ID: 1128173675

View in Genome Browser
Species Human (GRCh38)
Location 15:65534351-65534373
Sequence CTAGTGACTATGAGAGAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128173671_1128173675 17 Left 1128173671 15:65534311-65534333 CCAGTCATCACATCTCTATTCTG 0: 1
1: 0
2: 2
3: 21
4: 207
Right 1128173675 15:65534351-65534373 CTAGTGACTATGAGAGAACACGG 0: 1
1: 0
2: 0
3: 16
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128173675 Original CRISPR CTAGTGACTATGAGAGAACA CGG Intronic
908784294 1:67719867-67719889 TTAGTCAATATGAGAGAAGATGG - Intronic
909192403 1:72570965-72570987 CTAGTGCCTAGAAGAGGACATGG - Intergenic
909297131 1:73965071-73965093 CTAGTGATTATTAGAGACGATGG + Intergenic
909936238 1:81554687-81554709 CTAATGACCATGAGACAACCAGG + Intronic
910629828 1:89343233-89343255 CTAGTGACTTTGAGAACACTTGG - Intergenic
912167562 1:107057956-107057978 CTAGAGGCTATGAGGGAAAAGGG - Exonic
913136390 1:115893432-115893454 GCAATGACTATGAGAGAAAATGG - Intergenic
915864351 1:159482840-159482862 CTAGTGACATTGGGAGCACAAGG - Intergenic
916018034 1:160767867-160767889 CAAGTGACTGGGAGGGAACATGG - Intergenic
918886202 1:190197830-190197852 CTAGTGAATCTGTGAGAAAAGGG - Intronic
919521112 1:198588881-198588903 ATAGTAACCAAGAGAGAACAGGG - Intergenic
919612486 1:199762145-199762167 GTAGTGACTAAGAGAGAAAGAGG - Intergenic
919685348 1:200479119-200479141 CTAGTCACTTTAGGAGAACATGG - Intergenic
924287872 1:242506899-242506921 CAAGTGACTATGAGAGCAATAGG + Intronic
1064453773 10:15467728-15467750 CTGCTGAACATGAGAGAACAAGG + Intergenic
1064497269 10:15925236-15925258 ATAATGACCAAGAGAGAACAGGG - Intergenic
1068354651 10:55896171-55896193 ATTGTGACTATGTGAGAAGATGG + Intergenic
1073606661 10:104902363-104902385 CCAGTGACTCTGAGAGGTCATGG + Intronic
1073824784 10:107308132-107308154 CTAGTGACAAGGTGAGAACATGG + Intergenic
1081063248 11:38505694-38505716 CTGGTGGCTATGAGAGAAAATGG + Intergenic
1081537738 11:44007553-44007575 CTTGTCTCTATGAGACAACAGGG - Intergenic
1082250712 11:49977087-49977109 CTAATGACTATGGGAGAAACAGG + Intergenic
1083095417 11:60245674-60245696 CGGGTGACTGTGAGAGAAGAGGG - Intergenic
1085976326 11:81660003-81660025 CTAGTGACGCTGTGAGAAGAGGG - Intergenic
1088777108 11:113096153-113096175 CTATTGACTGTGAGAGAAGTGGG + Intronic
1090019568 11:123115643-123115665 GTAGTGAATATAAGGGAACATGG + Intronic
1090025681 11:123165772-123165794 CTAGGGACTAAGAGAGCACAGGG + Intronic
1097817375 12:64089711-64089733 CAAGTGTCTAGGAGAGAATATGG - Intronic
1099008180 12:77260111-77260133 CTAGTGAATCTGTGAGAAAAGGG - Intergenic
1100380055 12:94053592-94053614 CTGTTGTCTATCAGAGAACAGGG - Intergenic
1103166926 12:118778302-118778324 CTAGAGCCTCTGAGGGAACATGG + Intergenic
1103703676 12:122860400-122860422 CTAGTGGCGACGGGAGAACAGGG - Intronic
1105697749 13:22906551-22906573 CTAGAGATGATGAGAGAACAGGG + Intergenic
1106301127 13:28466793-28466815 CTAGTGAGTATGAAAGAAACGGG - Intronic
1107174618 13:37386059-37386081 CTACTGAGTATGAGGGAAGAGGG - Intergenic
1107832329 13:44385455-44385477 CAAGTGCCTAAGACAGAACAGGG - Intronic
