ID: 1128182885

View in Genome Browser
Species Human (GRCh38)
Location 15:65620581-65620603
Sequence GTCTTATTATCATGGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128182885_1128182892 9 Left 1128182885 15:65620581-65620603 CCAGAATCCCATGATAATAAGAC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 51
1128182885_1128182890 4 Left 1128182885 15:65620581-65620603 CCAGAATCCCATGATAATAAGAC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1128182890 15:65620608-65620630 GAAACTGGGTTTACCCCCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 107
1128182885_1128182893 16 Left 1128182885 15:65620581-65620603 CCAGAATCCCATGATAATAAGAC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1128182893 15:65620620-65620642 ACCCCCAGCGGGTAGGATTTAGG 0: 1
1: 0
2: 0
3: 2
4: 48
1128182885_1128182889 -10 Left 1128182885 15:65620581-65620603 CCAGAATCCCATGATAATAAGAC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1128182889 15:65620594-65620616 ATAATAAGACAGAAGAAACTGGG 0: 1
1: 1
2: 1
3: 60
4: 677
1128182885_1128182891 5 Left 1128182885 15:65620581-65620603 CCAGAATCCCATGATAATAAGAC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1128182891 15:65620609-65620631 AAACTGGGTTTACCCCCAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 77
1128182885_1128182898 28 Left 1128182885 15:65620581-65620603 CCAGAATCCCATGATAATAAGAC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1128182898 15:65620632-65620654 TAGGATTTAGGTTAGACACCAGG 0: 1
1: 1
2: 4
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128182885 Original CRISPR GTCTTATTATCATGGGATTC TGG (reversed) Intronic
910823444 1:91377764-91377786 GTCTTAGTTTCCTGGGTTTCAGG - Intronic
911080001 1:93919278-93919300 GTATTATTTTCAAGGGATTTAGG - Intergenic
911990654 1:104692990-104693012 GTGTTAAAATCATGGGATCCTGG - Intergenic
915825754 1:159074413-159074435 GTCTTTTTAACATATGATTCTGG - Intronic
919337894 1:196264311-196264333 GTCTTATTATACTAGAATTCTGG + Intronic
920082149 1:203382600-203382622 GTCCTACTGTCATGGGATTACGG + Intergenic
922648552 1:227317884-227317906 GTCCTATTTTCAACGGATTCCGG + Exonic
1063386803 10:5620894-5620916 ATCTTAGTATCTTGGAATTCTGG - Intergenic
1063552640 10:7047637-7047659 TTCTTATTTTCAGGGGCTTCAGG + Intergenic
1064196733 10:13249816-13249838 GTCTTAACAGCATGAGATTCTGG + Intergenic
1069404288 10:68081782-68081804 ATCTCATTAGCCTGGGATTCTGG + Intergenic
1070084539 10:73223864-73223886 GGTTTATTATTATGGGAGTCTGG - Intronic
1078426910 11:11259212-11259234 TTCTTATTATCATCTGCTTCTGG - Intergenic
1079947133 11:26758149-26758171 ATCTTCTTAGCCTGGGATTCAGG - Intergenic
1080147573 11:29005668-29005690 GTCAACTTATCATGGGATACAGG - Intergenic
1080409433 11:32009876-32009898 GTCTCATAGTCATGGAATTCTGG + Intronic
1081318133 11:41656475-41656497 GTCTTATTAGCATGGTTTTTTGG + Intergenic
1082032049 11:47611930-47611952 ATCTTATAATCATGGGACACTGG + Intergenic
1085166676 11:74407295-74407317 ATGTTATTATCTTGGGGTTCTGG + Intergenic
1086205579 11:84254579-84254601 GTCTTGGTATCATGAGATTTTGG - Intronic
1091871472 12:3894772-3894794 CTCTTATTATCCTGGGAGGCAGG - Intergenic
1093540711 12:20281041-20281063 GTCTTATAATCATAGAACTCTGG + Intergenic
1095829189 12:46565550-46565572 TTCTTATTATGAAGGGATGCTGG + Intergenic
1097725647 12:63073007-63073029 GTCTTATCATAATGGAATTTGGG + Intergenic
