ID: 1128180156

View in Genome Browser
Species Human (GRCh38)
Location 15:65595241-65595263
Sequence AGATATATGCTGCAGTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128180152_1128180156 21 Left 1128180152 15:65595197-65595219 CCAGAGAGATGCTGAATTTGAGG 0: 1
1: 0
2: 4
3: 21
4: 208
Right 1128180156 15:65595241-65595263 AGATATATGCTGCAGTAAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128180156 Original CRISPR AGATATATGCTGCAGTAAGG AGG Intronic
902586514 1:17442263-17442285 AGGTAGAGGCTGCAGTAAGCTGG - Intergenic
905807113 1:40884929-40884951 AGATGCATGCTTCAGAAAGGAGG + Intergenic
906406191 1:45544133-45544155 AGATCAATGCTGCAGTGAAGTGG - Intergenic
907550818 1:55303292-55303314 AGGTCTCTGCTGCTGTAAGGGGG - Intergenic
908035328 1:60045641-60045663 AGACATATGCTGAAATAATGTGG - Intronic
909415516 1:75401723-75401745 ACATATATACTGCAGCACGGAGG + Intronic
909958649 1:81807870-81807892 ATATATCTGCTGCACTAAGTAGG + Intronic
910830639 1:91457682-91457704 AGAAATATCGTGCAGAAAGGAGG + Intergenic
911639954 1:100277642-100277664 ACATATATGCTGCAGTATTCAGG - Intronic
912029783 1:105226582-105226604 AAATATATCATTCAGTAAGGTGG - Intergenic
913242002 1:116837634-116837656 AGATATTTGCATAAGTAAGGAGG + Intergenic
913468425 1:119166998-119167020 AGATATATGCTGAAGTACTTAGG + Intergenic
915250843 1:154587490-154587512 AGGTATATGCTGCAGAGAGATGG - Intronic
915524433 1:156467321-156467343 ACACATATGCTGCAGGAAGGGGG - Exonic
916238232 1:162612145-162612167 AGATATATCCAGCACTCAGGAGG - Intergenic
917835404 1:178937976-178937998 AGATTGATGCTGCGGTCAGGAGG + Intergenic
924318297 1:242821459-242821481 AGATATAGAATGCAGAAAGGAGG + Intergenic
924350471 1:243109491-243109513 AGAGATATGCTGCAGCAGAGGGG - Intergenic
1063827702 10:9916927-9916949 AGATATAAGCTCAAGTAATGGGG + Intergenic
1065182352 10:23139293-23139315 AGAGATTTGCTGCAGTAAATAGG - Intergenic
1067075829 10:43181241-43181263 AGATTTCTGCTCCAGTAAGTTGG + Intronic
1067808079 10:49407057-49407079 AGATAGATGCTTCAGTAAAGAGG + Intergenic
1067958783 10:50824010-50824032 AGACATCTGCTGCATTAAGAGGG - Intronic
1072141380 10:92592070-92592092 AGATAGAGGCTGCAGTGAGCCGG - Intergenic
1073679694 10:105689239-105689261 AGAGATTTGCTGCAGTAAATAGG - Intergenic
1074028983 10:109665236-109665258 AGATAAAGGCTGCATTGAGGAGG - Intergenic
1079647890 11:22890517-22890539 ATATTTGTGCTGCAATAAGGTGG - Intergenic
1082916116 11:58439407-58439429 AGATGGAAACTGCAGTAAGGTGG + Exonic
1085866702 11:80303367-80303389 AGATATTTGCATAAGTAAGGAGG + Intergenic
1098158539 12:67624831-67624853 AGATAGCTGCTGCAGGATGGTGG - Intergenic
1099110377 12:78552611-78552633 AGATAAATGCTGTAGTAGGCAGG - Intergenic
1102842338 12:116138544-116138566 AGTTTTATGATTCAGTAAGGTGG + Intronic
1108600601 13:51991224-51991246 AGATTTATACTGCAGCAGGGAGG - Intronic
1111194828 13:84860868-84860890 AGATATATGATGCAGAAATTTGG - Intergenic
