ID: 1128182884

View in Genome Browser
Species Human (GRCh38)
Location 15:65620560-65620582
Sequence GGCACATTTTGAAATTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128182884_1128182892 30 Left 1128182884 15:65620560-65620582 CCTGCTGAATTTCAAAATGTGCC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 51
1128182884_1128182888 10 Left 1128182884 15:65620560-65620582 CCTGCTGAATTTCAAAATGTGCC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1128182888 15:65620593-65620615 GATAATAAGACAGAAGAAACTGG 0: 1
1: 0
2: 2
3: 42
4: 555
1128182884_1128182889 11 Left 1128182884 15:65620560-65620582 CCTGCTGAATTTCAAAATGTGCC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1128182889 15:65620594-65620616 ATAATAAGACAGAAGAAACTGGG 0: 1
1: 1
2: 1
3: 60
4: 677
1128182884_1128182890 25 Left 1128182884 15:65620560-65620582 CCTGCTGAATTTCAAAATGTGCC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1128182890 15:65620608-65620630 GAAACTGGGTTTACCCCCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 107
1128182884_1128182891 26 Left 1128182884 15:65620560-65620582 CCTGCTGAATTTCAAAATGTGCC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1128182891 15:65620609-65620631 AAACTGGGTTTACCCCCAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128182884 Original CRISPR GGCACATTTTGAAATTCAGC AGG (reversed) Intronic
903695741 1:25205412-25205434 GGCAGCTGATGAAATTCAGCAGG + Intergenic
903756532 1:25665731-25665753 GGGCCATTTTCAAAATCAGCAGG - Intronic
904354753 1:29931711-29931733 GGCAAATGCTGAAATGCAGCAGG - Intergenic
905695203 1:39968671-39968693 GGTACATTTTGAAGAGCAGCAGG - Exonic
908835048 1:68221227-68221249 TGCAAATTCTGAAATTCAGGGGG + Intronic
909134878 1:71785596-71785618 GGCACATTTCCAAATGGAGCTGG - Intronic
912234088 1:107830070-107830092 TTCACCTTTTAAAATTCAGCAGG + Intronic
913543928 1:119848049-119848071 CCCACATTTTCCAATTCAGCTGG + Intergenic
913639845 1:120802001-120802023 CCCACATTTTCCAATTCAGCTGG - Intergenic
914212654 1:145594518-145594540 CCCACATTTTCCAATTCAGCTGG + Intergenic
914278635 1:146148337-146148359 CCCACATTTTCCAATTCAGCTGG + Intronic
914440247 1:147699422-147699444 GGCTCATATTGAAATCCAGTCGG + Intergenic
914539683 1:148599285-148599307 CCCACATTTTCCAATTCAGCTGG + Intronic
914626995 1:149472343-149472365 CCCACATTTTCCAATTCAGCTGG - Intergenic
916850317 1:168696587-168696609 GGCACATTATGAACTTCCACTGG + Exonic
922429199 1:225530584-225530606 GGGCCATTTTGAACTTGAGCAGG + Exonic
923401658 1:233621150-233621172 GTCACATTTTGAAATACTGAGGG - Intronic
923857336 1:237859182-237859204 GGCACGTTAGGAAATCCAGCTGG + Intergenic
1063003990 10:1951630-1951652 GGCACGTTTTGCAATTGTGCAGG - Intergenic
1063537969 10:6903661-6903683 GGCAAACTTTGTAATTCAACTGG + Intergenic
1063774325 10:9243988-9244010 TGGACAGTTTGAAATTCCGCAGG - Intergenic
1064509872 10:16078456-16078478 GCCACATTTTGTAACTCAGCCGG + Intergenic
1065010724 10:21418473-21418495 GAAACAGTTGGAAATTCAGCTGG + Intergenic
1066081025 10:31929931-31929953 GGCACAATTCGGAGTTCAGCTGG - Intergenic
1068298938 10:55113673-55113695 GGCTAATCTTGAAATTCATCAGG + Intronic
1069257591 10:66353334-66353356 GGCACAATTGTAAATTCAGTAGG + Intronic