1099251649 12:80263014-80263036 TTATTATTAACATAGGATTCTGG + Intronic
1099971758 12:89507367-89507389 ATTTTATTATCATGGTATTAGGG - Intronic
1101708341 12:107241704-107241726 ATGTTATTGTCCTGGGATTCTGG - Intergenic
1104315969 12:127702005-127702027 ATCTTATTGGCATGGGACTCTGG + Intergenic
1106659118 13:31779942-31779964 TTCTTATTCTCATGGTGTTCAGG - Intronic
1107320839 13:39186270-39186292 GTCTTATGATCATTGACTTCAGG + Intergenic
1107938925 13:45367350-45367372 ATTTTATTATCATGGGATTATGG + Intergenic
1108877639 13:55066879-55066901 TTCTTATCATCATGGAATTTTGG - Intergenic
1111334849 13:86806730-86806752 CTCTTCGTATCATGGGATTAAGG - Intergenic
1111340613 13:86881274-86881296 GTCTAATTATCATGGAGTTAAGG + Intergenic
1113428449 13:110229503-110229525 CTTTTATTATCCTGGGATGCAGG - Intronic
1115109545 14:29804965-29804987 GTGTTATTAAAATGGAATTCAGG + Intronic
1117021347 14:51573949-51573971 AACTAATTATTATGGGATTCTGG - Intronic
1118093430 14:62509038-62509060 TTCCTGTTATCATGGGATTTGGG - Intergenic
1118133101 14:62989816-62989838 GTTTTATTATCATTGGTTTTTGG + Intronic
1120042168 14:79766539-79766561 GTCTTGTCATCATTGCATTCTGG + Intronic
1120674019 14:87397922-87397944 TTCTTATTTTCTTGGGATTCTGG - Intergenic
1122887185 14:104715292-104715314 GTTTTATTATCATCAGAATCAGG - Exonic
1127510261 15:59633970-59633992 GTCTTACTATCATGGCATGTTGG - Intronic
1128182885 15:65620581-65620603 GTCTTATTATCATGGGATTCTGG - Intronic
1130308297 15:82730275-82730297 GGCTTGTTATCATGGGAGTGAGG + Intergenic
1134051290 16:11139352-11139374 GTATTTTAGTCATGGGATTCTGG - Intronic
1138939043 16:61767424-61767446 GTATTATTATCCTGCGTTTCAGG - Intronic
1142046761 16:87930492-87930514 GTCTGATGTTGATGGGATTCAGG - Intronic
1143088251 17:4433130-4433152 GTCTTCTCATGATGAGATTCCGG + Intergenic
1149221933 17:54425052-54425074 CTCTTATTATCATGGGGATGGGG - Intergenic
1150612436 17:66744728-66744750 GATTTATTATCATGTGGTTCCGG + Intronic
1153753343 18:8256025-8256047 GTGTTATTCTCATGAGAATCTGG + Intronic
1157881447 18:51324817-51324839 GTCTTATTTTTAGGGGACTCTGG + Intergenic
1158458943 18:57630822-57630844 GGCTTATTGGCATGGGATTGTGG + Intergenic
1159385102 18:67713316-67713338 ATAATATTTTCATGGGATTCTGG + Intergenic
1164534231 19:29073148-29073170 GTCTCACCATCATGGGATTCTGG - Intergenic
1166486419 19:43217624-43217646 GTCTTTTTAACATGTGATACCGG + Intronic
1167198308 19:48046128-48046150 GTCTGATTATGATGAGATTCAGG - Intergenic
925014429 2:511031-511053 GTCTTGTTGTCATGTGATCCAGG + Intergenic
936702456 2:115029684-115029706 TTTTTATCATCTTGGGATTCTGG + Intronic
938186835 2:129239581-129239603 GTCATATTAGCATGGCTTTCTGG - Intergenic
939183949 2:138838578-138838600 GCTTTATTTTCATGGGGTTCAGG + Intergenic
939285691 2:140126168-140126190 GTCTTATGATCTTGGGATGGGGG + Intergenic
941371966 2:164676718-164676740 GTCTGATTTTGATGGGATTCTGG - Intronic
942920096 2:181362840-181362862 TTCTTTTCATCATGTGATTCTGG - Intergenic
1169735241 20:8830827-8830849 GTCTGAAAATCAAGGGATTCTGG - Intronic
1175125698 20:56750017-56750039 GTCTTCTTCTCAAGAGATTCAGG + Intergenic
1176654321 21:9576325-9576347 ATCTTATTTTGGTGGGATTCTGG - Intergenic
1179784696 21:43722755-43722777 GTCCACTTAACATGGGATTCAGG + Intronic
1183864366 22:40692570-40692592 GTCTTGTTATCATAGGAGTGAGG + Intergenic
957715489 3:83924995-83925017 GTGTTATTATTAGGGGATACTGG - Intergenic