1114698798 14:24655391-24655413 AGATATATTCTGCAGTGGGTGGG - Intergenic
1115866234 14:37750054-37750076 TGATATATATTGCAGTAAGTTGG + Intronic
1117153945 14:52918945-52918967 AGATAAATGCTGGGTTAAGGTGG - Intronic
1119057632 14:71439237-71439259 AGAAATGTGCTGCAGACAGGAGG + Intronic
1120654694 14:87175843-87175865 AGAAATATGATGCATAAAGGGGG - Intergenic
1120912326 14:89678563-89678585 ATACATATGCTCCAGTAATGTGG + Intergenic
1121225898 14:92322134-92322156 AGATAAATGCCCCATTAAGGAGG - Intergenic
1128180156 15:65595241-65595263 AGATATATGCTGCAGTAAGGAGG + Intronic
1131666239 15:94573705-94573727 AAATATATGCTGCATTAAGTTGG + Intergenic
1131713508 15:95081369-95081391 AGATAGATGAGGCAGAAAGGTGG + Intergenic
1136139991 16:28282270-28282292 AGATCTCGGCTGCAGAAAGGAGG + Intergenic
1137295481 16:47088494-47088516 AAATATTTGCTGCACCAAGGAGG + Intronic
1142124753 16:88404674-88404696 AGAGGGATGCTGCAGGAAGGAGG + Intergenic
1153343213 18:3998035-3998057 AGACATATGCTTCTGTATGGAGG - Intronic
1156249962 18:35343819-35343841 AGGTCTATGCAGCAGTAAGGTGG - Intronic
1156528477 18:37791871-37791893 AAATATGTTCTGCCGTAAGGTGG + Intergenic
1156956609 18:42973456-42973478 AGATATATTTTGAAGAAAGGTGG - Intronic
1157123739 18:44936105-44936127 AGATACATTCTGCAGTAGGAAGG - Intronic
1157407464 18:47434388-47434410 AGTTATTTGCTCCAGTAAAGTGG - Intergenic
1158641569 18:59208090-59208112 AAATATATGTTGGAGAAAGGAGG + Intergenic
1159701203 18:71630416-71630438 AAATACATGTTGCAGTAATGAGG - Intergenic
1159939704 18:74397534-74397556 AGGTATCTGCTGGAGTAAGGAGG + Intergenic
1164001344 19:21102396-21102418 AGATATATGCTGAAGAAAGTGGG - Intronic
1164008107 19:21170597-21170619 AGATATATGCTGAAGAAAGTGGG - Intronic
1164123360 19:22287738-22287760 AGAGATAGGCTGCAGGAATGGGG - Intronic
1165849611 19:38841881-38841903 ACATATGTGCTGCAGTGCGGTGG + Intronic
1168014460 19:53561086-53561108 AGATCGAAGCTGCAGTAAGCTGG + Intronic
925951653 2:8919056-8919078 TGATATATGCTGCAACATGGAGG - Intronic
926742454 2:16124108-16124130 AGATAAATGCTGCAATAAAAGGG - Intergenic
927241418 2:20922889-20922911 AGATAGAATCTGCAGTCAGGAGG - Intergenic
930793440 2:55359574-55359596 ATATATATGCTACAGGAATGGGG - Intronic
932172869 2:69573351-69573373 AGATATATGCTAAAACAAGGAGG + Intronic
933200466 2:79442126-79442148 TTATATATGCTCCAGAAAGGAGG + Intronic
933423557 2:82082740-82082762 AGAAATATGTTGTAGGAAGGTGG + Intergenic
933984388 2:87578413-87578435 AATTATGTGCTGCAGAAAGGCGG + Intergenic
935713471 2:105919293-105919315 AAATCTATTCTGCAGAAAGGAGG - Intergenic
936309466 2:111372387-111372409 AATTATGTGCTGCAGAAAGGCGG - Intergenic
936827471 2:116599872-116599894 ATATATATGTTGCAGTCAGAAGG - Intergenic
938050074 2:128161527-128161549 AAATATATGCAGAAGTAAAGAGG + Intronic
938175569 2:129124188-129124210 AAATATATGCTGTATTCAGGAGG - Intergenic
939833470 2:147100342-147100364 AGATATCTGCTTCAGTGAGATGG - Intergenic
