ID: 1128162672

View in Genome Browser
Species Human (GRCh38)
Location 15:65434568-65434590
Sequence GCTTATCTGGAGACAAATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128162672_1128162681 15 Left 1128162672 15:65434568-65434590 CCGTCATTTGTCTCCAGATAAGC No data
Right 1128162681 15:65434606-65434628 GAAGCGAGCAGCAGAGCTGGGGG No data
1128162672_1128162676 -9 Left 1128162672 15:65434568-65434590 CCGTCATTTGTCTCCAGATAAGC No data
Right 1128162676 15:65434582-65434604 CAGATAAGCTAGGCCGGCTGAGG No data
1128162672_1128162680 14 Left 1128162672 15:65434568-65434590 CCGTCATTTGTCTCCAGATAAGC No data
Right 1128162680 15:65434605-65434627 TGAAGCGAGCAGCAGAGCTGGGG No data
1128162672_1128162678 12 Left 1128162672 15:65434568-65434590 CCGTCATTTGTCTCCAGATAAGC No data
Right 1128162678 15:65434603-65434625 GGTGAAGCGAGCAGCAGAGCTGG No data
1128162672_1128162679 13 Left 1128162672 15:65434568-65434590 CCGTCATTTGTCTCCAGATAAGC No data
Right 1128162679 15:65434604-65434626 GTGAAGCGAGCAGCAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128162672 Original CRISPR GCTTATCTGGAGACAAATGA CGG (reversed) Intergenic
No off target data available for this crispr