1071069909 10:81679980-81680002 GGCACATTTGGAATTTCAAGTGG + Intergenic
1072008359 10:91279835-91279857 GAATCATTTTGAAATTCAGAAGG - Exonic
1076528104 10:131125436-131125458 GACACAATGTGAAATTCTGCAGG + Intronic
1079703543 11:23582873-23582895 GTCACTTTTTGGATTTCAGCAGG + Intergenic
1081154087 11:39667568-39667590 GGCACCTTTTTAAGTTCAACAGG + Intergenic
1084249429 11:67885304-67885326 GGCACATCTTGAAGATCAGATGG + Intergenic
1085058068 11:73419556-73419578 GGCACATTTTGAAGGTCTGTGGG - Intronic
1087097000 11:94328695-94328717 GGCATTTTTTGAAATCTAGCTGG + Intergenic
1087611680 11:100442233-100442255 GTCACATGGTGATATTCAGCTGG + Intergenic
1088100476 11:106148954-106148976 GGCACATTTTCAAATACTGAAGG + Intergenic
1088603944 11:111511584-111511606 CTCACCTTGTGAAATTCAGCTGG - Intronic
1088694866 11:112358014-112358036 GCCACATTCTGAAATACATCAGG + Intergenic
1092696013 12:11171830-11171852 GTCACATTCTGAAATTCGTCAGG - Intergenic
1093764551 12:22948030-22948052 GGTACATTGTGAAAGTCAGAAGG + Intergenic
1093934178 12:24983546-24983568 GGCATCTTTTGAAATTTAGGTGG + Intergenic
1094236125 12:28168771-28168793 GGCTCATTTTTAAATTGAGTTGG - Intronic
1095291007 12:40480294-40480316 GGGACATCTTCAAATTCAGCTGG + Exonic
1095291049 12:40480738-40480760 GGGACATCTTCAAAATCAGCTGG + Exonic
1096261757 12:50097102-50097124 GGTCCATTTTGCAATTAAGCAGG + Intronic
1096275479 12:50203707-50203729 TGAAAATTTTGATATTCAGCTGG - Intronic
1098080435 12:66779204-66779226 GGCAGGTTTTCAAATTAAGCTGG + Intronic
1099863852 12:88253906-88253928 GGTAGATTTTGATATTAAGCAGG - Intergenic
1100723140 12:97379992-97380014 GGAAAATTTTAAAATTCATCTGG - Intergenic
1102709339 12:114911875-114911897 GGCACATTATCATATTCAGCTGG + Intergenic
1104831178 12:131752814-131752836 TGCACATTTTGAAGTTAAGGAGG + Intronic
1105223944 13:18409791-18409813 AGCACATTTTGAAATCTAGAAGG - Intergenic
1105630034 13:22154610-22154632 GAAACATTTCGAACTTCAGCAGG - Intergenic
1107762099 13:43690775-43690797 AGCACATCTAGAAATTTAGCTGG + Intronic
1108721627 13:53138556-53138578 CGCACATTTTGAAATTTAGCTGG + Intergenic
1108975493 13:56438736-56438758 AGCACCTTTTGAAATCCAGGTGG + Intergenic
1113226520 13:108165754-108165776 GGCACACTGTGAATTTCAGTGGG + Intergenic
1113956391 13:114101794-114101816 GGCCCACTTTGGAATCCAGCAGG - Intronic
1114008091 14:18334617-18334639 AGCACATTTTGAAATCTAGAAGG - Intergenic
1114567014 14:23640036-23640058 GGCACATTTTGGGAGACAGCTGG - Intronic
1114857382 14:26465527-26465549 AGCACAATTTGAAAACCAGCTGG - Intronic
1115024766 14:28730372-28730394 CACACATTTTGAAAATCAACAGG - Intergenic
1115706830 14:36007822-36007844 GGCACACATTTAAATTCAACAGG + Intergenic
1116050482 14:39796769-39796791 TCCACATTTTAAAATTCATCAGG - Intergenic
1117372167 14:55088628-55088650 GGCAGATTTTGAATTTAAGATGG - Intergenic
1117556163 14:56886701-56886723 GCTACATTTGGAAAATCAGCAGG + Intergenic
1117835020 14:59795130-59795152 GCCAGAGTTTGAACTTCAGCTGG - Intronic
1118257792 14:64220363-64220385 GGCTCATTTTGAACCTCAGTAGG - Intronic
1118692350 14:68352349-68352371 GACACATTCTGAAAGCCAGCAGG + Intronic
1120281646 14:82446263-82446285 GTCACATTTTCAAATTCCTCTGG - Intergenic
1125196598 15:37054576-37054598 GAAACATTTTAAAAATCAGCTGG - Intronic
