ID: 1128182886

View in Genome Browser
Species Human (GRCh38)
Location 15:65620588-65620610
Sequence TTCTTCTGTCTTATTATCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3063
Summary {0: 1, 1: 0, 2: 2, 3: 875, 4: 2185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128182886_1128182890 -3 Left 1128182886 15:65620588-65620610 CCCATGATAATAAGACAGAAGAA 0: 1
1: 0
2: 2
3: 875
4: 2185
Right 1128182890 15:65620608-65620630 GAAACTGGGTTTACCCCCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 107
1128182886_1128182891 -2 Left 1128182886 15:65620588-65620610 CCCATGATAATAAGACAGAAGAA 0: 1
1: 0
2: 2
3: 875
4: 2185
Right 1128182891 15:65620609-65620631 AAACTGGGTTTACCCCCAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 77
1128182886_1128182892 2 Left 1128182886 15:65620588-65620610 CCCATGATAATAAGACAGAAGAA 0: 1
1: 0
2: 2
3: 875
4: 2185
Right 1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 51
1128182886_1128182893 9 Left 1128182886 15:65620588-65620610 CCCATGATAATAAGACAGAAGAA 0: 1
1: 0
2: 2
3: 875
4: 2185
Right 1128182893 15:65620620-65620642 ACCCCCAGCGGGTAGGATTTAGG 0: 1
1: 0
2: 0
3: 2
4: 48
1128182886_1128182898 21 Left 1128182886 15:65620588-65620610 CCCATGATAATAAGACAGAAGAA 0: 1
1: 0
2: 2
3: 875
4: 2185
Right 1128182898 15:65620632-65620654 TAGGATTTAGGTTAGACACCAGG 0: 1
1: 1
2: 4
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128182886 Original CRISPR TTCTTCTGTCTTATTATCAT GGG (reversed) Intronic
Too many off-targets to display for this crispr