1108648546 13:52453444-52453466 AAAGTGCCTGTGAGAGAACAGGG - Intergenic
1109582434 13:64359958-64359980 CTTTTGACTATGAGAGAACTAGG + Intergenic
1111776487 13:92669840-92669862 CTATTGACTATGAAGGGACATGG - Intronic
1112907423 13:104442064-104442086 TTAGTGAATAGAAGAGAACACGG - Intergenic
1113780615 13:112974670-112974692 CTAGTAAATATGAGAGAAGCTGG + Intronic
1114182342 14:20377493-20377515 CTAGAGAATGAGAGAGAACAAGG + Intronic
1114739341 14:25079189-25079211 GAAGTGCCTGTGAGAGAACATGG - Intergenic
1119121913 14:72087534-72087556 CTAATGACTGTGAGTGAAAAAGG + Intronic
1120046147 14:79808579-79808601 GTAGTAAGTATGATAGAACAAGG - Intronic
1120389141 14:83883059-83883081 CTGTTGACTATGAGACAACTTGG - Intergenic
1124918847 15:34004487-34004509 ATAATGACTATGAGACAACTGGG + Intronic
1124970311 15:34483263-34483285 CTATTGAATATGAGGGGACATGG - Intergenic
1126752271 15:51888753-51888775 CTAGTGGCTAAGAGAGAAAATGG - Intronic
1127836794 15:62796852-62796874 CTAGTGACTGTGAGGACACATGG - Intronic
1128003530 15:64216826-64216848 GTAGGGACTATGAAAGAAAATGG - Intronic
1128173675 15:65534351-65534373 CTAGTGACTATGAGAGAACACGG + Intronic
1128917963 15:71583521-71583543 ATAGTGACTGTGAAAAAACAAGG - Intronic
1129825548 15:78632693-78632715 CTAATGGCTATGAGAAAATAAGG + Intronic
1129851480 15:78796392-78796414 CTAGTCACTATGAGAGAGCCTGG - Intronic
1130407040 15:83611595-83611617 CTACTGAATGTGAGAGAGCAAGG + Intronic
1131340701 15:91598167-91598189 CAAATGGCTTTGAGAGAACAGGG + Intergenic
1131646077 15:94346423-94346445 CTAGTGACTATAAAGGAATAAGG - Intronic
1134512200 16:14857394-14857416 CTGATGACTATATGAGAACATGG + Intronic
1134699836 16:16255897-16255919 CTGATGACTATATGAGAACATGG + Intronic
1134971989 16:18538765-18538787 CTGATGACTATATGAGAACATGG - Intronic
1135425554 16:22332489-22332511 CTAGTGACAAGCAGAGAAGAGGG - Intronic
1135835765 16:25823812-25823834 CTCATGACTTTGAGAGACCAAGG - Intronic
1137341092 16:47606319-47606341 GTAGTGAATATGACAGAGCAAGG - Intronic
1138860966 16:60756582-60756604 CTAATGATTATAAGAGAACAGGG - Intergenic
1139460829 16:67121146-67121168 GTGGTGCCTATGACAGAACAGGG + Intronic
1142585349 17:969004-969026 CTAGAGACTATCACAGAACCTGG - Intronic
1152292077 17:79445716-79445738 CTTGTGACTCTGGGAGCACATGG - Intronic
1157264290 18:46204212-46204234 CTTGAGAGAATGAGAGAACAAGG - Intronic
1158657420 18:59351503-59351525 CTAATGTCTATGAGTGATCATGG - Intronic
1165318045 19:35068645-35068667 CTGGGGACTCTGAGAGAACATGG + Intergenic
925555645 2:5128949-5128971 ATAATTACTATGAGAGAAAAGGG - Intergenic
928886328 2:36152678-36152700 CTTGTGCAGATGAGAGAACATGG + Intergenic
931086614 2:58838277-58838299 TTAATGACTAGGAGAGAAGAGGG + Intergenic
942890952 2:180987345-180987367 GTGGTGACTAGGAGAGGACAAGG - Intronic
945749868 2:213768109-213768131 CTAGTGAAGAGGAAAGAACATGG + Intronic
1173676095 20:44836955-44836977 CTTGTGAGTATGAGGGCACAGGG + Intergenic
1177317132 21:19477014-19477036 CTAGTGGATATGTGAGAAGAAGG - Intergenic
1180689249 22:17697682-17697704 ATAGTGACTATTTGAGAATAAGG - Intronic
