ID: 1128161031

View in Genome Browser
Species Human (GRCh38)
Location 15:65422950-65422972
Sequence CCGCGGCGCCGCGCCTCCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 326}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128161031_1128161054 25 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161054 15:65422998-65423020 GGCCCGAGCTGGGGCCGGCGCGG 0: 1
1: 1
2: 0
3: 66
4: 557
1128161031_1128161044 -2 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161044 15:65422971-65422993 GGGCGGGGGCGCGGCCTCGGGGG 0: 1
1: 0
2: 14
3: 128
4: 930
1128161031_1128161055 26 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161055 15:65422999-65423021 GCCCGAGCTGGGGCCGGCGCGGG 0: 1
1: 0
2: 4
3: 82
4: 683
1128161031_1128161048 14 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161048 15:65422987-65423009 TCGGGGGCCCGGGCCCGAGCTGG 0: 1
1: 0
2: 1
3: 29
4: 301
1128161031_1128161050 16 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161050 15:65422989-65423011 GGGGGCCCGGGCCCGAGCTGGGG 0: 1
1: 0
2: 1
3: 74
4: 540
1128161031_1128161057 27 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161057 15:65423000-65423022 CCCGAGCTGGGGCCGGCGCGGGG 0: 1
1: 0
2: 2
3: 41
4: 343
1128161031_1128161045 3 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161045 15:65422976-65422998 GGGGCGCGGCCTCGGGGGCCCGG 0: 1
1: 0
2: 9
3: 86
4: 765
1128161031_1128161043 -3 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161043 15:65422970-65422992 CGGGCGGGGGCGCGGCCTCGGGG 0: 1
1: 1
2: 14
3: 69
4: 568
1128161031_1128161049 15 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161049 15:65422988-65423010 CGGGGGCCCGGGCCCGAGCTGGG 0: 1
1: 0
2: 3
3: 38
4: 372
1128161031_1128161042 -4 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161042 15:65422969-65422991 GCGGGCGGGGGCGCGGCCTCGGG 0: 1
1: 3
2: 17
3: 83
4: 809
1128161031_1128161041 -5 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161041 15:65422968-65422990 CGCGGGCGGGGGCGCGGCCTCGG 0: 1
1: 0
2: 11
3: 105
4: 865
1128161031_1128161046 4 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161046 15:65422977-65422999 GGGCGCGGCCTCGGGGGCCCGGG 0: 1
1: 0
2: 6
3: 67
4: 635
1128161031_1128161059 28 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161059 15:65423001-65423023 CCGAGCTGGGGCCGGCGCGGGGG 0: 1
1: 0
2: 5
3: 49
4: 607
1128161031_1128161051 20 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161051 15:65422993-65423015 GCCCGGGCCCGAGCTGGGGCCGG 0: 1
1: 1
2: 10
3: 76
4: 867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128161031 Original CRISPR CCGCGGCGCCGCGCCTCCCC GGG (reversed) Exonic