 X:13143772-13143794 CTGTACAGGGAGAATGATGAGGG + Intergenic
1187482125 X:19667258-19667280 CTGGAGATGGATAGTGATGACGG + Intronic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188954034 X:36413452-36413474 CTGTACAAGAAGCATGATGCTGG + Intergenic
1189345243 X:40236135-40236157 CTGGAGATGGATAATGGTGATGG - Intergenic
1189504769 X:41601163-41601185 CTGGAGATGGATAGTGATGATGG + Intronic
1189911273 X:45812738-45812760 CTGTACAAGAAGCATGATGCTGG + Intergenic
1191592065 X:62897282-62897304 GTGGAGATGGGGAATGATGAGGG + Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1192831538 X:74755710-74755732 CTGCAAAAGGAGTGTGATGAGGG - Intronic
1192851881 X:74965498-74965520 GTGTAGAATGAGAAAGATGGAGG - Intergenic
1192923047 X:75728328-75728350 CTATACAAGAAGAATGATGCTGG + Intergenic
1193219347 X:78904176-78904198 CTTGAGATGGAGATTGATGATGG - Intergenic
1194747256 X:97641510-97641532 CTGCAGAAGATGAATCATGAGGG + Intergenic
1195758196 X:108220058-108220080 CTGTAGAAGCATAATGGAGAGGG - Intronic
1195918639 X:109960192-109960214 CTGTACAGGAAGAATGATGCTGG - Intergenic
1196250789 X:113457942-113457964 ATGTAAAGGGGGAATGATGAAGG + Intergenic
1196480748 X:116144650-116144672 CTTTAGAAGAAAAATGATGGAGG - Intergenic
1197087785 X:122499441-122499463 CTGTAGAAGAAACAGGATGAAGG - Intergenic
1197221992 X:123923044-123923066 CTGTGCAAGGTGAATGATGGAGG + Intergenic
1197283974 X:124573208-124573230 CTTTAGAAACATAATGATGAAGG + Intronic
1198649549 X:138846615-138846637 CTGTACAAGAAGCATGATGCTGG - Intronic
1198673050 X:139102313-139102335 CTGCAAAATGAGAATGATGCTGG + Intronic
1198873893 X:141202889-141202911 CTGTATAGGTAGAAAGATGAGGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199418563 X:147615976-147615998 CTGTGAAAGGAGAGTGATAATGG + Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200207969 X:154331313-154331335 CTGTAAAATGAGCATGATGATGG + Intergenic
1200799959 Y:7377495-7377517 GTGCAGAAGGAGACAGATGAAGG - Intergenic
1202031344 Y:20577448-20577470 CAATAGAAGGGGAATGATCAGGG + Intronic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic