ID: 1128161046

View in Genome Browser
Species Human (GRCh38)
Location 15:65422977-65422999
Sequence GGGCGCGGCCTCGGGGGCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 709
Summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 635}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128161033_1128161046 3 Left 1128161033 15:65422951-65422973 CCGGGGAGGCGCGGCGCCGCGGG 0: 1
1: 1
2: 4
3: 45
4: 342
Right 1128161046 15:65422977-65422999 GGGCGCGGCCTCGGGGGCCCGGG 0: 1
1: 0
2: 6
3: 67
4: 635
1128161028_1128161046 18 Left 1128161028 15:65422936-65422958 CCGGGCGTCAGTGGCCCGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1128161046 15:65422977-65422999 GGGCGCGGCCTCGGGGGCCCGGG 0: 1
1: 0
2: 6
3: 67
4: 635
1128161031_1128161046 4 Left 1128161031 15:65422950-65422972 CCCGGGGAGGCGCGGCGCCGCGG 0: 1
1: 0
2: 7
3: 52
4: 326
Right 1128161046 15:65422977-65422999 GGGCGCGGCCTCGGGGGCCCGGG 0: 1
1: 0
2: 6
3: 67
4: 635

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128161046 Original CRISPR GGGCGCGGCCTCGGGGGCCC GGG Exonic
900121865 1:1051686-1051708 GGGTGGGGCCTCGTGGGCTCCGG - Intronic
900125542 1:1067499-1067521 GGGCAGGGCCTCGCGGGCGCAGG + Intergenic
900211851 1:1460029-1460051 GAGCAGGACCTCGGGGGCCCGGG - Intronic
900283912 1:1890496-1890518 GGCCGGGGCCCCGGGGGCGCGGG - Intronic
900306410 1:2011168-2011190 GGGCGCGGTCGCTGGGGTCCTGG - Intergenic
900514212 1:3073661-3073683 GAGCGGGGCCTGGGGGACCCCGG + Intronic
900594112 1:3472649-3472671 TGGTGCGGCAGCGGGGGCCCGGG + Intronic
900786772 1:4654664-4654686 GGGCGCGGGCGGCGGGGCCCCGG + Intergenic
900984616 1:6066154-6066176 GGAAGCGGCCTCGGGAGCCCAGG - Intronic
901628968 1:10639007-10639029 GGGCGCGGGCGCGCGGACCCCGG - Exonic
901700951 1:11044580-11044602 GGGCTCAGCCTCTGGGGACCTGG + Intronic
901791301 1:11654845-11654867 GGGCGGGGCCTGGCGGGCCGGGG + Exonic
901930796 1:12595403-12595425 GGGCGGGGCCGCGGGGGTCCCGG + Intronic
902067468 1:13700214-13700236 CGGCGCGGCCGCGGGCGCCGGGG + Intronic
902336853 1:15758953-15758975 GGGCGCCGCGCCGGGGGTCCCGG - Intronic
902385591 1:16073684-16073706 GGGCGCGGCGGGCGGGGCCCGGG + Intergenic
902400833 1:16155857-16155879 GGCCGCGGCCGCGGCGGCGCAGG - Exonic
903078038 1:20787093-20787115 GGGAGCGGCGTCGGCGCCCCGGG + Intronic
903132771 1:21290334-21290356 GGGCGCGGCCTGGAGGGCGGGGG - Intronic
903182401 1:21611587-21611609 AGGCGTGGCCTGGGGGGCCCCGG - Intronic
903233967 1:21937560-21937582 GGGCGGGGGACCGGGGGCCCGGG + Intergenic
903349749 1:22710703-22710725 GCGCGCGGCCGCCGGGGGCCGGG + Intergenic
903504720 1:23825325-23825347 GGCCGCCGCCTCGGCGGCTCGGG + Intronic
903522224 1:23959562-23959584 GGCCGGGGCCTCGGCGGGCCAGG + Intronic
903788310 1:25875588-25875610 GCGGGCGGCCTCGGGCGCTCTGG + Intergenic
903795121 1:25922923-25922945 GGGCGCGGCCGCGTGCGCCCGGG - Intergenic
904039513 1:27575851-27575873 GGGCCCGGCCTGGCGGGCCGGGG - Intronic
904128559 1:28259621-28259643 GCGAACGGCCTCGGGGGCCTGGG - Exonic
904244987 1:29181494-29181516 TGGCGGCGCCTCGGGGGCGCGGG - Intronic
904682799 1:32240754-32240776 GGGCGCGGTCGTAGGGGCCCGGG - Intergenic
904822667 1:33255997-33256019 GGCCACGGCCGCCGGGGCCCCGG + Intergenic
905800364 1:40838844-40838866 GGGAGCGGGCGCTGGGGCCCTGG + Exonic
906517478 1:46448210-46448232 GCGCGCGGCCTCGGGAGCGCTGG + Intergenic
907200928 1:52726413-52726435 AGGCGCGGGCTCGCGCGCCCGGG + Intergenic
907278079 1:53327920-53327942 GGGCGCGGCGGCCGGAGCCCCGG - Exonic
907901801 1:58748064-58748086 GGGAGCCGCCTGGGGAGCCCAGG + Intergenic
908751678 1:67430152-67430174 GGGGGCGGCGTTGGGGGCCCTGG - Exonic
908796261 1:67833473-67833495 GGGCGGGGCGGCGGCGGCCCCGG + Intergenic
909475222 1:76074639-76074661 GGGCGGGGCCGCGCGGGCCGCGG + Intergenic
913047943 1:115089531-115089553 GGGCGGGGCCTCCGGGGGGCGGG + Intergenic
913250737 1:116910328-116910350 GCGCGCGGCCTGGGGCGCCGAGG + Intronic
915246290 1:154558469-154558491 GGGGGCGGCGCCGGGGGCCGGGG - Exonic
915309776 1:155001211-155001233 GGGCGGCGCCAGGGGGGCCCTGG - Intergenic
915462159 1:156076746-156076768 GGGGGCGGCCTGCGGAGCCCCGG - Exonic
916651770 1:166839902-166839924 GGGCGCGGCGGCGGTGGCGCAGG + Intronic
917962302 1:180154774-180154796 GGGCGGGGGCTCGGGGGCGGGGG + Intergenic
919731601 1:200916524-200916546 GGGTGCGGCCCTGGGGGCCGCGG + Intergenic
919878876 1:201889277-201889299 GGCAGAGGCCTCGGGGGCTCTGG + Intronic
921944975 1:220880028-220880050 GGGGGCGGCCCCGGAGGGCCTGG + Exonic
922467894 1:225856880-225856902 GGGCAGGGCCTCGGGGCTCCCGG + Intronic
922505174 1:226121992-226122014 GGGCGGGGCCTCGGCGTCCGGGG - Intergenic
922720341 1:227896995-227897017 GGGGGCAGCCTCGGAGGCCCAGG + Intergenic
923490417 1:234478940-234478962 GCGCGCGGCAGCGGGGGCGCAGG - Exonic
1062774754 10:135642-135664 GGCCGCGGCCTCTGGGGCGGCGG + Intronic
1062874086 10:931482-931504 TGGCGCGGCCGCCGGGCCCCGGG - Exonic
1063418287 10:5890442-5890464 GGGTGGGGCAGCGGGGGCCCCGG + Intronic
1064209083 10:13348120-13348142 GGCGGCGGCGGCGGGGGCCCGGG + Exonic
1065099906 10:22321894-22321916 GGGCGCGCGCTCGCGGGCGCGGG - Intronic
1066464396 10:35640319-35640341 GGGCGCGGGCGCGGGCGGCCCGG - Exonic
1066758208 10:38730880-38730902 CGGCGCAGCCTCGGAGGCTCAGG + Intergenic
1067103714 10:43351276-43351298 GGGCGGGGGAACGGGGGCCCGGG - Intergenic
1067432863 10:46255405-46255427 GGGCAGGGCCTCGTGGGCCCTGG + Intergenic
1067440394 10:46306031-46306053 GGGCAGGGCCTTGTGGGCCCTGG - Intronic
1067462136 10:46465839-46465861 GGGCGGGGCCGAGTGGGCCCCGG - Exonic
1067625059 10:47918759-47918781 GGGCGGGGCCGAGTGGGCCCCGG + Intergenic
1068967151 10:62924390-62924412 GAGGGCGGCCTCAGGTGCCCCGG + Intergenic
1069744283 10:70705231-70705253 GGACGCAGCCTCAGGGGCCAAGG - Intronic
1069849631 10:71396744-71396766 GGGCGGGAGCTCGGGGGTCCTGG + Intergenic
1070544071 10:77438998-77439020 GGGCTCGGCCTCGGCCTCCCGGG - Intronic
1072903661 10:99431066-99431088 AGGCCCGGCCTGGCGGGCCCGGG + Intergenic
1073207990 10:101778780-101778802 GGGAGCGGCCTGCGGGGGCCCGG - Intronic
1073297675 10:102450878-102450900 CGGCGCGGCCTCGGGTGGCGCGG + Exonic
1073325908 10:102643977-102643999 GGGCGCGGGCTGCGGGGCGCGGG - Intergenic
1073328949 10:102658511-102658533 GGGCTGGGCCTGGGAGGCCCTGG - Intergenic
1074169740 10:110920014-110920036 GGGCGCGGGCCGGGGGCCCCCGG + Intronic
1074829985 10:117241316-117241338 GGGCGGGGCTGCGGGGACCCCGG + Intronic
