ID: 1128182887

View in Genome Browser
Species Human (GRCh38)
Location 15:65620589-65620611
Sequence TTTCTTCTGTCTTATTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 876
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 810}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128182887_1128182893 8 Left 1128182887 15:65620589-65620611 CCATGATAATAAGACAGAAGAAA 0: 1
1: 0
2: 4
3: 61
4: 810
Right 1128182893 15:65620620-65620642 ACCCCCAGCGGGTAGGATTTAGG 0: 1
1: 0
2: 0
3: 2
4: 48
1128182887_1128182892 1 Left 1128182887 15:65620589-65620611 CCATGATAATAAGACAGAAGAAA 0: 1
1: 0
2: 4
3: 61
4: 810
Right 1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 51
1128182887_1128182891 -3 Left 1128182887 15:65620589-65620611 CCATGATAATAAGACAGAAGAAA 0: 1
1: 0
2: 4
3: 61
4: 810
Right 1128182891 15:65620609-65620631 AAACTGGGTTTACCCCCAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 77
1128182887_1128182890 -4 Left 1128182887 15:65620589-65620611 CCATGATAATAAGACAGAAGAAA 0: 1
1: 0
2: 4
3: 61
4: 810
Right 1128182890 15:65620608-65620630 GAAACTGGGTTTACCCCCAGCGG 0: 1
1: 0
2: 0
3: 10
4: 107
1128182887_1128182898 20 Left 1128182887 15:65620589-65620611 CCATGATAATAAGACAGAAGAAA 0: 1
1: 0
2: 4
3: 61
4: 810
Right 1128182898 15:65620632-65620654 TAGGATTTAGGTTAGACACCAGG 0: 1
1: 1
2: 4
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128182887 Original CRISPR TTTCTTCTGTCTTATTATCA TGG (reversed) Intronic
900010039 1:98239-98261 TTACTTCTGTCATATTAGGATGG - Intergenic
900026151 1:274823-274845 TTACTTCTGTCATATTAGGATGG - Intergenic
900035933 1:408676-408698 TTACTTCTGTCATATTAGGATGG - Intergenic
900057556 1:644427-644449 TTACTTCTGTCATATTAGGATGG - Intergenic
900729381 1:4244188-4244210 TTTCTTCTGTGTTATCTTCTAGG + Intergenic
901093336 1:6658487-6658509 TTTCTTCTGTCATGTTTACATGG - Intronic
901301804 1:8205089-8205111 TGTCTTCTGTCTTCCTGTCAAGG + Intergenic
901941998 1:12669520-12669542 CTGCTTCTGACTTATTATCTTGG - Intergenic
901984770 1:13066324-13066346 TTTCTTTTGTCTTATTGACCTGG + Intronic
901997040 1:13160446-13160468 TTTCTTTTGTCTTATTGACCTGG - Intergenic
902246244 1:15122667-15122689 TTTCTCCTGTCTGAATATCAGGG - Intergenic
903272565 1:22199635-22199657 TTTCTCCTGTTTTATTTTCTAGG + Intergenic
903837763 1:26216703-26216725 TTTCTCCTGTCTTATAAACTAGG - Intergenic
904967275 1:34384806-34384828 TTTCGTCTCTCTTGTTATCTTGG - Intergenic
905162463 1:36048559-36048581 TTCCTTTCTTCTTATTATCATGG - Intronic
906175577 1:43768914-43768936 TTTCTTCAGTTTTGGTATCAAGG - Intronic
906310085 1:44747710-44747732 TTTCTACTAGCTTACTATCATGG + Intronic
906326455 1:44849168-44849190 TTTCCTCTGTCTCACTGTCAGGG + Intergenic
906552893 1:46680909-46680931 TTTCTTCTGGCATTTTCTCAAGG + Intronic
906814642 1:48866524-48866546 ACTGTTCTGTCTTATGATCATGG - Intronic
906842512 1:49155116-49155138 TTTCTTCTCTTTCATTAGCAAGG - Intronic
907811637 1:57876790-57876812 TTTCTCCTGTCTTCTTTTCTTGG - Intronic
908546766 1:65169794-65169816 TTTCTGCAGTTTTTTTATCATGG + Intronic