1125221274 15:37338352-37338374 GGCTGAATATGAAATTCAGCTGG - Intergenic
1125323959 15:38517021-38517043 GCCCCATTTTGAAAGACAGCAGG + Intronic
1127639599 15:60903563-60903585 GCTTTATTTTGAAATTCAGCTGG + Intronic
1128182884 15:65620560-65620582 GGCACATTTTGAAATTCAGCAGG - Intronic
1130250407 15:82296711-82296733 AGCACATTTTTAAATCCATCAGG + Intergenic
1130688085 15:86056691-86056713 TCCACATTTTCAAATTCACCAGG - Intergenic
1133445216 16:5853738-5853760 GCCACAATTTGAAATGCAGCAGG - Intergenic
1133447935 16:5878152-5878174 GGAACAATTGGAAAATCAGCTGG + Intergenic
1134209886 16:12267328-12267350 GGGGGATTTTGAAATTAAGCAGG + Intronic
1134599795 16:15524407-15524429 AGTACATTTAGAAATTCAGGAGG - Intronic
1135515660 16:23131011-23131033 AAGACATTTAGAAATTCAGCTGG + Intronic
1138222966 16:55268716-55268738 GGCACATTTGGGACATCAGCAGG - Intergenic
1143631552 17:8143121-8143143 GCCTCATTCAGAAATTCAGCTGG + Intronic
1145185686 17:20791915-20791937 GGCTAATTTTGAAATACATCAGG - Intergenic
1146041614 17:29459995-29460017 GGAAAGTTTTGAATTTCAGCAGG + Intronic
1154221048 18:12454480-12454502 GTGACATTTTGAATTTCAGGAGG - Exonic
1154529366 18:15329326-15329348 AGCACATTTTGAAATCTAGAAGG + Intergenic
1155109731 18:22702328-22702350 GTCACATATTGCATTTCAGCAGG + Intergenic
1155460030 18:26068493-26068515 GGAACATTTTGAAGATTAGCAGG - Intronic
1156232718 18:35170075-35170097 TTCACATTTTGAAATTATGCAGG + Intergenic
1157142697 18:45126563-45126585 GGCACATTTTCCATTGCAGCAGG - Intergenic
1160419394 18:78733779-78733801 GACACATATTGAAATGCTGCGGG + Intergenic
1161337269 19:3721439-3721461 GGCACATTTTGAGGTGCATCTGG - Intronic
1164778143 19:30870808-30870830 GGCACATTATGGAATTCAGAAGG - Intergenic
1166620937 19:44299574-44299596 GGCACCCTCTGTAATTCAGCAGG - Intronic
926392457 2:12407162-12407184 GACACACTTTGAAATTCTTCAGG - Intergenic
926828816 2:16937300-16937322 GGCAAATTTTGACATTCTTCTGG + Intergenic
929790948 2:45022489-45022511 GACACATTTTGAAAGTCACTAGG - Intergenic
931485030 2:62682101-62682123 GAGACATTTTGACATTCAGAAGG + Intronic
933153588 2:78945810-78945832 TGCACATGTTCAAATTCAGTGGG - Intergenic
933384605 2:81593959-81593981 GGCAGATTTTAATATTCAGTTGG - Intergenic
933516881 2:83315217-83315239 GGCCCATTTTAAAGTTCAGTAGG - Intergenic
934031697 2:88054805-88054827 GGTACATATTAAAACTCAGCTGG + Intronic
936076919 2:109407287-109407309 GGAAGTGTTTGAAATTCAGCAGG + Intronic
938528461 2:132160752-132160774 AGCACATTTTGAAATCTAGAAGG + Intronic
939515199 2:143157917-143157939 GGCACATATTCAAATGCAGTAGG + Intronic
942308864 2:174635253-174635275 GGCATATTTTGGAGGTCAGCAGG - Intronic
942966159 2:181894270-181894292 GGCAAATGTTGACATTCACCAGG + Intronic
944836193 2:203582289-203582311 GGCAAATTATGAAATTCCTCTGG + Intergenic
945056110 2:205870585-205870607 GTCATATTTTGAGATTCATCAGG - Intergenic
945227059 2:207542500-207542522 TGCACATTTTAAAATTCGGTTGG + Intronic
945833007 2:214809160-214809182 GGTAGTTTTTGAACTTCAGCGGG - Intronic
947705740 2:232274052-232274074 GGCACACTTTCAACTTCAACCGG - Intronic
947961515 2:234241908-234241930 GACACATTTTAAAAATCACCAGG + Intergenic
1168789098 20:563967-563989 GGCTCATTCTGTCATTCAGCTGG - Intergenic
1170051610 20:12151830-12151852 GACAGATTTTGAAATTAACCTGG - Intergenic