1075334435 10:121598263-121598285 AGCTGCGGCCTCGGGGCCCCCGG + Exonic
1075343064 10:121662569-121662591 GTGAGCAGCATCGGGGGCCCGGG + Intergenic
1075520024 10:123137617-123137639 GGCTGCAGCCGCGGGGGCCCCGG + Exonic
1076371750 10:129959810-129959832 CCGCGCGGGCTCGGGCGCCCTGG - Intronic
1076817652 10:132922718-132922740 TGGCGTGGCATCAGGGGCCCTGG + Intronic
1076824587 10:132960602-132960624 GGGGGGGGCCTGGGGGGCACCGG - Intergenic
1076830967 10:132994043-132994065 GGCCGCGGCCTGGGGGGCTGAGG - Intergenic
1077063494 11:627465-627487 GGGGGGGGACTGGGGGGCCCCGG + Intergenic
1077064885 11:636745-636767 GGGCGCGGAGTCGGGGGCAGGGG + Intergenic
1077101631 11:825024-825046 GCGCGGGGCCTCAGCGGCCCAGG - Exonic
1077105954 11:842732-842754 TGCCGCGGCCGCGCGGGCCCGGG - Intergenic
1077107894 11:849811-849833 GCGCGCGGGGTCGGGGGCGCGGG + Intronic
1077228883 11:1449911-1449933 GGGGGCAGCCTCGCGGACCCTGG + Intronic
1077233759 11:1470200-1470222 GGGGCCGGCAGCGGGGGCCCGGG - Exonic
1077253753 11:1571806-1571828 GGGCGCCGCGTCGGGGGCGCTGG - Intronic
1077264573 11:1642407-1642429 GGGGGCGGGCCAGGGGGCCCAGG - Intergenic
1079090354 11:17476417-17476439 TGGCGCGGGATCGGGGGCACCGG + Intronic
1079163172 11:18012975-18012997 GGGGGCGGCCTCCGAGGCGCTGG + Exonic
1079459894 11:20669994-20670016 GGACCCGGCCTCAGGGGCGCAGG + Intronic
1079689391 11:23403500-23403522 GGGCCCGGGCTCGGGAGCCTGGG - Intergenic
1080807057 11:35663073-35663095 GGCCAAGGCCTCGGGGCCCCGGG - Exonic
1081861047 11:46333416-46333438 GGGCACGGCCGCTGGGCCCCCGG + Intronic
1081992709 11:47346420-47346442 GGGCGGGGCTTCCTGGGCCCAGG + Intronic
1082243112 11:49891777-49891799 GCGCGCGGCCTGGTGGTCCCGGG + Intergenic
1082657614 11:55872602-55872624 GCGCGCGGCCTGGTGGTCCCGGG + Intergenic
1082821227 11:57545976-57545998 CTGCTCGGCCCCGGGGGCCCCGG + Exonic
1083658770 11:64242444-64242466 GGCCACGGCCACGGGGGCCGAGG + Exonic
1083659753 11:64246628-64246650 GGGCGCGGCGTTGGCGGCCCCGG - Exonic
1083728846 11:64642647-64642669 GGGGGCGGCCGAGGGGGCCCGGG - Intronic
1083932927 11:65855712-65855734 GGGCGCAGACTCGGGGGCCCTGG + Exonic
1083992966 11:66258001-66258023 GGGCGCGGTCCCGGGTGGCCCGG + Intronic
1084538878 11:69774633-69774655 GGGCACCTGCTCGGGGGCCCCGG - Intronic
1084727239 11:70949732-70949754 GGCCCAGGCCACGGGGGCCCAGG - Intronic
1085057148 11:73411694-73411716 GGGAGCTGCCTCTGGGGCCAGGG - Intronic
1085522777 11:77147978-77148000 GGGCGGGGCCTGAGGGGGCCTGG - Intronic
1086590481 11:88509178-88509200 GAGCGCGGCCGCGCGGGCGCCGG + Exonic
1086724632 11:90167267-90167289 GGGCCCGCCCTCGGAGGCGCCGG + Intronic
1088626193 11:111732327-111732349 GAGGGGGGCCTCGGGGGCCCAGG - Intronic
1089014213 11:115153586-115153608 GCGGGCGGCCTCAGGAGCCCAGG - Intergenic
1089729635 11:120512037-120512059 GGGCGCGGGGGCGGGGGCCGGGG - Intronic
1090375166 11:126283163-126283185 GGGCGGGGTCGCGGGGGACCGGG + Intronic
1090375186 11:126283230-126283252 GGGCCGGGACTCTGGGGCCCAGG - Intronic
1090799166 11:130159961-130159983 GCGAGCGGCCTCGGGGACCATGG + Exonic
1091550226 12:1530811-1530833 GGGGGCGGCCGGCGGGGCCCGGG - Intronic
1091823113 12:3491077-3491099 GGGGGCGGGCCCGGGGGCGCTGG + Intronic
1092383588 12:8018707-8018729 GGGCGCGGCGGCGGCGGCCTGGG - Intergenic
1092743166 12:11649554-11649576 AGGGGCGGCCGCGGGGGCGCGGG - Intergenic
1095752298 12:45727161-45727183 TGGCGCGGCCGAGGTGGCCCAGG + Intergenic
1096459384 12:51814041-51814063 GCGCGCGCCCCCGGGGGCCTGGG - Intergenic
1096460876 12:51821001-51821023 GCGCGCGCCCTCGGCGGCGCCGG + Intergenic
1096654320 12:53079214-53079236 GGGCGGGGGCTCTGGGGCCAGGG - Intronic
1097019176 12:56007771-56007793 GGGCGGGGCCTCGGTAGCCGGGG + Intronic
1097019186 12:56007792-56007814 GGGCGGGGCCTGAGGGGCTCTGG + Intronic
1097033282 12:56104828-56104850 GAGTGCGGCCTCGGGGGTCGGGG + Intronic
1097180650 12:57169829-57169851 GGGCCCAGCCTCGGGGGCGGTGG + Intronic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1099315533 12:81078247-81078269 CGGGGCGGTCTCGGGGGCCGGGG + Exonic
1101371862 12:104137964-104137986 GGGAGCGGCCTCGCAGGCGCGGG + Intronic
1102025874 12:109714161-109714183 GGATGCAGCCTCGGGGGCCTCGG - Intergenic
1102101414 12:110281465-110281487 GGGAGGGGGCTCGGGGGCCGCGG + Intronic
1102678074 12:114672062-114672084 GGCGGCGGCCGCGGGGCCCCTGG - Exonic
1103120672 12:118376914-118376936 CGGGGCGGCCTCCGGGGCCTGGG + Intronic
1103474803 12:121210425-121210447 CGGCGCGGCGGCTGGGGCCCAGG - Intronic
1103568716 12:121830313-121830335 GGGGGCGGGCGCGGGGGGCCGGG - Exonic
1103907748 12:124336018-124336040 AGGCGGGGCCCCGGGGACCCAGG - Intronic
1103983990 12:124755129-124755151 GGGCTGGGCCTCGGGCGCCCTGG - Intergenic
1103989197 12:124786808-124786830 TGGCGGGGCCACCGGGGCCCTGG + Intronic
1104623804 12:130337552-130337574 GGGCGGGGCCTGTGGGGGCCTGG + Intergenic
1104854298 12:131894888-131894910 GGGCGCGGGGCCGGGGGCGCGGG - Exonic
1105472246 13:20704301-20704323 GGGCGCGTCCTGGCGGGGCCCGG + Intronic
1105678077 13:22696626-22696648 TGGAGCGGCGGCGGGGGCCCTGG + Intergenic
1106157351 13:27171363-27171385 GGGCGCCGCCTGGTGGGCCAGGG - Intronic
1106264821 13:28100522-28100544 CGGCGCGGCCTGGGGACCCCGGG - Exonic
1107555313 13:41512705-41512727 GGGCGCTGCCTGGGAGCCCCTGG + Intergenic
1108648160 13:52450612-52450634 GCTCGCGGCCTCGGAGGGCCGGG - Exonic
1110436233 13:75481218-75481240 GGGCTCGGCCTTGGGGGATCGGG - Intronic
1110630187 13:77698180-77698202 CGCCGCGGCCTCAGGGGGCCTGG + Intronic
1110705918 13:78602139-78602161 GGGGGCGGCGGCGGCGGCCCGGG - Exonic
1112692882 13:101916634-101916656 GGCCGCGGCCATGGTGGCCCCGG + Intronic
1112752558 13:102597220-102597242 GGGCCCGGGCGCGGGGGCGCGGG + Intronic
1113656120 13:112068570-112068592 GGCCGCGTCGTCGGGCGCCCTGG + Exonic
1113737798 13:112690467-112690489 CGGCGCGGGCTGGGGGACCCGGG + Intronic
1113841702 13:113364474-113364496 CGCCGCGGCCTCGGAAGCCCCGG - Intergenic
1113889972 13:113730578-113730600 GGGCGCAGCCACGGGGACTCAGG - Intronic
1114627938 14:24141494-24141516 GGGGGCGGACTCCGGGACCCAGG - Exonic
1115028169 14:28766564-28766586 CCGCGCGGCCTCGGGGTCCGAGG + Intergenic
1115093090 14:29602238-29602260 GAGAGTGACCTCGGGGGCCCAGG + Intronic
1115852662 14:37599856-37599878 GCGCGCGGCCGCGGGGACCCAGG - Intronic
1116817849 14:49599754-49599776 GGGCGCGGCGACCGGGGCCGGGG + Intronic
1118404982 14:65413405-65413427 TGGCGCAGCCCCGGGGGCGCGGG + Intronic