909891409 1:81012241-81012263 TTTCTTATTTCTTATAATAAAGG - Intergenic
910233723 1:85012665-85012687 TTCCTCCTGTGTTATTATCTAGG + Intronic
911350556 1:96748358-96748380 TTTCTTGTTTTTTATTCTCATGG - Intronic
911440895 1:97924344-97924366 TTTCCGCTGTCTGATTTTCAAGG + Intergenic
911545291 1:99208895-99208917 TTTAATCTGTCTTATTACAAAGG - Intergenic
912077120 1:105888964-105888986 TATCTTGTGTCTCATTCTCATGG + Intergenic
912088967 1:106046356-106046378 TATTTTCTGTTTTATTATCTAGG - Intergenic
912821156 1:112868801-112868823 TTTCTCCTGTCTTATAAACTAGG - Intergenic
913391877 1:118322858-118322880 TTTATTCTGTGTCATTCTCAGGG + Intergenic
914862237 1:151396426-151396448 TGTCTTATGTCTTGTTCTCACGG + Intergenic
915430358 1:155861112-155861134 TTTCTTCTTCCTTATTCTGAGGG - Intronic
916229490 1:162526045-162526067 TTTTTTCTGTCTTATTACACTGG + Exonic
916393156 1:164355288-164355310 TTTCTTCTATGTTTTTTTCAGGG - Intergenic
916823205 1:168419964-168419986 TTTCGTCTGAGTTATCATCAAGG - Intergenic
917125416 1:171683190-171683212 TTTCTGCTGGCTTCTTTTCAGGG + Intergenic
917223922 1:172761612-172761634 ATTTTTCTGTCTTATGACCAAGG + Intergenic
917345331 1:174022761-174022783 TTTCTTCTTCCATATTATCCAGG + Intergenic
917955719 1:180095669-180095691 TTTCTTCTGCCTTATTTTTTTGG - Exonic
918556093 1:185800827-185800849 TTTCTTCTGTCTTATATTTGTGG + Intronic
918569597 1:185973658-185973680 TTTCCTATTACTTATTATCATGG + Intronic
918827128 1:189338578-189338600 TTTTTTTTTTCTAATTATCAAGG - Intergenic
918833535 1:189429993-189430015 TTTCTTCTGATTTATTATCTTGG - Intergenic
918892856 1:190297836-190297858 TTTCTTCTGGTTTGTTATCAGGG + Intronic
919167000 1:193907941-193907963 TTTCTTCTTTCCTGTTTTCATGG + Intergenic
919953180 1:202385741-202385763 TTTCCTTTGTCATATTATTATGG + Intronic
921612342 1:217227406-217227428 TTTCATATGTCTTCTTATAAAGG + Intergenic
921641781 1:217563444-217563466 TTTTTTCTGTCTCACTATCATGG - Intronic
922258471 1:223914244-223914266 TTACTTCTGTCATATTAGGATGG - Intergenic
922300437 1:224294701-224294723 TGTCTTTTCTCTTATTACCATGG - Intronic
922341415 1:224658661-224658683 TCTTTGCTGTCTTATTATCTGGG - Intronic
922673282 1:227531766-227531788 GTTGTTCTGTCATATTACCAGGG + Intergenic
923239319 1:232065562-232065584 ATTCTTTTGTCTTATTATATTGG - Intergenic
924109297 1:240682091-240682113 TATCTCCTGTTTTATTTTCAGGG - Intergenic
924339666 1:243017006-243017028 TTACTTCTGTCATATTAGGATGG - Intergenic
1062951891 10:1509884-1509906 TTTCTTCTTTCTTTATGTCAAGG + Intronic
1063013983 10:2056345-2056367 ATTATTATATCTTATTATCAAGG + Intergenic
1063498516 10:6531761-6531783 TATTTCCTGTCTTATTATAATGG - Intronic
1063760940 10:9075882-9075904 TTTCTTCTGTTTTATGCACAGGG - Intergenic
1063789734 10:9429219-9429241 TTTCTTTTTTTTTATTATTATGG - Intergenic
1063812434 10:9727392-9727414 TTTTTTCTTTCATTTTATCATGG - Intergenic
1064565317 10:16633497-16633519 TTTAGTCTTTCTTCTTATCATGG + Intronic
1064791800 10:18965048-18965070 CTTTTTCTCTCTTTTTATCATGG - Intergenic
1064816784 10:19274454-19274476 TCTCTCCTGTCTTTTTATAAAGG - Intronic