958596302 3:96228515-96228537 ATTTTATTATCATGGAACTCAGG - Intergenic
961972848 3:130988790-130988812 GTCTTGTTATCACAGGATTAAGG - Intronic
963890074 3:150625411-150625433 GTGATATTATCATAGGTTTCTGG - Intronic
964896240 3:161599692-161599714 GTCTTGTTTTCATGAGAATCTGG + Intergenic
965187750 3:165487376-165487398 TTTTTATTTTAATGGGATTCAGG + Intergenic
965359789 3:167724745-167724767 GTCTTATTATCACTGAATTTTGG - Intronic
966492712 3:180546192-180546214 TTTTTATTATCAAGGGATTTTGG - Intergenic
968199266 3:196738709-196738731 GACTTTTTACCATGGCATTCAGG + Intergenic
968383608 4:116361-116383 GACTTTTTATCATGGGTTTGGGG + Intergenic
971851020 4:31986517-31986539 GTCATTTAATCATGAGATTCTGG - Intergenic
979253342 4:118587842-118587864 TTCTTATTTCCAGGGGATTCAGG - Intergenic
981194644 4:141904255-141904277 ATCTTAATATCACGGGAGTCAGG - Intergenic
983721008 4:170851403-170851425 GTTTTCTTATCATTGGATTCAGG - Intergenic
989731931 5:44659343-44659365 GTGTTAAACTCATGGGATTCTGG + Intergenic
998749462 5:145302928-145302950 GTATTACAATCATGGGATTTGGG + Intergenic
1004140711 6:13014506-13014528 CTCCTATTATGATGGGATACAGG + Intronic
1004502400 6:16220567-16220589 GTCTTATTAAAATGAGATTGAGG - Intergenic
1005412703 6:25567194-25567216 GTCTTTGTTTCCTGGGATTCAGG - Intronic
1006832071 6:36974786-36974808 GTCTTTATATCATGGTTTTCCGG - Intronic
1009471834 6:64035891-64035913 ATCTTATTAAAATTGGATTCTGG + Intronic
1010581213 6:77598365-77598387 GTGTTCTTCTCATGTGATTCTGG - Intergenic
1012509189 6:99982964-99982986 GTCTTATTATTATTAGAGTCAGG + Intronic
1013795487 6:113883476-113883498 GTCTTAATTTTATGGGATCCTGG + Intergenic
1023302234 7:38785089-38785111 GTCTTATTCCCAAGAGATTCTGG + Intronic
1023620054 7:42061856-42061878 GTCTTGTTATCATGGCCTTCGGG + Intronic
1024425773 7:49225169-49225191 TTCTTATCATTATGGGATTCTGG - Intergenic
1026119730 7:67526189-67526211 GCCTTATTATCATTAGATTCTGG - Intergenic
1028829544 7:95312563-95312585 GTATTATCTTCATGGGAGTCAGG + Intronic
1033614950 7:143004976-143004998 GTCTTAATACCATAGGATCCAGG + Intergenic
1036049468 8:5179830-5179852 GTCTGATTAAGATGGGACTCAGG + Intergenic
1036623998 8:10450357-10450379 ATCTGATTATCATGGAATTGAGG + Intergenic
1038508189 8:28104641-28104663 GTTTTCTCATCATGAGATTCAGG + Intronic
1038522510 8:28245323-28245345 GTCTTGTTATCATAGGAGCCAGG - Intergenic
1039543774 8:38392609-38392631 GTCTTATTTAAATGGGAATCTGG - Exonic
1045218690 8:100175685-100175707 GTCTTGAACTCATGGGATTCTGG + Intronic
1049983522 9:926816-926838 ATGTTATCTTCATGGGATTCAGG + Intronic
1058193775 9:101950474-101950496 CTCTCACTATCATGGGATTGTGG - Intergenic
1061832139 9:133303056-133303078 GTCTTGTTATCACGGGAGTGAGG - Intergenic
1187722549 X:22166317-22166339 GGCTTGTTAACATGGCATTCAGG + Intronic
1187981944 X:24766730-24766752 GCCTTATTATTATAGGATTTTGG + Intronic
1188184494 X:27097374-27097396 GACTTATTATCATAGCATTTGGG + Intergenic
1188342237 X:29018413-29018435 ATTTTGTCATCATGGGATTCTGG + Intronic
1193322347 X:80137634-80137656 GTCTTATCATCAGAGTATTCAGG + Intergenic
1193630005 X:83873255-83873277 GTCTTAGAATTTTGGGATTCTGG - Exonic
1194586063 X:95735726-95735748 GTCTTAAAATCATGGAATTTGGG + Intergenic
1195785505 X:108516352-108516374 TTCTTATTATCATGGTACTGTGG + Intronic
1197669124 X:129256312-129256334 GTCTCCTTATGATTGGATTCAGG + Intergenic
1200914242 Y:8557361-8557383 CTCTTTTTATCCTGGGACTCTGG - Intergenic