1119106847 14:71932684-71932706 CCGCGCGTCCTCGCGGGCCCGGG + Exonic
1119219371 14:72893602-72893624 GGCCGCGGGCTCGGGGGCGCGGG + Intronic
1119383022 14:74240511-74240533 ACGCGCGGGCTCGGGGACCCTGG + Intronic
1121453962 14:94026811-94026833 GGGCGCCGCCTCGACGGCGCTGG + Intronic
1121645750 14:95516423-95516445 CGGCGCGGGGGCGGGGGCCCCGG - Intronic
1122130917 14:99604244-99604266 GGGCGGGGCGGCGGGGGCTCCGG - Intergenic
1122162277 14:99793252-99793274 GGGGGCGGCCTCGGCGGCCGCGG - Intronic
1122221327 14:100240342-100240364 CGCCGCGGCCTCGCGGGCCAGGG + Intronic
1122418296 14:101560706-101560728 GGGCGCGGCCAGGGCGGCGCGGG + Intergenic
1122418367 14:101560953-101560975 GGCCGCCGCTTCGGTGGCCCCGG - Intergenic
1122657663 14:103273294-103273316 GGGCGAGGCCGCGGGGGACCCGG - Intergenic
1122736889 14:103848165-103848187 GGGCGCGGCCCCGAGAGCCGCGG - Intergenic
1122917514 14:104865752-104865774 GGGCGGGGACCCGGGTGCCCAGG - Intronic
1122993333 14:105249099-105249121 GCGCGCGGGCGCGGGGGCCGCGG - Intronic
1123021120 14:105398438-105398460 GGGCGCGGTCTGGGGGTCCCCGG - Intergenic
1123024880 14:105419864-105419886 CTGCGCGGCCTCGGCGGCCTCGG + Exonic
1123051550 14:105546601-105546623 GGTCATGGCCTCTGGGGCCCTGG + Intergenic
1124161178 15:27271502-27271524 GGGCGTGGCCTGGGGGCTCCGGG - Intronic
1126483659 15:49155443-49155465 GGGAGAGGCCGCGGGCGCCCCGG + Intronic
1127867187 15:63042501-63042523 GGCCGCCGCCTCGGCGGCTCGGG + Intergenic
1128161046 15:65422977-65422999 GGGCGCGGCCTCGGGGGCCCGGG + Exonic
1128547739 15:68579198-68579220 GGGGGCGGCGGCGGCGGCCCGGG - Exonic
1128767935 15:70262445-70262467 GGCCTTGGCCCCGGGGGCCCAGG + Intergenic
1129660707 15:77551350-77551372 GTGTGCGGCCTCTGAGGCCCTGG + Intergenic
1129682141 15:77663941-77663963 GGGCTCTGCCTTGGGAGCCCAGG - Intronic
1129780036 15:78264238-78264260 GGGGGCGGCCTCGGGGCGGCGGG + Exonic
1129893948 15:79090163-79090185 GGCCGCGGCCCTGGGGGCTCAGG - Intronic
1130023698 15:80252106-80252128 GGGCGCGGGCTCGCGGGGCGCGG + Intergenic
1131133071 15:89912568-89912590 GGGCGCGGCGGCAGGGGCGCCGG + Intronic
1131184933 15:90265922-90265944 GGGCGCGGCCTGGAGCGCCGGGG - Intronic
1131200001 15:90388227-90388249 GGGCGGGGCCTCGGGGACCCCGG + Exonic
1131257405 15:90871617-90871639 GGGCGCGGGGCCCGGGGCCCGGG + Intronic
1132017181 15:98328439-98328461 GGGCGGGGCTTCTGGGGCACTGG - Intergenic
1132619256 16:856591-856613 GGTCAAGGCCTAGGGGGCCCAGG + Intronic
1132646410 16:1001210-1001232 GGGCCCTGCCTCGGTGCCCCCGG + Intergenic
1132700571 16:1220441-1220463 GGGCTCGGCCTCAGGGCCCCAGG - Exonic
1132740166 16:1408226-1408248 GGGCGTGGCCTTGAGGCCCCGGG - Intronic
1132741338 16:1414768-1414790 GGGCGGGGCCGCGGGGGGCGTGG - Intergenic
1132849852 16:2020099-2020121 GCGCGCGGCCGCCGGGCCCCTGG + Exonic
1132891349 16:2206294-2206316 GGTGGAGGCCTGGGGGGCCCTGG + Intronic
1132903362 16:2270106-2270128 GGGGGCAGCCTCGGTGGTCCAGG + Intergenic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1133802127 16:9092368-9092390 GGCGGCGGCCTCGGGGATCCCGG + Intronic
1133924236 16:10181080-10181102 GGACGCTGCCTGGTGGGCCCAGG + Intronic
1134070050 16:11255351-11255373 GGGCACGGCCGCGGGCGCGCGGG + Exonic
1134134145 16:11668575-11668597 GGGCGGGGGCGCCGGGGCCCGGG + Intronic
1134149656 16:11796475-11796497 AGGCTCGACCTCGGAGGCCCCGG + Intronic
1134656212 16:15949902-15949924 GCTGCCGGCCTCGGGGGCCCGGG + Intronic
1136083421 16:27867793-27867815 GGGCGTGGCCTCAGGGGGCGTGG - Intronic
1136365406 16:29807003-29807025 GGGCTCGGCCGCCGGGGCCTGGG - Exonic
1136478293 16:30526542-30526564 ACGTCCGGCCTCGGGGGCCCGGG - Exonic
1136628737 16:31477106-31477128 GGGCGGGCCCTCGGGGGGGCGGG + Intronic
1136628843 16:31477594-31477616 GGGCGCGGCCTCCGGGGGAGAGG - Exonic
1136923368 16:34350231-34350253 GGGGGCGGCCGCGGGCTCCCGGG - Intergenic
1136981205 16:35061575-35061597 GGGGGCGGCCGCGGGCTCCCGGG + Intergenic
1138180733 16:54938601-54938623 GCGAGCGGCCTTGGGGACCCAGG - Intergenic
1138435931 16:57000098-57000120 GGGAGAGGCCTCTGGGGCCCGGG + Intronic
1138591273 16:58000786-58000808 TGGCCCGGCCACGGGGTCCCCGG - Intronic
1138659615 16:58509492-58509514 GGGCCCAGCATCCGGGGCCCAGG - Intronic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1139489585 16:67279282-67279304 GCGCGCGGTCTGCGGGGCCCGGG + Exonic
1139594291 16:67949047-67949069 AAGCGCTGCCTCGGGGTCCCTGG + Intronic
1141002265 16:80319146-80319168 GGGCTCGGCCAGGGGGGCCCAGG - Intergenic
1141184817 16:81779551-81779573 GGGCGCACCCTCGGGGACCCCGG + Intronic
1141185809 16:81786209-81786231 TGGCCCGTCCTCTGGGGCCCTGG + Intronic
1141463339 16:84191355-84191377 GGGCGCGGGCGCGGGCCCCCAGG - Exonic
1141553226 16:84819925-84819947 GGGCGTGGCCTCCGGGCTCCGGG + Intergenic
1141585038 16:85028021-85028043 GGGCGGGGCCTCGCGGGCCGAGG + Intronic
1141608646 16:85169444-85169466 GGGCGCGGCGGCGGCGGCCTGGG + Intergenic
1141693949 16:85611387-85611409 TGGCTCGGCCGCGCGGGCCCGGG - Intronic
1141694608 16:85613615-85613637 GGGCGGGGACTCGGGGGCTCCGG + Intronic
1142018629 16:87766082-87766104 GGCAGCGGGCTCGGGGGCCTCGG + Intergenic
1142195468 16:88737425-88737447 TGCCGCCCCCTCGGGGGCCCAGG - Intronic
1142290970 16:89193410-89193432 GGGCGCGACTTCAGGGGGCCGGG - Intronic
1142567583 17:850631-850653 GGGGGCGGCGTGGGGGCCCCGGG + Intronic
1142667628 17:1471702-1471724 GGGCACGGCCTGGGGGAGCCGGG + Intronic
1142762426 17:2050236-2050258 GGGCGCGGCGGCGGCGGCCGGGG + Intergenic
1142812013 17:2399866-2399888 GGGCGCAGCGAGGGGGGCCCGGG + Intronic
1142848129 17:2691926-2691948 GGGCGGGGCCGCGGGGGCACGGG - Intronic
1142848207 17:2692151-2692173 GGGGCCTGACTCGGGGGCCCGGG + Intronic
1143150734 17:4806776-4806798 GGGCGCTGCCTCGGCGCCCGGGG - Intergenic
1143485375 17:7251322-7251344 GAGCTGGGCCGCGGGGGCCCCGG - Exonic
1143521542 17:7446972-7446994 GCGCGGGGCCTCGGGGGGCGGGG + Intronic
1143554426 17:7651671-7651693 GGGCGACGCCTCGGGGGCGCAGG + Intronic
1143719374 17:8799176-8799198 GGGCGCGGCCCCAGGTACCCGGG + Exonic
1143780620 17:9226946-9226968 AGGCGGGGCCTCGGGGGGCGGGG - Intronic
1144847047 17:18225560-18225582 GGGCGCGGGCGCGCGGGGCCGGG - Intergenic
1144941888 17:18947816-18947838 GGGCTCGGCACCAGGGGCCCTGG - Intergenic
1144991558 17:19237321-19237343 GGGCGGGACCTCGGGGCCTCGGG + Exonic
1145311688 17:21704331-21704353 GGGCCAGGCCACGGGGGCCAGGG + Exonic
1146433662 17:32822635-32822657 GGGGGTGGCCGCGCGGGCCCCGG + Intronic