1064846058 10:19654792-19654814 TTTCTTGTGTCTAATTCTCTTGG - Intronic
1064897050 10:20249124-20249146 ATTTTTCTGTTTTATTATGATGG + Intronic
1064978043 10:21138433-21138455 TTTCTTCTAGCTTGTAATCATGG - Intronic
1065059352 10:21882355-21882377 TATATTCAGTCTTATGATCATGG - Exonic
1065584305 10:27202840-27202862 GTTCTTCTTTCCTATTACCAGGG + Intronic
1065608876 10:27450443-27450465 TCTCTTCTGTGGAATTATCAGGG + Intergenic
1065750475 10:28881792-28881814 TTTGTTCAGTTTTATTATCAAGG - Exonic
1065906050 10:30253110-30253132 TGTCTTCTGTGTTTTTTTCATGG + Intergenic
1067898080 10:50207209-50207231 TTTCTTCTTTCTTAATATATGGG - Intronic
1068121295 10:52784601-52784623 TTTCTTGTCTCTTCTTATAAGGG + Intergenic
1069329175 10:67270828-67270850 TTTCTTTGTTGTTATTATCAAGG - Intronic
1070488917 10:76957441-76957463 TTTGTTCTCTCTTAATCTCATGG - Intronic
1071099529 10:82018930-82018952 TTTCTCCTGTCTTATTGCCCTGG + Intronic
1071720802 10:88144241-88144263 TTTCTTCTGGCTTTCTCTCATGG + Intergenic
1071924228 10:90387227-90387249 TTTCTTGTGTCCTCTTATTAGGG - Intergenic
1072072256 10:91929872-91929894 TTCCTTCTGTCATCTTATAATGG - Intronic
1073235691 10:102013778-102013800 TGTCTTCTGACTTATTATCATGG - Intronic
1073527461 10:104198037-104198059 TTTCTTTTGTATGTTTATCAGGG - Exonic
1073968811 10:109022791-109022813 TTTCTTCTTTCTTTTTTTAATGG + Intergenic
1074091959 10:110268842-110268864 TTGATTCTCTATTATTATCAGGG + Intronic
1074217531 10:111400933-111400955 TTTCTTCTGTTTTCTTCTAAAGG + Intergenic
1074540548 10:114361988-114362010 TTTTTTCTTTCTTATGATAAAGG + Intronic
1074826532 10:117218983-117219005 ATTCTCCTGCCTTATTAGCATGG + Intergenic
1075197936 10:120377556-120377578 TTTCCTCTGTCTTCTGATCTGGG - Intergenic
1076261991 10:129074156-129074178 TTTCTTCTGTTTTCTTATTTAGG - Intergenic
1077986858 11:7361076-7361098 TTTCTTGATTCTTTTTATCAAGG + Intronic
1078018341 11:7634474-7634496 TTTCTTTTGTGTTTTTTTCAGGG + Exonic
1078193297 11:9111641-9111663 TTGCTTCTGTCTTGCTACCATGG + Intronic
1078841239 11:15077080-15077102 TTTCTTCTTTCTTTTCATGATGG + Intronic
1079048583 11:17131923-17131945 TTTCTTCTATCTTATTAAATGGG - Exonic
1079486093 11:20937328-20937350 TTTCTTCTTCCTTGTGATCATGG - Intronic
1079874498 11:25839571-25839593 TTTCTTGTTTCTTATCATAAAGG + Intergenic
1080203095 11:29696667-29696689 GATCTTCTGTCTTATTTTCTTGG + Intergenic
1080374748 11:31695151-31695173 TTTCTCCTGCCTGATTGTCATGG + Intronic
1080707288 11:34708389-34708411 TTTCTTCTTTCTTGTTATTTTGG + Intergenic
1080942019 11:36929565-36929587 TTTCTTCTGCTTAATTAGCATGG + Intergenic
1080977790 11:37363578-37363600 TTTCTTCATCCTTATCATCAAGG - Intergenic
1081074813 11:38658306-38658328 TTTCTTGTGTCTTCCTACCATGG - Intergenic
1081278915 11:41184262-41184284 TTTTTCCTGTCATATTGTCAGGG + Intronic
1082286769 11:50326097-50326119 TTTCTCCTGTCTGATTGTCCTGG + Intergenic
1082300378 11:50497681-50497703 TTTCTCCTGCCTAATTATCCTGG - Intergenic
1082582135 11:54884733-54884755 TTTCTTCTGTTTTTTTATACTGG - Intergenic