942348239 2:175025995-175026017 ATAAAGATGCTGCAGTAAGGGGG - Intergenic
942371532 2:175290882-175290904 AAGTATATGCAGCATTAAGGTGG - Intergenic
942841125 2:180362042-180362064 AAATCTATGCTGAAGTAAAGAGG - Intergenic
943959067 2:194236493-194236515 TGTTCTATGCTGCAGTAAGGAGG + Intergenic
943977207 2:194499227-194499249 AGGTTTATGCTGCATTAAGATGG - Intergenic
946359211 2:219209067-219209089 AGATATATGCTGCAGTGGAAGGG + Intronic
948529880 2:238597707-238597729 AGAAATTTCATGCAGTAAGGAGG - Intergenic
1173914011 20:46693183-46693205 AGATAAATCCAGCAGGAAGGGGG + Intergenic
1173927984 20:46794828-46794850 AGAGATGAGCTGCAGTAAGGAGG + Intergenic
1177555451 21:22682070-22682092 AGAAATTTGCATCAGTAAGGAGG - Intergenic
1182051599 22:27316521-27316543 AGAAATATGAAGCAGGAAGGAGG - Intergenic
1182063980 22:27417393-27417415 AGGTATTTGCTGAAGGAAGGAGG + Intergenic
1183895511 22:40965508-40965530 AGATAAAGGTTGCAGTAAGCCGG - Intronic
949261473 3:2106730-2106752 AGAAATTTGCAGAAGTAAGGAGG - Intronic
959106880 3:102074965-102074987 AGATCTATGCTGCAGTGATGTGG - Intergenic
965707937 3:171528624-171528646 TGAAATGTGCTACAGTAAGGTGG + Intergenic
965884255 3:173424333-173424355 AGAAATTTGCTCAAGTAAGGAGG - Intronic
966657850 3:182379515-182379537 AAATATTAGCTGCAGTAAGTTGG - Intergenic
967138050 3:186529176-186529198 AGAAATGTGCTGCAGTGGGGAGG + Intergenic
971313357 4:25546003-25546025 AGATTTATGCTGGGGTGAGGGGG + Intergenic
975340878 4:73238595-73238617 AGAGAAATGATGGAGTAAGGAGG - Intronic
976824576 4:89246615-89246637 ATATATATGCTGGAGTAAAAAGG - Exonic
977565090 4:98572395-98572417 AAATATTTGCTGAAGTAAGTGGG - Intronic
977808083 4:101326218-101326240 AGATATATGTAGGAGTTAGGAGG - Intronic
978586220 4:110278516-110278538 AGCTGAATGCTGCAGAAAGGTGG + Intergenic
979133892 4:117084757-117084779 AGAGATAAGCTCCAGTAATGTGG + Exonic
979336308 4:119467079-119467101 AGATAATTGCTGCAGTGAGTGGG + Intergenic
982233026 4:153226482-153226504 AGAAATATGCTGCAGGCAGTTGG + Intronic
983239213 4:165212420-165212442 AGATAATTGCTGCAGTGAGTGGG + Intronic
992751111 5:79862531-79862553 AGAAATATGCTGCTGTCAAGTGG - Intergenic
993024103 5:82626464-82626486 AGATATTTGCAGAAGTAATGAGG + Intergenic
995244113 5:109918144-109918166 AGATATTTGCTTAAGTAACGAGG + Intergenic
995954638 5:117761593-117761615 AGAAATCTGATGCAGTAATGTGG + Intergenic
997327589 5:133034840-133034862 AGATATCTGAATCAGTAAGGTGG + Intergenic
997613533 5:135231327-135231349 AGAGATGTGCTCCAGGAAGGTGG + Intronic
998988740 5:147791538-147791560 GAATATATGCTGCAGGAATGTGG + Intergenic
1000011111 5:157233918-157233940 ATATATATGTATCAGTAAGGAGG - Intronic
1001996835 5:176168579-176168601 AGATAGATGCTGAAGTATTGGGG + Intergenic
1003143737 6:3492707-3492729 AGCTCTAAGCTGCAGTGAGGGGG + Intergenic
1005694917 6:28342938-28342960 AGATATATATTGGAGAAAGGGGG + Intronic
1006062913 6:31438935-31438957 AGAAATTTGCATCAGTAAGGGGG + Intergenic