1146646375 17:34579817-34579839 GGGCGCGGCGCCAGGGGCCAGGG - Intergenic
1146908132 17:36630885-36630907 GTGCTGGGACTCGGGGGCCCAGG + Intergenic
1146909976 17:36642082-36642104 GGGCGCGGACTCGGGAACTCGGG - Intergenic
1147628999 17:41918296-41918318 AGGCGAGGCCTCGGGCACCCTGG + Intronic
1147648881 17:42050709-42050731 GGGCGCGGCCAGGTGAGCCCCGG - Intronic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1148081245 17:44968513-44968535 GGGCGGGGCCGCGGAGACCCCGG + Intergenic
1148779275 17:50112482-50112504 GGGCCCGGCCTCAGGGCCTCTGG + Intronic
1149477811 17:56978015-56978037 GGGCGGGGCCTGGGCGGACCCGG - Intergenic
1151414571 17:73952896-73952918 GGGCGCGGCCGCGGCGTCCGGGG - Intergenic
1151802263 17:76385303-76385325 GGGGGCGCCCTCGGAGGCACCGG + Intronic
1151854387 17:76710749-76710771 GGCCGCCGGCTCGGGGGCGCAGG + Exonic
1151854401 17:76710784-76710806 GGCCGAGGCCACCGGGGCCCCGG - Exonic
1152357831 17:79815227-79815249 GGGAGCGGCCTGGAGGCCCCGGG - Intergenic
1152362436 17:79838973-79838995 GGGCGGGGGCCCGGGGGCCGAGG - Intronic
1152426452 17:80220845-80220867 GCGCGCGGGCGCCGGGGCCCTGG + Intronic
1152538748 17:80964339-80964361 GGCCGTGGCCTGGTGGGCCCGGG - Exonic
1152541914 17:80981135-80981157 GGGCGCGGGGGCGGGGGCACGGG - Intergenic
1152634058 17:81423270-81423292 GGAAGGGGCCTTGGGGGCCCTGG + Intronic
1152797267 17:82314567-82314589 GGGGTCGGCCTCGGAGGCCTCGG + Intergenic
1152877133 17:82793305-82793327 AGGCGGGGCCTAGGGGGCACTGG - Intronic
1152903970 17:82960572-82960594 AGGAGCGGCCACGTGGGCCCGGG - Intronic
1152921378 17:83068192-83068214 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921392 17:83068226-83068248 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921430 17:83068328-83068350 GGGGGCGGCAACGGGGGTCCCGG + Intergenic
1152921466 17:83068430-83068452 GGGGGCGGCAACGGGGGTCCCGG + Intergenic
1152921504 17:83068532-83068554 GGGGGCGGCAACGGGGGTCCCGG + Intergenic
1152921555 17:83068668-83068690 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921625 17:83068842-83068864 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152942104 17:83178182-83178204 GGGCCGGGACCCGGGGGCCCAGG - Intergenic
1153348388 18:4052500-4052522 GGGCACAGCATGGGGGGCCCTGG + Intronic
1153457539 18:5296295-5296317 GGGCGGGGCTTCGGGAGCCAGGG + Intronic
1153911278 18:9708343-9708365 GGGCGCGGGCGCGGCGGCCCCGG + Exonic
1154251779 18:12750912-12750934 GGGAGCAGCCTTAGGGGCCCAGG - Intergenic
1154501433 18:14999694-14999716 TGGCTCGGCCTCGCGGGTCCGGG + Intergenic
1158436010 18:57435861-57435883 GGGGGCGGCGGCGGGGGCCCGGG + Exonic
1160499790 18:79395996-79396018 GGGCGCGGGCACCGGGGCGCGGG + Intronic
1160505183 18:79422923-79422945 GGGGGCTGCCTCGGGGGCGGGGG + Intronic
1160631277 18:80247608-80247630 GGGCGGGTCCTCCGGGGCTCGGG - Intergenic
1160719196 19:590076-590098 GGGCGCGGGCCCGGGGCCCGGGG - Exonic
1160733572 19:651871-651893 GGGCGTGACCTCGGGGGCTCAGG + Intronic
1160766870 19:812695-812717 GGGCGCGGCCGATGGGGCGCTGG - Exonic
1160807975 19:1000906-1000928 GGGAGCGGGGTCGGGAGCCCTGG + Intronic
1160860885 19:1236859-1236881 GGCGGCGGCCTCGGGGGGGCGGG + Intronic
1160864074 19:1249535-1249557 GGGCGCGCCCCGGGGGGCGCGGG - Intronic
1160873237 19:1286347-1286369 GGGCGCGGCTTGGGGGGCGTTGG - Intronic
1160917926 19:1506623-1506645 GGGCGCGGCCGCGGGTGTCAGGG + Exonic
1160930654 19:1568168-1568190 GGGGGCGGGCACGGGGGGCCGGG + Intergenic
1160939628 19:1614250-1614272 GGGGGCGGCCCCTGGAGCCCAGG + Intronic
1160967599 19:1753478-1753500 GGGAGCGGCCGCCGGCGCCCGGG - Exonic
1160991840 19:1863319-1863341 GGGGGTGGCCCCGGGGTCCCGGG + Exonic
1161019246 19:2000243-2000265 GGCCGCGTCCTCAAGGGCCCAGG + Intronic
1161031883 19:2061402-2061424 GAGCACGGACTCGGGGGTCCGGG + Intergenic
1161169969 19:2807755-2807777 GGACGCGGCCTCGGGGGAGGTGG + Exonic
1161175821 19:2841702-2841724 GGGCGGGACCCCCGGGGCCCAGG - Intronic
1161473397 19:4472460-4472482 GGGGGGGGCAGCGGGGGCCCCGG + Intronic
1161510757 19:4669932-4669954 GAGCGGGGCCTTGTGGGCCCCGG - Intronic
1161682622 19:5687627-5687649 AGGCGCGATCTCGGAGGCCCAGG - Exonic
1161686997 19:5707839-5707861 GGGAGCTGCCTCGGTGGCCAGGG + Intronic
1162079289 19:8209113-8209135 GGGTGCGGGGTCGGGGGCCAGGG + Intronic
1162128238 19:8510873-8510895 CGGCCCGGCCGCGGGGGCCGCGG + Exonic
1162238089 19:9324107-9324129 GGGCGGGGCCTCGGGTTCCCGGG - Exonic
1162421585 19:10568750-10568772 GGGCGCGGCCGCGGTGCACCCGG + Exonic
1162445071 19:10718027-10718049 GGGCGCAGCCCCCGGGGCCGGGG + Intergenic
1162929877 19:13952552-13952574 GGGAGCGGCGGCGGCGGCCCCGG + Exonic
1162948532 19:14057535-14057557 GCTCGCTGCCTCGGGAGCCCCGG - Intronic
1163154511 19:15432574-15432596 GGGCCCGGGCTCGGGGGGCTGGG + Intronic
1163320481 19:16571912-16571934 GCGCCCGGCCTCGGGGGCGGCGG - Intronic
1163410927 19:17154156-17154178 GGGAGCGGGTTCGGGGGCCAGGG - Intronic
1163462769 19:17448704-17448726 GGGGGCGCCCGCGGGGCCCCGGG - Intronic
1163547295 19:17947972-17947994 GGGCGGGGCCGCGGGGCCGCCGG + Intergenic
1163557638 19:18001606-18001628 GGTCGCGGCCGAGGGGGTCCCGG - Intronic
1163729529 19:18941142-18941164 GGGCGCGGGCCCGGGAGCCAGGG - Intronic
1163729575 19:18941274-18941296 CGGGGCGGCCTTGGCGGCCCGGG - Intergenic
1164601973 19:29568356-29568378 GTGGGCGGCCTCGGGAGCTCGGG + Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1164658561 19:29942414-29942436 GGGCGCGGCCTCCTGGGCGCGGG + Exonic
1164874714 19:31675788-31675810 GGGAATGGCCTCTGGGGCCCTGG - Intergenic
1164952079 19:32345511-32345533 GGGTCCAGCCTCGGCGGCCCGGG + Intergenic
1165247287 19:34504925-34504947 AGGCGCAGCCTGTGGGGCCCAGG + Exonic
1165349828 19:35269381-35269403 GGGCGCGGGGGCGGGGGCGCGGG + Intronic
1165411489 19:35665230-35665252 GGGGACGGTGTCGGGGGCCCTGG + Intergenic
1165421412 19:35723816-35723838 GGGCGGGAGCTGGGGGGCCCCGG + Exonic
1165423250 19:35732589-35732611 GGGAGCAGCCACGGGGGCCCGGG + Exonic
1165871362 19:38975673-38975695 CGGCGTGGCCCAGGGGGCCCCGG + Exonic
1166055326 19:40284996-40285018 GGGACCAGCCTCGGGGGGCCGGG - Intronic
1166064327 19:40348323-40348345 GGGCGCGGGCCCGGTGGGCCAGG - Intronic
1166106372 19:40600097-40600119 GGCGGCGGCCCCGGGGGCCAGGG + Exonic
1166205107 19:41264479-41264501 GGGGGCCACCCCGGGGGCCCGGG + Exonic
1166301911 19:41915813-41915835 GAGCGCGGCCTGCGGGGCCTGGG + Intronic
1166306842 19:41940223-41940245 GGGCGAGGCCTGGCGGGCGCGGG + Intergenic