1082968398 11:58992584-58992606 TTTCTTCAGACTTGTTATCATGG - Intronic
1083957314 11:65991817-65991839 GTTCTTCAGTCATATTTTCAAGG - Intergenic
1083958526 11:66000712-66000734 TTTCTCCTGTCTTATAAACTAGG - Intronic
1086094753 11:83039364-83039386 TTTCTTAGGACTTTTTATCATGG - Intronic
1087731644 11:101784849-101784871 TTTCTCTTGTCTTATTTTCCTGG + Intronic
1087991914 11:104754869-104754891 TGTCTTCTGTCTCATTACCATGG + Intergenic
1088384189 11:109234770-109234792 TTTTTTCTATATTATTAGCATGG - Intergenic
1088630758 11:111771877-111771899 TTTCTTCTGTGTTTTCTTCATGG + Intergenic
1088760397 11:112923942-112923964 TTTCTGTTGTCTGATCATCACGG - Intergenic
1088851323 11:113705782-113705804 TTTCTTCTGCCTCAGTACCAAGG + Intronic
1089311137 11:117559015-117559037 TTTCTCCTGTCTTATAAACTAGG + Intronic
1089590902 11:119540227-119540249 TTTCTTCTGTTTCATTATCCTGG - Intergenic
1089659276 11:119975528-119975550 TTTCTTCTGCCTCATTTCCAGGG - Intergenic
1089826194 11:121280501-121280523 CTTGTTCTGTCATATTACCAGGG + Intergenic
1090411406 11:126512246-126512268 GTTCTTGTGTCTTTCTATCAGGG + Intronic
1090756956 11:129801016-129801038 TTTTTTCTCTCTTATTTTCTTGG - Intergenic
1090921563 11:131210767-131210789 TTTATTCTGTGTTATTTTTATGG - Intergenic
1091929931 12:4387850-4387872 TTTCTTTTGTCTTGTTTTAAAGG - Intergenic
1091993113 12:4972908-4972930 CTTTTTATTTCTTATTATCAAGG + Intergenic
1092344463 12:7704051-7704073 TTTCTCCTGTCTTATAAACTAGG + Intergenic
1092804921 12:12212276-12212298 TTGTATCTGTCTTATTACCAAGG + Intronic
1092972921 12:13715777-13715799 TTTATTTTGTTTTATTATCAAGG - Intronic
1093310179 12:17572119-17572141 TTTTTTCTGACATATTATTATGG - Intergenic
1093319071 12:17689953-17689975 TTTCATCTGTTCTATTAACATGG + Intergenic
1093364898 12:18282013-18282035 TATCTTCTTTTGTATTATCAAGG + Exonic
1093824263 12:23663244-23663266 TTTTTTCTGTTTTATTTCCAAGG + Intronic
1094362214 12:29641657-29641679 CTTGTTTTGTCATATTATCAGGG - Intronic
1095050575 12:37550711-37550733 TTTTTTCTGTCTTATATTCAAGG - Intergenic
1095804634 12:46305032-46305054 TTTCTTTTGTCCTATATTCAAGG - Intergenic
1096070454 12:48772542-48772564 TCTCTTCTATCTTCTTACCAGGG - Exonic
1096942565 12:55363772-55363794 TTTCTTTTTTCTTGTTTTCAGGG + Intergenic
1097148239 12:56956564-56956586 ATTCATCTGTCTTATTATAGAGG - Intronic
1097295599 12:57958801-57958823 TTTGTTTTGTCATATTACCAGGG - Intergenic
1097419257 12:59353782-59353804 TTTCTCCTGTCTTATAAACTAGG + Intergenic
1097906391 12:64923985-64924007 TTTCTTCTCTTGTATTCTCAGGG - Intergenic
1098001427 12:65947982-65948004 TTTCTTTTTTCTTTTTTTCAAGG + Intronic
1098612743 12:72481226-72481248 TTTCTTTTTTCTTTTTATCAAGG + Intronic
1098693602 12:73522524-73522546 TTTCTTCTGTCCTCTTTTGAGGG - Intergenic
1098716849 12:73839519-73839541 TTTGTTCTTTCTTCTTATGACGG - Intergenic
1098859058 12:75687386-75687408 TTTCTTTTCTATTAATATCATGG - Intergenic
1098937830 12:76500730-76500752 TTTCTTTTTTCTTATGACCAGGG + Intronic
1099207657 12:79746635-79746657 ATTCTTCAGGCTTATTTTCAAGG - Intergenic