1171018706 20:21564500-21564522 GGCACATGGTGAAGTGCAGCCGG - Intergenic
1172315333 20:33949587-33949609 GGCACACTTTGAATTTTAGTAGG + Intergenic
1173836156 20:46127502-46127524 GCCATATTTTGAAAATCATCAGG - Intronic
1173923488 20:46763355-46763377 CTCACAGTTTGAAAATCAGCAGG + Intergenic
1174557892 20:51408867-51408889 GGCAGAGTTTCTAATTCAGCAGG + Intronic
1174568608 20:51484911-51484933 GGCACATTTTGAAATTACACAGG + Intronic
1176768035 21:13039144-13039166 AGCACATTTTGAAATCTAGAAGG - Intergenic
1178406820 21:32331318-32331340 TTCACAGTTTGAAATTCAGCAGG - Intronic
1180432597 22:15265427-15265449 AGCACATTTTGAAATCTAGAAGG - Intergenic
1182925141 22:34115371-34115393 GGGAGATTTTGAAGATCAGCAGG - Intergenic
1183381521 22:37492650-37492672 GGCACACTTGGAAGTCCAGCCGG + Exonic
949095059 3:76053-76075 GGCACAATTTGAAATTAAGGAGG - Intergenic
949383072 3:3467313-3467335 GGCATTTTTAGAAAGTCAGCAGG - Intergenic
950030921 3:9852827-9852849 GGCCGATACTGAAATTCAGCCGG + Intronic
951371235 3:21851732-21851754 GGCACCTTTTTAAATGCAGTGGG - Intronic
959070039 3:101693647-101693669 GGCAGATACTGAAGTTCAGCCGG - Intergenic
959094720 3:101941757-101941779 GACACACTTTGAAAATCAGAAGG + Intergenic
960725176 3:120662836-120662858 GTCACATTCTGAAATACAGGGGG - Intronic
961225126 3:125237274-125237296 TGCAAATTTTGAAATAGAGCTGG + Intronic
961289702 3:125836104-125836126 GGCACATCTTGAAGATCAGATGG - Intergenic
963609271 3:147444486-147444508 AGGACAGTTTGAAATTCAGTGGG - Intronic
963666686 3:148197103-148197125 GGAACATTTTTAAAACCAGCTGG + Intergenic
964107380 3:153053902-153053924 GGAACATTATGATATTCAGAAGG - Intergenic
965438645 3:168685126-168685148 GGCACATTTAGAAATTTTGCAGG - Intergenic
967001621 3:185341127-185341149 GTCACATTTTGAAGTTCTGGTGG - Intronic
969975482 4:11096912-11096934 GGAACAGTTTGAAATTTAGGTGG + Intergenic
970701931 4:18751760-18751782 GGCACATTTAGAAAGATAGCTGG - Intergenic
974001970 4:56520888-56520910 GGCAGATTTTGACATTTTGCTGG + Intronic
974375068 4:61065372-61065394 GAAACATATTGAAATTCAGCAGG - Intergenic
976192235 4:82498888-82498910 AACAAATTATGAAATTCAGCAGG + Intronic
978403156 4:108351825-108351847 GGCACATTTTGATAACCTGCAGG + Intergenic
978411796 4:108434116-108434138 AGCACATTTTCAACTGCAGCAGG + Intergenic
978780551 4:112548616-112548638 GACATATTTTGATATTCAGACGG + Intronic
981105576 4:140876808-140876830 GCCACATTTGGAAACCCAGCAGG + Intronic
981492798 4:145358389-145358411 TGCACATTTTGTAATTCAGATGG - Intergenic
983501193 4:168501646-168501668 GGCACATGTTGAAATTCACCTGG + Intronic
985690954 5:1312020-1312042 GGCACATTCTGAAGTTCTGGGGG - Intergenic
987615488 5:20268573-20268595 AGCACATTTTAAAAATTAGCTGG + Intronic
988411272 5:30888809-30888831 GGAACATTTTGAATTTAAGATGG - Intergenic
991163718 5:63536302-63536324 AGCACATTTTGAAATGCATAAGG + Intergenic
992046227 5:72892773-72892795 GGCACATTCTGAGATCCTGCCGG - Intronic
992208230 5:74451997-74452019 GGGACATGTTAAAAATCAGCAGG - Intergenic
992245522 5:74818530-74818552 AGCACATTTTGAGATTCATCCGG - Intronic
993396299 5:87393487-87393509 GTCACATAGTGAAATACAGCTGG + Intronic
995027618 5:107442587-107442609 GAAACAGTTTGTAATTCAGCTGG - Intronic
996621072 5:125503832-125503854 GGCACATTTGGAAATATAGGTGG + Intergenic