1166682619 19:44778130-44778152 GGAGGCGGCCCCGGGGGTCCCGG + Exonic
1166949398 19:46416535-46416557 GGGCGGGGCCGCGGGAGGCCCGG - Intergenic
1166983998 19:46649103-46649125 GCGCGAGGCCTTGCGGGCCCTGG + Exonic
1167267531 19:48491112-48491134 GGGCCGGGCGTCGGGGGCCCGGG + Exonic
1167268247 19:48493874-48493896 CGGCGGGGCCGCGGGGCCCCGGG - Exonic
1167268250 19:48493882-48493904 GGGCGCGGCGGCGGGGCCGCGGG - Exonic
1167300413 19:48674388-48674410 GGGGGCGGCCACGGGGGCCCGGG + Intergenic
1167342135 19:48922243-48922265 GGGCTGGGCCTCTGGGGTCCTGG + Intronic
1168309118 19:55451959-55451981 GGGAGGGGGCTCGGGGGGCCGGG - Intergenic
1168636698 19:58002516-58002538 CGGCGCGGCCTCGGGGACAAAGG + Exonic
924962374 2:46296-46318 CCGCGCGGCGTCGGGGTCCCGGG + Exonic
925376112 2:3387652-3387674 GTGCGGGGCCTCCGGGGCCGGGG - Exonic
925609889 2:5693618-5693640 CGGCGCGACCTCGGGCGCCGGGG + Exonic
925744517 2:7032948-7032970 GGGTGCTGACTCGGGGGACCCGG + Intronic
925801817 2:7609413-7609435 TGGCGGGGCCTAGGGGGCGCAGG - Intergenic
926077129 2:9951038-9951060 GCGCGCGGCCGCGGTGGGCCAGG + Intergenic
926267990 2:11344083-11344105 CGGCGCGGTCTCGGGGGCGCCGG + Exonic
926308366 2:11656881-11656903 AGCCGCGGCTTCGGAGGCCCTGG - Intergenic
926320713 2:11746779-11746801 GGGCTCGGCCCCGGGGCCCGAGG + Intronic
927168583 2:20350324-20350346 GGCCGCCGCCTCGGGGGCGTGGG - Intronic
928381308 2:30821179-30821201 GAGCACGGACTCTGGGGCCCAGG + Intergenic
929966834 2:46542810-46542832 GGGCGCGGCGACCGGGGCCGGGG + Exonic
931228121 2:60351524-60351546 GGCAGCTGCCTCTGGGGCCCGGG - Intergenic
931355836 2:61537466-61537488 GGGCGCGGCGGCGGCGGCCGCGG - Intronic
932493876 2:72137182-72137204 GGGCGTGGCCTCCAGGGCACCGG - Intronic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
935011594 2:99141308-99141330 GGGCGGGGCCACGGCGGCACTGG - Intronic
935149136 2:100417735-100417757 GGGCGCGGCCGCGGGACCCCAGG + Intergenic
935250054 2:101253055-101253077 AGGAGCGGCTTCGGGGGCTCCGG + Exonic
936671447 2:114662024-114662046 GGGCGCGGCCTGGAGAGCCCGGG - Intronic
937261162 2:120587435-120587457 GGGCGCCCCCTCGGGGCCGCGGG - Intergenic
937956329 2:127423474-127423496 GGGCGCGGCGCGGGGGGCTCAGG + Intronic
938118897 2:128620190-128620212 GGCACCGGCCTCGGGGGCTCTGG + Intergenic
938397754 2:130963607-130963629 GGGCGCGGGCGCGGGGCTCCGGG - Intronic
938451551 2:131425351-131425373 GGGCACGGCGTAGGGGGCCTCGG - Intergenic
938455590 2:131460759-131460781 GGGCGCGGCGACCGGGGCCGGGG + Intergenic
938500610 2:131829876-131829898 TGGCTCGGCCTCGCGGGTCCGGG + Intergenic
939628509 2:144508184-144508206 GGCTGTGGGCTCGGGGGCCCGGG - Intronic
940038031 2:149330474-149330496 CGGCCCGGCCTCGAGGGCCGCGG - Intronic
940883256 2:158968340-158968362 AGGCGCAGCCCCGGGGGACCCGG + Intergenic
941104895 2:161341129-161341151 GGCCGCCGGCTCGGGGGCGCAGG + Intronic
941104909 2:161341164-161341186 GGCCGAGGCCACCGGGGCCCCGG - Intronic
941666231 2:168246785-168246807 GGACGCGGCCCCCGGGGCCCTGG + Intronic
941911715 2:170770872-170770894 GGGCGCGGCGAGGAGGGCCCGGG - Intergenic
943342084 2:186693928-186693950 GGGCGCGGGACCGCGGGCCCCGG + Intergenic
945119477 2:206443430-206443452 GGGCGCGCTCTCGGGGGGCGGGG + Intergenic
945188946 2:207166624-207166646 GGGCGCGGCGCAGGGGGCCGCGG + Intronic
945833240 2:214810060-214810082 GGGCGGGGCCTAGGGGCCTCGGG + Intergenic
946185561 2:217978736-217978758 GGCCGCGGGCTGGCGGGCCCGGG - Intronic
947906367 2:233766259-233766281 TGGCCCGGGCTCGGTGGCCCGGG + Intronic
948368921 2:237475299-237475321 GGGCGCGGCCTGGGCGGCCCTGG - Intergenic
948473720 2:238203410-238203432 GGGCGCCGCCTCAGCCGCCCCGG + Intronic
948505839 2:238426656-238426678 GGGCGGGGCCCCGAGGGCCGTGG - Intergenic
948614525 2:239190127-239190149 GGGTGGGGGCTCTGGGGCCCAGG - Intronic
948801463 2:240435391-240435413 GGGGCCGCCCTCGGGGACCCCGG + Intergenic
948801684 2:240436093-240436115 GGGCGCGGCGCCGGGAACCCGGG + Intronic
948824794 2:240568917-240568939 GGGGGCGGCGGCGCGGGCCCCGG - Exonic
948837040 2:240630904-240630926 GGGCCAGGTCTCGGGGGCTCCGG + Exonic
948874629 2:240820083-240820105 GGGCGCGGGCGCGGGAGGCCGGG + Intronic
948991641 2:241558784-241558806 TGCCGCGGCGTCGGGGGCCTGGG - Exonic
949019666 2:241734262-241734284 GGGCTCGGCCTCGGAGGAGCGGG + Intergenic
949041702 2:241852600-241852622 AGGTGCGGCCTCGGAGGCCCCGG - Exonic
1168769786 20:408003-408025 GGGCGGGGCCGGGGGGGCCGGGG - Intronic
1169195990 20:3682186-3682208 GCGCGCGCCGTCGGGGCCCCTGG - Exonic
1169211395 20:3767898-3767920 GGGCGCTGCCTCGGCGACCCTGG - Intronic
1169758659 20:9068544-9068566 GGGCGCAGCCTCGCGAGCCGGGG - Intergenic
1171430688 20:25081743-25081765 GGCAGCGGGCTCGGGGCCCCTGG + Exonic
1171452815 20:25247986-25248008 GGGCGGGGCCTCGGGAGGGCGGG - Intergenic
1171452825 20:25248006-25248028 GGGCGGGGCCTCGGGGGGCGGGG - Intergenic
1172155323 20:32820064-32820086 GGGGGCGGCCGCGTGGGCCAAGG + Intronic
1172272009 20:33660080-33660102 GGGCTAGGCCTCGGAGTCCCAGG - Intronic
1172474573 20:35227007-35227029 GGGCGCGGGCTCGGGGCATCCGG + Intronic
1173009709 20:39170641-39170663 GGGCTTGGCCTCTGTGGCCCTGG - Intergenic
1173548099 20:43914683-43914705 GGCCGGGGGCCCGGGGGCCCGGG - Intergenic
1173785831 20:45792145-45792167 GGGCACGGCCTCGGGGCTCCTGG + Intronic
1173952929 20:47007490-47007512 GGGCGGGGCCTCCGAGGCCCAGG + Intronic
1175424641 20:58855663-58855685 GGGAGGGGCCCCGGGGCCCCGGG + Intronic
1175429280 20:58890998-58891020 GGAGGAGGCCTCGGGGGCGCCGG + Intronic
1175831016 20:61965658-61965680 GGGGGCGGCCGGGGGGGCCAGGG - Intronic
1175967051 20:62664984-62665006 GAGAGTGGCCTCGGTGGCCCCGG - Exonic
1176042255 20:63072038-63072060 GGGCGGGGCCTCGAGGGGCGGGG - Intergenic
1176068828 20:63215761-63215783 GGGCCCGGCCTCCGCGACCCCGG + Intronic
1176148042 20:63574135-63574157 GGGCGGGGGCGCGGGGGTCCAGG - Intronic
1176207269 20:63895638-63895660 GGGGGCGGCCGCGGGGACCTGGG - Intronic
1176429095 21:6565060-6565082 AGACTCGGCCTGGGGGGCCCTGG + Intergenic
1176548978 21:8213457-8213479 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1176556871 21:8257669-8257691 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1176567907 21:8396487-8396509 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1176575811 21:8440706-8440728 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1176952496 21:15064429-15064451 GGGGCCGGACTCGGGGGGCCGGG - Intronic