1008367839 6:50703671-50703693 AGAGATTTGCTGCAGTAAATAGG - Intergenic
1009250465 6:61292178-61292200 AGATTTATGCTGCATAAAAGTGG - Intergenic
1011771606 6:90679441-90679463 AGATATGTGGTGCTGTAATGAGG + Intergenic
1012030283 6:94051689-94051711 AGAAATTGGTTGCAGTAAGGGGG - Intergenic
1013628940 6:111966325-111966347 AGATATATGCTGAAGTATTTGGG + Intergenic
1017265221 6:152437079-152437101 AGATAGAGGCTGCAGTGAGCAGG + Intronic
1021393068 7:20118269-20118291 AGTTATATTCTGAAGTAATGAGG - Intergenic
1024888280 7:54169724-54169746 AGCTCTCTGCTGCAGAAAGGGGG - Intergenic
1024894617 7:54243445-54243467 GGAAATATGCTGTAGGAAGGTGG + Intergenic
1025256388 7:57386358-57386380 AAATATCTGCTGAATTAAGGAGG + Intergenic
1025721522 7:64020192-64020214 AGAAATTTGCAGCAGTAAAGAGG + Intergenic
1025791811 7:64694970-64694992 AGATATAGGCTGAAGAAAGTGGG - Intronic
1026363632 7:69625786-69625808 AGATTGAAGCTGCAGTAAGCTGG + Intronic
1027369133 7:77489728-77489750 ATATATATGCATCAGTAAGCTGG + Intergenic
1031957139 7:127954163-127954185 AAATATTTGCTGGAGTAAGGGGG - Intronic
1032339890 7:131060968-131060990 AGATATTTGCTGCTGTAATATGG - Intergenic
1033530588 7:142258936-142258958 AGATATATTTTGCAGTGATGGGG + Intergenic
1033946941 7:146730621-146730643 ATATATATGTTGCGGTCAGGAGG - Intronic
1035700158 8:1632258-1632280 AGATATATGCTGCCGTAATGGGG + Intronic
1037169648 8:15875713-15875735 TGATACTTGCTGCAGTAAGGGGG + Intergenic
1038806951 8:30802796-30802818 AGATACATGCTACAATATGGAGG + Intronic
1044910158 8:97049263-97049285 AAATATCTGCTGAAGGAAGGAGG - Intronic
1045155166 8:99460380-99460402 AGATATATGTGTCAATAAGGGGG - Intronic
1045301959 8:100919045-100919067 AGAGATTTGCTGCAGTAAATAGG + Exonic
1045994705 8:108349517-108349539 ATGTATATGGTGCAGTAAGATGG + Intronic
1050051046 9:1601853-1601875 AGATAAATGCTTCAATAAGATGG + Intergenic
1050643343 9:7692826-7692848 AGAAATTTGCAGAAGTAAGGAGG + Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1052702490 9:31953888-31953910 TGTTATATGCTGCAGTTAGATGG - Intergenic
1052730363 9:32278131-32278153 GGTTATATTCTCCAGTAAGGAGG - Intergenic
1052730367 9:32278213-32278235 GGTTATATTCTCCAGTAAGGAGG - Intergenic
1052730371 9:32278251-32278273 GGTTATATTCTCCAGTAAGGAGG - Intergenic
1187423737 X:19159314-19159336 AGATAAGTTCTGCAATAAGGAGG + Intergenic
1189100402 X:38183121-38183143 AGATGGAGGCTGCAGTAAGCCGG - Intronic
1189457790 X:41209053-41209075 AGATATATGTTGAAGTATGAAGG - Intronic
1189512214 X:41674174-41674196 AGAGATTTGCTGCAGTAAATAGG + Intronic
1191598444 X:62974260-62974282 AGATATTTGCTGCAGGGAAGGGG - Intergenic
1194635082 X:96335737-96335759 AGATATATGCTGCTGTAGGTTGG - Intergenic
1196910243 X:120477516-120477538 AAACTTATGCAGCAGTAAGGAGG - Intergenic
1197741049 X:129894325-129894347 AGATTGAGGCTGCAGTAAGCTGG - Intergenic
1197908589 X:131454965-131454987 AGATTTCTGCTCCAGTAAGCTGG - Intergenic
1201221755 Y:11777966-11777988 AGATATAGAATGCAGAAAGGAGG + Intergenic