1182207350 22:28642363-28642385 CTAGTGTCTAGGAGAGTACCTGG - Intronic
950127652 3:10520033-10520055 CCAGTGACCATGAGGGATCAGGG - Intronic
952507321 3:34018831-34018853 CTAGTGCCTAGAATAGAACAGGG - Intergenic
953718371 3:45334863-45334885 CTGGTGGCGATGAGAGTACATGG - Intergenic
956045349 3:65190287-65190309 CTAGTGACTAAGATACAGCAGGG + Intergenic
957450251 3:80371446-80371468 CTAGAGATTATGAAAGAACCAGG - Intergenic
960104160 3:113775947-113775969 CTAGAAACTATGAGATAATACGG - Intronic
960856268 3:122105445-122105467 CTAGTAACTATAAAAGAACAAGG + Intronic
965330730 3:167371429-167371451 CAAGGGACTAGGAGAGAACATGG - Intronic
965458143 3:168929732-168929754 CTAGTGAAGCTGAGAGAAAAGGG - Intergenic
965789259 3:172370143-172370165 CTAGGGATTATAAGATAACAAGG + Intronic
966090659 3:176131719-176131741 TTTTTGCCTATGAGAGAACAGGG + Intergenic
971479702 4:27103472-27103494 CTAGTGCCTATAAGAGCACTTGG + Intergenic
971568681 4:28181240-28181262 TTAGTGATTATCAGAGACCAGGG - Intergenic
976756521 4:88504098-88504120 CTAGTAACTATGACAGTCCATGG + Intronic
976894046 4:90085715-90085737 CTAGGGACTGAGAGAGAAGAGGG - Intergenic
979363350 4:119790991-119791013 GAATTGACTATGAAAGAACATGG - Intergenic
980076981 4:128304028-128304050 CTAGTGACTATGAAAGCACTAGG + Intergenic
980474322 4:133291978-133292000 CTAGGAATTATGATAGAACAGGG + Intergenic
981650019 4:147046767-147046789 CTGGTAAATTTGAGAGAACAAGG - Intergenic
983146449 4:164221710-164221732 CTTGTGACCATGAGGCAACAGGG - Intronic
983305465 4:165979544-165979566 CTGGTTACTCTGAGAGAACATGG + Intronic
984141590 4:176010835-176010857 CTATGGACTGTGAGAGAAGAAGG + Intergenic
986064920 5:4225883-4225905 CTAGGGACACAGAGAGAACACGG - Intergenic
986564369 5:9096969-9096991 CGAGTAACTATGAGAGAAGGTGG + Intronic
989123382 5:38027071-38027093 ATAGTGCCTATGGGAGAACTAGG - Intergenic
990273804 5:54174136-54174158 CCAGTGTCTAGCAGAGAACATGG + Intronic
990332690 5:54743174-54743196 CTAATGACAATGACAGCACAGGG + Intergenic
991418046 5:66411843-66411865 CTTTTGACTATGAGACACCAAGG + Intergenic
991734186 5:69616711-69616733 CCTGTGATTATAAGAGAACATGG + Intergenic
991810619 5:70471846-70471868 CCTGTGATTATAAGAGAACATGG + Intergenic
991860081 5:71005437-71005459 CCTGTGATTATAAGAGAACATGG - Intronic
992602382 5:78415385-78415407 CACTTGACTATGAGAGAGCAGGG + Intronic
996521634 5:124433803-124433825 ATAGTGACTATGAGAGGCTAAGG + Intergenic
996832838 5:127758811-127758833 CCAGTGAATATAAGAGGACAAGG + Intergenic
997790976 5:136761926-136761948 CAAGAGAATATGAGAGAACACGG + Intergenic
1000422185 5:161050942-161050964 CTAGTGACTGGGAAGGAACATGG + Intergenic
1002670932 5:180866543-180866565 CTAGTGGCAAAGACAGAACAGGG + Intergenic
1004164376 6:13242804-13242826 CAAGTTACTAAGGGAGAACATGG + Intronic
1004313527 6:14566301-14566323 CTAATGACTAAGAAAGACCATGG + Intergenic
1010366602 6:75058875-75058897 CTAGTGGATATGTGAGAAGAGGG - Intergenic
1010594554 6:77748155-77748177 CTAGTGAAGCTGAGAGAAGAGGG - Intronic
1012286801 6:97400313-97400335 CTAGTAACTGTGGGATAACAGGG - Intergenic
1014256621 6:119166825-119166847 ATAATGATTATGAAAGAACATGG + Intergenic