1178843489 21:36156549-36156571 GGGCGGGGCCTCGGCTGGCCGGG - Intergenic
1178922540 21:36747965-36747987 GGTCGCCGCCTCGGGGCCGCCGG - Exonic
1178992781 21:37368139-37368161 AGCCGCTGCCTCGGCGGCCCTGG + Intronic
1179411585 21:41167477-41167499 GGGCGGGGGCTCGGGGGCAGCGG + Intergenic
1179704585 21:43173376-43173398 AGACTCGGCCTGGGGGGCCCTGG + Intergenic
1179746195 21:43445387-43445409 GGTCGCGGACTTGGAGGCCCAGG + Intergenic
1179818150 21:43921254-43921276 GGGCGAGGCCTGGGGTGTCCAGG - Intronic
1179874480 21:44261221-44261243 GGGCTCGGCCTCTGGGTCCAGGG + Exonic
1179951585 21:44711602-44711624 AGGGGCGGCCGCGGGGCCCCCGG + Intergenic
1180042279 21:45287043-45287065 GGGCGCAGCCTCGGGAGCCCAGG - Intronic
1180057856 21:45368123-45368145 GCGAGCGGCTTCTGGGGCCCAGG + Intergenic
1180064560 21:45405774-45405796 GGGCGGGGCCGCGGGGTCTCGGG + Intronic
1180612961 22:17109378-17109400 GGGCGAGTCCTCGGGGTCCACGG - Exonic
1180835407 22:18927114-18927136 GGCTGCAGCCTCAGGGGCCCTGG - Intronic
1180843596 22:18970349-18970371 GGGCGGGGGCTGGGGGGCGCGGG - Intergenic
1180843610 22:18970375-18970397 GGGCGGGGGCTGGGGGGCGCGGG - Intergenic
1180871636 22:19150095-19150117 GGGCGCAGCCTCGGGCGCCCCGG + Exonic
1180876792 22:19178507-19178529 GGGCGGGGCCTCAGCGTCCCGGG + Intronic
1180959380 22:19755698-19755720 GGACGCGGCCTCGGGGTCTCGGG - Intergenic
1181031641 22:20150947-20150969 GGGGGTGGCCGCAGGGGCCCAGG + Intergenic
1181239719 22:21469549-21469571 GGGCGCGGCCGCGGTCCCCCAGG + Intergenic
1181510987 22:23388626-23388648 GGGCGCCCCCTCGGGGCCACTGG + Intergenic
1181511763 22:23392570-23392592 GGGCGTGGCCGCAGGGGCCCAGG - Intergenic
1181811386 22:25405530-25405552 GGGAGGGGCCGCGGGGACCCGGG - Intergenic
1181941764 22:26483490-26483512 GGGCGCAGCCCCCGGGGCGCAGG + Intronic
1182087806 22:27573648-27573670 GGGCGCAGCCTCGCCAGCCCAGG + Intergenic
1182350246 22:29695365-29695387 GAGCGCCGCCTCGGGGTGCCTGG - Exonic
1182576522 22:31276713-31276735 GGGCGCGGCGTTGGCGGCCCCGG + Intronic
1182903912 22:33920611-33920633 GGGCGCGGGGCCGGGGGCGCGGG + Intronic
1183279602 22:36924807-36924829 GGGCAGGGCCCCGGGGGCACTGG - Intronic
1183309376 22:37101179-37101201 GGGGGCGGGATCGGGGTCCCAGG + Intronic
1183358813 22:37372971-37372993 GGGAGCAGACTCGGGGGCCAAGG - Exonic
1183489522 22:38109099-38109121 GGGCTGGGGCTCGGTGGCCCGGG + Intronic
1183720173 22:39557873-39557895 GGCGGCGGGCCCGGGGGCCCGGG - Intergenic
1183856121 22:40636371-40636393 GCGCGCGTCCTCGGGGGGTCGGG - Intronic
1184101488 22:42343697-42343719 GGGGCGGGCCTCGCGGGCCCTGG + Intergenic
1184207561 22:43014828-43014850 GGGCGAGTGCTCGGGGCCCCGGG - Intronic
1184472241 22:44702447-44702469 GGGCGCGGCGCAGGCGGCCCGGG + Intronic
1184662626 22:45972354-45972376 GGGCCGGGTCTCGTGGGCCCGGG + Intronic
1184796763 22:46737707-46737729 GGGCGCGGGGTCGTGGCCCCCGG - Intronic
1184796887 22:46738016-46738038 GGGCGCCGGCTCCGGGCCCCGGG + Exonic
1184914365 22:47559025-47559047 GGCGGTGGCCTAGGGGGCCCTGG + Intergenic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1185415233 22:50705836-50705858 GGTCAGGGCCTCAGGGGCCCTGG - Intergenic
1185420193 22:50730761-50730783 CAGCGCAGCCCCGGGGGCCCGGG + Intergenic
1203253862 22_KI270733v1_random:129764-129786 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1203261918 22_KI270733v1_random:174843-174865 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1203285495 22_KI270734v1_random:152413-152435 GGCTGCAGCCTCAGGGGCCCTGG - Intergenic
949559257 3:5187567-5187589 GGGCCCGGCCTCGCGGGGCGCGG - Intergenic
950024272 3:9809960-9809982 GGGCGCGGGATCAGGGGCCCTGG + Intronic
950215279 3:11154467-11154489 GGGGGCGGCGGCGGGGGCGCCGG - Intronic
950282539 3:11719953-11719975 TGGCGGGGCCTCGGGGGCGGGGG - Intronic
950448032 3:13049289-13049311 GGGCTCTGCCTGTGGGGCCCAGG - Intronic
952382893 3:32818207-32818229 GGGGGCGGCGGCGGGGGCCCTGG + Exonic
952867067 3:37861655-37861677 GGCCGCGCGCGCGGGGGCCCGGG - Intergenic
952867228 3:37862120-37862142 GGGCGCGGCGCGGGGGGCGCGGG - Intronic
952929293 3:38347052-38347074 GGGCAGGGGCGCGGGGGCCCCGG - Intronic
952970901 3:38649611-38649633 GGGCGCAGGCTCAGCGGCCCCGG + Exonic
953404684 3:42654552-42654574 GGCCGCGCCCCCGGGGGCCATGG + Intronic
954540749 3:51391687-51391709 CGGCAAGGCCTCGGGGGACCCGG + Exonic
954575123 3:51671585-51671607 AGGCGCGGCCTTGGGGGACGGGG - Exonic
954632760 3:52056216-52056238 GGGCGCGGCGACGGGGGCAGGGG - Exonic
954912699 3:54122400-54122422 CGGCCCCGCCTCGGCGGCCCCGG - Intergenic
960586119 3:119322866-119322888 CGGCCCGGCCGCGGGGGTCCCGG + Intronic
961377460 3:126476111-126476133 GGGCGCGGGGTCGGGGGGCGGGG + Intergenic
961377471 3:126476131-126476153 GGGCGCGGGGTCGGGGGGCGGGG + Intergenic
961377482 3:126476151-126476173 GGGCGCGGGGTCGGGGGGCGGGG + Intergenic
961377493 3:126476171-126476193 GGGCGCGGGGTCGGGGGGCGGGG + Intergenic
961377504 3:126476191-126476213 GGGCGCGGGGTCGGGGGGCGGGG + Intergenic
961456758 3:127028347-127028369 GGGCGGGGCCACGGCTGCCCGGG + Intronic
964375037 3:156041382-156041404 GGGCGTGGGCTCGGCGGGCCCGG + Intronic
965220236 3:165918745-165918767 GGGCGTGGCCTCGGCAGACCCGG - Intergenic
966732553 3:183162858-183162880 CGGCGCAGCCGCCGGGGCCCGGG + Exonic
966764427 3:183447442-183447464 GGTCTCGGCCTCCGGGACCCTGG - Intergenic
967272634 3:187743798-187743820 AGGCGCGGCGGCGGCGGCCCGGG - Intronic
967395330 3:189002174-189002196 GCGCGCTGCCTCATGGGCCCAGG + Intronic
968048151 3:195635438-195635460 GGGGGCGCCCGCGGGGGTCCGGG - Intergenic
968048177 3:195635500-195635522 GGGGGCGGCCGCGGGGGTCGGGG - Intergenic
968092731 3:195908875-195908897 GGGCCCGGCCGGTGGGGCCCCGG - Intronic
968099227 3:195954120-195954142 GGGGGCGGCCGCGGGGGTCGGGG + Intergenic
968099253 3:195954182-195954204 GGGGGCGCCCGCGGGGGTCCGGG + Intergenic
968178196 3:196569062-196569084 GGGCTCGGGCTCTGGGGCCGCGG + Exonic
968306434 3:197654421-197654443 GGGGGCGGCCGCGGGGGTCGGGG + Intergenic
968306460 3:197654483-197654505 GGGGGCGCCCGCGGGGGTCCGGG + Intergenic
968353538 3:198081453-198081475 GGGCATGGCCTGGGCGGCCCCGG + Intergenic
968483851 4:849382-849404 GGGCGTGGCCTCTGGAGCCCCGG - Exonic
968508977 4:987138-987160 GGCCGCGCCCCCGGTGGCCCCGG + Exonic
968556773 4:1249594-1249616 GCCCGCGGCCTCGGTGCCCCTGG - Intronic
968583013 4:1403608-1403630 GGCGGCGGCCTCGGGGCCCGCGG - Exonic
968636747 4:1684701-1684723 GCGCGCGGTCTCGGGGCCCGAGG + Intergenic