997173052 5:131744146-131744168 GGCATATGTTGAAATTCAATAGG + Intronic
999404932 5:151298467-151298489 GGCACATTTTCAATTGCAGAGGG + Intronic
1000968405 5:167686907-167686929 AGCACATGTTGAAATCCAGGAGG + Intronic
1002818538 6:700829-700851 AGGACAATTTGAAATTCTGCAGG + Intergenic
1007192601 6:40032303-40032325 GGCTCAGGTTGAAATTCAGGCGG - Intergenic
1008477196 6:51944828-51944850 GGCACTTGTAGAAATTGAGCAGG - Intronic
1010659350 6:78550774-78550796 AGCACCTTTTTAAATTCACCTGG - Intergenic
1012811473 6:103965005-103965027 GGCACATTTGGAGAATCAGTTGG - Intergenic
1013678609 6:112495905-112495927 GCCACATTTTAAAAAGCAGCAGG - Intergenic
1015024495 6:128518350-128518372 AGCTCATTTTCACATTCAGCTGG + Intronic
1016474884 6:144416405-144416427 GGCACATCTGGAGAATCAGCTGG - Intronic
1021163801 7:17308523-17308545 GGTAAAGTTTGAAATTCAGTTGG + Intronic
1022241817 7:28519593-28519615 GGCACATATTGTAAGACAGCTGG + Intronic
1023291656 7:38674421-38674443 GGCCAATTTTTAAACTCAGCTGG - Intergenic
1024135578 7:46404437-46404459 GGCATATTTAGAAATTCACTTGG - Intergenic
1024352880 7:48385011-48385033 GTCACATTTTGAAGTACAGGGGG + Intronic
1027453036 7:78354544-78354566 GGCAGATTATGAAAGTCACCAGG + Intronic
1027665189 7:81035889-81035911 GGCACATTTGGAATTTCATGGGG + Intergenic
1027955195 7:84869822-84869844 GGCACATTTTTAAACTTAGCAGG - Intergenic
1028515627 7:91675065-91675087 GGCACATTTGGAATTCCAGAAGG - Intergenic
1028730720 7:94145589-94145611 GTCAAATTTTAAAATTCAGAAGG - Intergenic
1035636290 8:1146986-1147008 GGCAGATTTTAAAATTCATCTGG - Intergenic
1036411880 8:8509626-8509648 GGCAGATGTTGAATTTCAGCTGG - Intergenic
1037571515 8:20161953-20161975 GGCATCTTTTGAAATTTAGGTGG + Intronic
1038604317 8:28983320-28983342 GGCAAATAGTGAAATTCAGCTGG - Intronic
1039014150 8:33127530-33127552 TGCAGATTTTTAAATTCAGTAGG - Intergenic
1040125206 8:43729341-43729363 TACATATTTTTAAATTCAGCAGG + Intergenic
1040713968 8:50224837-50224859 GGAACATTTTAAAATACATCAGG - Intronic
1043542198 8:81276683-81276705 GGCACAGCTTGAAATGGAGCGGG - Intergenic
1046126878 8:109921008-109921030 GGGACATTTTGAAATTGTGGAGG - Intergenic
1047035621 8:120935484-120935506 GGCACATCTTAAATTGCAGCAGG - Intergenic
1047624378 8:126641033-126641055 GGCAAAGATGGAAATTCAGCTGG + Intergenic
1056064921 9:82924094-82924116 GGTTCATTTTGCAAATCAGCTGG - Intergenic
1058475654 9:105329837-105329859 GCCATATTTTGAAATTGAGTAGG - Intronic
1059843882 9:118249355-118249377 GGCACATTCTGGAAGTTAGCAGG - Intergenic
1060959948 9:127673309-127673331 GGCAGATGTTAAAATTCTGCTGG - Intronic
1186133985 X:6499317-6499339 GGCACATTTTATAATTCTGGTGG - Intergenic
1186775995 X:12865212-12865234 GGTGCATTTTGGAAATCAGCTGG - Intergenic
1188888694 X:35582818-35582840 GGGGCATTTTGAGCTTCAGCTGG - Intergenic
1192549344 X:72041686-72041708 AGCAGATTTTGAAAGTCAGGTGG - Intergenic
1192797390 X:74435185-74435207 GGCACATGATGAAATTCAATTGG - Intronic
1193978241 X:88150043-88150065 GGCATCCTTTGAAATTCAGGTGG + Intergenic
1195152060 X:102082175-102082197 GGCACATTTGGAAGTTGGGCAGG - Intergenic
1197227988 X:123973215-123973237 GGCTCATTGTTAAAATCAGCTGG + Intronic
1197524702 X:127547199-127547221 GTGACATTTTGAAATTTAGAGGG + Intergenic