1016785926 6:148010802-148010824 CTAGTGAATCTGTGAGAAGAGGG + Intergenic
1018574141 6:165241162-165241184 CTTGAGGCTATGATAGAACAGGG + Intergenic
1022516618 7:30978799-30978821 TAAGTGATTAAGAGAGAACAGGG + Intronic
1022793857 7:33716219-33716241 CTAGGGAATAGCAGAGAACAAGG - Intergenic
1024305606 7:47926835-47926857 CTAGAGAAGATGAGTGAACAAGG + Intronic
1024922034 7:54568176-54568198 ATAGTGACTTTTAGAGAACAAGG + Intronic
1025038595 7:55619463-55619485 CTAGTGAAGGTGTGAGAACAGGG + Intergenic
1028739652 7:94259009-94259031 CTGGTGCCTGTGAGAAAACAAGG + Intergenic
1029820928 7:103146381-103146403 CTAGTGACAATGAGAAAGCTTGG + Intronic
1030668774 7:112310859-112310881 TGAGTGGCTATGAGAGAAAAAGG - Intronic
1031872761 7:127104728-127104750 CTAATGACTATGATAGAAACAGG + Intronic
1032737028 7:134702033-134702055 CTAGTCACTGTGAGATGACAAGG + Intergenic
1034473209 7:151267410-151267432 ATAGTGACTCAGAAAGAACACGG - Intronic
1034659405 7:152756517-152756539 CTAGAGTCTTCGAGAGAACATGG + Intergenic
1036988451 8:13564779-13564801 CTAGTTCCTATCAGAGAGCAGGG - Intergenic
1037350640 8:17951332-17951354 CAAGTGAAAATGAGAGAATATGG + Intronic
1038912072 8:31976041-31976063 CTAGTGACTACAACAGAACTAGG + Intronic
1044072943 8:87785023-87785045 CTAGTGAATCTGTGAGAAGAGGG - Intergenic
1044278226 8:90326646-90326668 CCACTGTCTATGAGGGAACAGGG + Intergenic
1046000958 8:108420556-108420578 ATATTGACTATAAGAGGACAAGG + Intronic
1046202930 8:110950930-110950952 CCAGTCACTCTGAGAGATCAAGG + Intergenic
1047334770 8:123924858-123924880 ACAGTGACCATGAGAGAACAGGG - Intronic
1051634239 9:19167080-19167102 CTGGGGACTATGAGAGAGGAGGG - Intergenic
1051922325 9:22281997-22282019 CTAGTGCCTAGCAGAGAGCATGG + Intergenic
1052693546 9:31848541-31848563 CTTGTGAGTATGAGAGAGCCAGG + Intergenic
1052996288 9:34553161-34553183 CTAGGGGCTGTGAGAGAGCAGGG - Intronic
1053455456 9:38230203-38230225 CCAGTGACTTTGGGAGAAGAGGG - Intergenic
1054710676 9:68507964-68507986 CTAGTGTCTATCATAGACCAGGG + Intronic
1055080489 9:72263980-72264002 GTAGTGAGGATGAGAGAAAATGG - Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061845307 9:133384890-133384912 CAAGTGACCATGAGATAAGAGGG - Intronic
1186916981 X:14233618-14233640 TCAGTGAGTATTAGAGAACATGG - Intergenic
1187047518 X:15662013-15662035 CTAGAGACAATTACAGAACAGGG + Intronic
1188127143 X:26383410-26383432 CTAGTGAATCTGTGAGAAGAGGG + Intergenic
1190430258 X:50371918-50371940 CTAGTGACCAAGAGACCACAAGG + Intronic
1194751029 X:97684154-97684176 CTAGTGGCTATGCAAGTACATGG - Intergenic
1196043961 X:111236694-111236716 AAAGTGACTATGAGAGGAGATGG + Intergenic
1197014363 X:121605738-121605760 CAAGTGACTATCACAGAACTAGG - Intergenic
1197724197 X:129765511-129765533 CTAGTGAGTATGTGAGGAAATGG - Intronic
1197935498 X:131736397-131736419 CTAATGACTAGGTCAGAACATGG - Intergenic
1198872855 X:141194062-141194084 CTAGTGAAGATGTGAGAAGAGGG + Intergenic
1199196147 X:145032968-145032990 CTAGTGAAGCTAAGAGAACAGGG + Intergenic
1201275544 Y:12294401-12294423 CTAGTGACTTTTAGTGAGCAGGG - Intergenic