968640565 4:1712462-1712484 GGGCGAGGCCTCGGGACCGCGGG + Exonic
968645808 4:1740010-1740032 GCACGTGGCCTCGGTGGCCCGGG - Intronic
968810618 4:2798130-2798152 GGGCCTGGTCTCGGTGGCCCTGG + Intronic
969422186 4:7103866-7103888 GGGCGGGGAGTCAGGGGCCCAGG + Intergenic
969682234 4:8649758-8649780 GCCCCCGGCCCCGGGGGCCCCGG - Intergenic
969726231 4:8920099-8920121 CGGCCCGGGCTCGGTGGCCCAGG - Intergenic
970456065 4:16226030-16226052 TGGCGCGGCCGCGGGGGCCTCGG + Intronic
973292337 4:48483286-48483308 GGGCGGGGCCTGCGGGGCGCGGG + Intergenic
973386381 4:49516902-49516924 GGGCTGGGCCTCAGGGACCCTGG - Intergenic
973888532 4:55346652-55346674 GGACCCGGCCTGGGAGGCCCTGG + Intronic
975612130 4:76213710-76213732 GAGCGCGGCCCCGGGTGCACCGG + Exonic
976629176 4:87219971-87219993 TGGCGCGGGTTCGGGGCCCCGGG - Intronic
977908244 4:102501513-102501535 GGCTGCGGCCTCGGCGGCGCTGG - Exonic
978351518 4:107825017-107825039 GAGTGCGGCCTCGGGGGCGGCGG + Intronic
979685318 4:123505647-123505669 GGTCGCGGCCTCGGCGGCGGCGG - Intergenic
980913806 4:139016122-139016144 GGCGGCGGCCTCGGCGGCCTCGG + Exonic
980923898 4:139115329-139115351 GGGCGCGGCGTTGGCGACCCCGG - Intronic
981528776 4:145733121-145733143 GGGCGCGGCTTTGGGGGCGCAGG - Intronic
984206461 4:176792763-176792785 GGGCGCTGCGGCGGGGGCGCTGG + Intergenic
984966364 4:185143509-185143531 GGGCGCGGGCGCGGCGGGCCGGG + Intronic
985497657 5:218586-218608 CGGGGCGGACTCGGGGACCCGGG + Intronic
985649312 5:1099904-1099926 GGGCCAGGCCTGGGGGACCCCGG - Intronic
985680118 5:1251759-1251781 GGGAGCGGCCCCGGGCGCCGTGG - Intergenic
985737665 5:1594205-1594227 TGGGGCGGACTCGGGGGTCCGGG - Intergenic
986912552 5:12574771-12574793 GGGCGTGGACTCGGCGGGCCCGG - Intergenic
992078904 5:73216151-73216173 GGGCGCGGCGGCGGCGGCCAGGG + Intergenic
992530118 5:77645258-77645280 GGGCGCGGCCGAGGGGCCCCCGG - Intergenic
992939650 5:81750485-81750507 GAGCGCGGCGGCGGGGGCCTGGG - Intronic
994072771 5:95620614-95620636 CCGCGCGGCCACGGGGGACCTGG + Exonic
995724740 5:115170517-115170539 AGGCGCGGCCTGGGGTTCCCTGG + Intronic
996221390 5:120936905-120936927 GGGCTCGGCATGGGCGGCCCAGG + Intergenic
997222529 5:132181238-132181260 GGGCGTGGCCTCTGAGGACCTGG - Intergenic
997265169 5:132490981-132491003 GGGCGGGCCCGCGGTGGCCCCGG - Intergenic
997302127 5:132813869-132813891 GGGCTCGGGCTCCGGGGGCCGGG - Exonic
997443099 5:133922573-133922595 GGGAGAGGCCTCGGGAGCTCAGG + Intergenic
997585098 5:135039306-135039328 GGTAGCAGCCTCGGGGGCACGGG - Intronic
997635102 5:135398991-135399013 GGGTCCGGCCGCGGGTGCCCGGG - Intronic
997732296 5:136190611-136190633 GGGCTGGGCCTCAGGAGCCCTGG + Intergenic
998208335 5:140175347-140175369 GGGCGCGTCCCCGGGCTCCCTGG + Intronic
1000345692 5:160312056-160312078 GGGGGCGCCCGCCGGGGCCCGGG - Intronic
1001065055 5:168529538-168529560 GGGGGCGGCCGCGGGGGCGGCGG + Exonic
1001396236 5:171420987-171421009 GGGAGCGGCCTCGCGGGCAGCGG - Intronic
1001483852 5:172105994-172106016 GGGCGGGACATCGGGGGCCTGGG - Intronic
1001920614 5:175596709-175596731 GGGCGAGGCCTCCGCAGCCCAGG + Intergenic
1002062022 5:176630639-176630661 GGACGCGCCCCTGGGGGCCCCGG + Intergenic
1002133602 5:177095594-177095616 GGTCGGGGCCTGGGGGGCGCCGG - Exonic
1002580881 5:180208963-180208985 GGGCGCGGGCTCGCGGGGGCTGG - Intronic
1002633686 5:180596774-180596796 TGGCTCGGCCCCGTGGGCCCTGG + Intergenic
1002633711 5:180596839-180596861 TGGCTCGGCCCCGTGGGCCCTGG + Intergenic
1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG + Intronic
1004140568 6:13013858-13013880 GCGCCCGGCCCCGGGCGCCCGGG + Intronic
1004396205 6:15248388-15248410 TGGCGCGGCCTGCGGGGCGCGGG + Intronic
1004627915 6:17393906-17393928 CGGCGCGGGCGCGGGGGCCGGGG + Intronic
1005526792 6:26659416-26659438 AAGCGCGGCCTGCGGGGCCCAGG - Intronic
1006366761 6:33620911-33620933 GGGCGCGCCCTGGAGCGCCCTGG - Exonic
1006408077 6:33856667-33856689 TGGCAAGCCCTCGGGGGCCCTGG + Intergenic
1007108830 6:39301380-39301402 GGGCCCAGCCTTGGGGGACCTGG - Intronic
1007371197 6:41427916-41427938 GCGGCCAGCCTCGGGGGCCCCGG + Intergenic
1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG + Intergenic
1007643580 6:43363473-43363495 GGCAGAGGCCCCGGGGGCCCTGG + Intronic
1007751320 6:44073573-44073595 GGGAGGGGCCGCGGCGGCCCTGG + Intergenic
1009899749 6:69796848-69796870 TGGCGCGGCCTCGGCGGAGCTGG - Exonic
1011075081 6:83430731-83430753 GGCCGCGGCCTGGGGGGCCTTGG - Intronic
1011195067 6:84772964-84772986 GGGCTCCGCCGCGGGAGCCCGGG + Intergenic
1012052540 6:94362317-94362339 GGGTCATGCCTCGGGGGCCCAGG - Intergenic
1013793533 6:113859858-113859880 GGCCCCGGCCTCGGGGGCAGCGG - Exonic
1013793619 6:113860201-113860223 GGGCGCGGCCTCCGGGGAGCAGG + Exonic
1016217175 6:141618276-141618298 GGGCGTGGCCTTGGCGGGCCCGG + Intergenic
1016340886 6:143060742-143060764 TGGCGCGGCCGCGAGCGCCCGGG - Intronic
1016386775 6:143537122-143537144 GTGAGCGGCCGCGGGGGCTCGGG - Intronic
1016683662 6:146857688-146857710 GGGCGCAGGCTCGCGGGCCAAGG + Intergenic
1018013716 6:159693707-159693729 AGGAACGGCCACGGGGGCCCTGG - Intronic
1018612629 6:165660636-165660658 GGGCTCAACCTCGGGTGCCCTGG + Intronic
1018920292 6:168167858-168167880 GGGCTCAGCCTCGGGTTCCCTGG - Intergenic
1018936443 6:168276855-168276877 AGGCGCGGCCTTGCGGGCCCTGG - Intergenic
1019539531 7:1545542-1545564 GGGCAAGGCCTGGGGGGCTCAGG - Exonic
1020034883 7:4958907-4958929 GCGCGCGGCGGCGGGGGCCGCGG - Intronic
1020087706 7:5320497-5320519 GGGCGGGGCCTCGGGAGGCTCGG - Intronic
1020260155 7:6526533-6526555 GTGGGCGGCCTCGCCGGCCCCGG - Exonic
1020309117 7:6855570-6855592 AGGCGCCGCCCCCGGGGCCCAGG - Intergenic
1021163053 7:17299150-17299172 GGGCGCGGCTTCGCGGAACCCGG + Exonic
1021313215 7:19117335-19117357 ACGCGTGGCCTCGCGGGCCCGGG + Exonic
1022106114 7:27199293-27199315 GTGCCGGGCCTCGGGGGCCCCGG - Exonic
1022207571 7:28179706-28179728 GGACGCGGGCCCGGGGGCTCTGG - Intronic
1022396249 7:29989879-29989901 CGGCGGGGCCCCGGGGGCCGGGG - Intronic
1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG + Intergenic
1022800836 7:33775845-33775867 GGGCTCTGCCTTGGGGGCCTCGG - Intergenic
1023016320 7:35971521-35971543 GGGCGCTGCGTTGGCGGCCCTGG - Intergenic
1023843611 7:44109475-44109497 GGGAGGGGCCCCGGGAGCCCAGG + Intronic
1023861818 7:44221277-44221299 GGGCCAGGCCTGGTGGGCCCAGG - Intronic
1023955594 7:44884714-44884736 GGAGGCGGCGCCGGGGGCCCAGG - Exonic
1025206608 7:56996669-56996691 GGGCGGGGCCTCGGGAGGCTTGG + Intergenic
1025665332 7:63580258-63580280 GGGCGGGGCCTCGGGAGGCTCGG - Intergenic
1026980511 7:74523961-74523983 GGGGCCGGCCTCGGGGGCTCTGG + Intronic
1027956034 7:84880645-84880667 GGGCGTGGCCTCGGCAGGCCCGG + Intergenic
1029080750 7:97972206-97972228 GAGCGGGCCCTCGGCGGCCCAGG - Intergenic
1029109562 7:98205717-98205739 GGCCGCGGCCGCGGGTGCACGGG - Exonic
1029291465 7:99505056-99505078 GCGAGCGGCTTCGGGGGCCCTGG + Exonic
1029372585 7:100158734-100158756 GGGCGTGGCCGCCGAGGCCCCGG + Intergenic
1029440272 7:100583453-100583475 GGACTCCGCCTCGCGGGCCCTGG - Intronic
1029537222 7:101163795-101163817 CAGCGCGGCCTCGGGGGTCGGGG - Exonic
1029640777 7:101817479-101817501 GGGCGCGGGCCGGGGAGCCCCGG - Intronic
1031134846 7:117873356-117873378 CGCCGCGTCCTCCGGGGCCCGGG + Exonic
1033288617 7:140062784-140062806 GTGCGCGGCCGGGGGCGCCCTGG - Exonic
1033299826 7:140176360-140176382 GGGCGGGGCGGCGGCGGCCCGGG + Intronic
1034222965 7:149460075-149460097 ACGCGCGGCCTCGGGGCCCCGGG - Intronic
1034338307 7:150337433-150337455 GGGCTGGGCCTCGGTGGCTCTGG - Exonic
1034347649 7:150397202-150397224 GGGCGCCCCCGCGGCGGCCCCGG - Exonic
1034455400 7:151167484-151167506 GGGGGCGGCGGCGGGGGCCCGGG - Exonic
1034467426 7:151238271-151238293 GGGCCAGCCCCCGGGGGCCCTGG - Exonic
1034470005 7:151249894-151249916 GGGCGTGGCCTTTGGGGACCTGG - Intronic
1034964628 7:155383627-155383649 GGGTGCGGTCTCGGGTGGCCAGG + Intronic
1035169420 7:157009504-157009526 GGGCGAGTCCTCGCAGGCCCCGG + Intronic
1035171850 7:157021526-157021548 GGGCCCGGCCACAGGTGCCCCGG + Intergenic
1035345150 7:158192653-158192675 GGACACAGGCTCGGGGGCCCGGG - Intronic
1035603537 8:913898-913920 GGGCACGGCCCCCGGAGCCCCGG + Intergenic
1036195298 8:6708559-6708581 GGGCGCGGCGGCCCGGGCCCGGG + Exonic
1036454189 8:8893375-8893397 GCGCGGCGCCTCGGGGGGCCCGG + Exonic
1036766698 8:11553959-11553981 AGGCGCGGACTCGGGGAACCGGG + Intronic
1038204959 8:25457903-25457925 GGGCGCGGGGACGGGGGCGCGGG - Intronic
1038613221 8:29072029-29072051 GGGCTCGGCCTCAGGGGCGGTGG + Exonic
1038828498 8:31032993-31033015 GGGAGCGGCCCCGGGGGCGGCGG - Exonic
1039454550 8:37698190-37698212 GAGCGCGGCCTGGGCGGCGCTGG - Exonic
1039467909 8:37797105-37797127 GGGCGCGGCGGCGGGGACCCCGG + Intronic
1039476439 8:37841604-37841626 GGGCGGGGCATGGGGGGCCGCGG - Exonic
1040104551 8:43534401-43534423 TGGCCCAGCCTCGAGGGCCCTGG + Intergenic
1042020757 8:64370079-64370101 GGGCGCGGGCTTGCGGGGCCCGG + Intergenic
1042059090 8:64798410-64798432 GCGCGCGGCCCGCGGGGCCCAGG + Intronic
1043052854 8:75404576-75404598 GGACGCGGCCACCGGGGCTCAGG - Intergenic
1045673960 8:104588570-104588592 GGGCCCGGCCGGGAGGGCCCCGG - Intronic
1046770513 8:118112208-118112230 CCGCGCGGCCCCGGGCGCCCTGG + Intergenic
1049212175 8:141391896-141391918 AGGGGCGGCCTCGGGGGCGGCGG + Intergenic
1049475360 8:142794673-142794695 GGGACAGGCCTCGGGGGCCGTGG - Intergenic
1050182081 9:2933427-2933449 GGGCCCCGCTTCAGGGGCCCAGG + Intergenic
1051897966 9:22008729-22008751 GGGCGCGGCCTCGGCGGATCGGG - Intronic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1053167311 9:35853784-35853806 GAGCTGGGCCTCGTGGGCCCAGG + Exonic
1053304525 9:36974820-36974842 CGTCGAGGCCTCGGGGGCTCAGG - Intronic
1053372726 9:37576242-37576264 GGCCGCGGCCGCCGGTGCCCTGG + Exonic
1053643776 9:40109755-40109777 GCGCTGGGCCTCGGGGACCCTGG + Intergenic
1056991949 9:91421327-91421349 GGGCGCGGCCCGTGGAGCCCGGG - Intronic
1056992343 9:91423719-91423741 GGGCCGGGCCTCCGGGGCCGCGG + Exonic
1057168569 9:92947343-92947365 GGGCGCCGGCTCGGGTGCACAGG - Intergenic
1057619014 9:96619115-96619137 CGGCCCGGCCCCGGAGGCCCCGG + Intronic
1057781921 9:98056989-98057011 GGGCGGGGCCGCGGGGAGCCAGG + Intronic
1057817075 9:98303698-98303720 GAGTGAGGCCTCGGGGGCCCTGG - Intronic
1058866593 9:109167000-109167022 GCGCGCGTCCCCGGGGTCCCCGG + Exonic
1061000518 9:127899667-127899689 GGGCGGAGCCTCGGGGCCGCGGG + Intronic
1061415384 9:130444696-130444718 GGGCGCGCCGGCGGGGGCGCAGG - Intergenic
1061559759 9:131394580-131394602 CGGCCCGGCCTCGGGGGTACGGG - Intronic
1062022580 9:134326397-134326419 GCGCGCGGCGGCGGGGGCGCGGG + Intronic
1062028700 9:134352343-134352365 AGGGGCTGCCTCGGGGACCCTGG + Intronic
1062363324 9:136197648-136197670 GGGCCGGCCCTCGGGAGCCCTGG - Exonic
1062396777 9:136355799-136355821 GGCCGTGGCCTCGGCAGCCCCGG - Exonic
1062423545 9:136495619-136495641 GGGCGCGGCCTGGACGCCCCAGG + Exonic
1062567497 9:137169829-137169851 GGCCTCGCCCTCGGGGTCCCTGG - Exonic
1062621325 9:137423681-137423703 CAGCGCGGCCTCGGGGTCCCCGG - Exonic
1203772816 EBV:58114-58136 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772823 EBV:58129-58151 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772830 EBV:58144-58166 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772837 EBV:58159-58181 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772844 EBV:58174-58196 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772850 EBV:58189-58211 GGCCCCGGCCTCTGCGGCCCCGG - Intergenic
1203772856 EBV:58204-58226 GGCCCCGGCCTCTGCGGCCCCGG - Intergenic
1203470262 Un_GL000220v1:112908-112930 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1203478083 Un_GL000220v1:156880-156902 GGGCGCGGCCGGGCGGGCCGCGG - Intergenic
1185448158 X:269718-269740 GGGCGGGGCCTGCAGGGCCCGGG + Intergenic
1185457440 X:318044-318066 GGGCGGGGCTTCAGGGGGCCAGG - Intronic
1185469538 X:374174-374196 GGGGACGGCCTCGGGGACCCAGG + Intronic
1185520429 X:734524-734546 GGTGGCGGCCTCGGGGGTCCTGG - Intergenic
1186516927 X:10173379-10173401 GGGCGCTGCCTCAGGGACCCCGG + Intronic
1186611697 X:11144076-11144098 GGACGCGGCCCCGGGGGGCTCGG - Exonic
1186670009 X:11758391-11758413 AGGCGCGGGCTGGGGGACCCGGG + Intronic
1187181538 X:16947221-16947243 GGCCGAGGCCTCCGGGTCCCTGG - Intronic
1187533467 X:20116677-20116699 GGGGGCGGGCCCGGCGGCCCAGG - Intronic
1190214049 X:48468468-48468490 GGTCTCGGGCTTGGGGGCCCAGG - Intronic
1190598766 X:52069165-52069187 GGGCGCGGCTGCGGGGTTCCTGG - Exonic
1190610058 X:52184908-52184930 GGGCGCGGCTGCGGGGTTCCTGG + Exonic
1196001985 X:110795955-110795977 AGGCGCGGGCGCGGCGGCCCGGG + Intergenic
1199772691 X:150984295-150984317 GCCCGGGGGCTCGGGGGCCCGGG - Intronic
1200233502 X:154457881-154457903 GGGCGCGGCCTCGCTGGTCCCGG - Intergenic