1099782631 12:87217020-87217042 TTTCTTATTGTTTATTATCAAGG + Intergenic
1100336743 12:93638705-93638727 TTTCCTCTCTCTTATATTCATGG - Intergenic
1100617774 12:96244520-96244542 TTTCTTCTGTGTTTTTATTTTGG + Intronic
1102639249 12:114352065-114352087 TTTCTTCTGTCCTATAAGCTTGG + Intergenic
1103175390 12:118858954-118858976 TTCCCTCTGTCTTGTTCTCAGGG - Intergenic
1103995511 12:124827522-124827544 TTTCTCCTGTCTTATAAACTAGG + Intronic
1104526628 12:129530154-129530176 TTTTTTTTGGCTTATGATCAAGG - Intronic
1105090767 13:16285059-16285081 TTGCTTCTGTCTAGTTATTATGG - Intergenic
1105099746 13:16432448-16432470 TTGCTTCTGTCTAGTTTTCATGG - Intergenic
1105106643 13:16545163-16545185 TTGCTTCTGTCTAGTTATTATGG - Intergenic
1105108170 13:16569734-16569756 TTGCTTCTGTCTAGTTTTCATGG - Intergenic
1105108505 13:16575189-16575211 TTGCTTCTGTCTTGTTTTTATGG - Intergenic
1105110430 13:16606558-16606580 TTTCTTCTGTCTAGTTTTGATGG - Intergenic
1105111253 13:16620206-16620228 TTTCTTCTGTCTAGTTTTTATGG - Intergenic
1105115666 13:16692352-16692374 TTGCTTCTGTCTTGTTTTTATGG - Intergenic
1105117254 13:16718269-16718291 TTGCTTCTGTCTTGTTTTTATGG - Intergenic
1105117587 13:16723721-16723743 TTGCTTCTGTCTAATTTTTATGG - Intergenic
1105128016 13:16893937-16893959 TTGCTTCTGTCTAGTTTTCATGG - Intergenic
1105132341 13:16964887-16964909 TTGCTTCTGTCTAATTTTTATGG - Intergenic
1105138086 13:17058684-17058706 TTGCTTCTGTCTAGTTATTATGG - Intergenic
1105141142 13:17108992-17109014 TTGCTTCTGTCTAATTTTTATGG - Intergenic
1105142588 13:17132180-17132202 TTTCTTCTGTCTAGTTTTGATGG - Intergenic
1105143349 13:17144462-17144484 TTGCTTCTGTCTTGTTTTTATGG - Intergenic
1105152700 13:17297124-17297146 TTGCTTCTGTCTAGTTTTCATGG - Intergenic
1105158641 13:17394038-17394060 TTGCTTCTGTCTAGTTTTCATGG - Intergenic
1105159384 13:17406314-17406336 TTGCTTCTGTCTAGTTTTCATGG - Intergenic
1106854159 13:33829752-33829774 TTTCTTCCTTCTCATTATCCAGG - Intronic
1107331132 13:39302017-39302039 TTTTTTCTTTCTTATTATCTTGG - Intergenic
1108863609 13:54894478-54894500 TATATTCTTTCTTATTGTCATGG + Intergenic
1108884473 13:55163365-55163387 TTTCCTCTGTCTTTTTGTCTTGG + Intergenic
1108927142 13:55765716-55765738 ATTCTTTTGTTTTATTATCCAGG - Intergenic
1108996303 13:56738152-56738174 TTTCTTCTGTCTGAACATTAAGG - Intergenic
1109047443 13:57431288-57431310 TTTCTCTTGCCTTATTATTATGG - Intergenic
1109079073 13:57875143-57875165 TTTTGTCTGTGTTATTATAAAGG + Intergenic
1109560221 13:64038313-64038335 TTTCATCTGTCTTAGTATTAAGG + Intergenic
1109688541 13:65853718-65853740 TTTCTTCTTACTTATTATAAAGG - Intergenic
1109922683 13:69089431-69089453 TTTCTTCTCTCTTGTCAGCATGG - Intergenic
1110410726 13:75201446-75201468 TTACTTCTTTCTTAATAACAAGG + Intergenic
1110704282 13:78587073-78587095 TTTTTCCTGTCTTATGATTAGGG - Intergenic
1110881657 13:80578720-80578742 TTTGTTTTGTCATATTACCAGGG - Intergenic
1111059995 13:83004534-83004556 TTCCTTCTGTCTTTTGTTCAGGG + Intergenic
1111340612 13:86881266-86881288 TCACTTTTGTCTAATTATCATGG + Intergenic
1111753645 13:92364894-92364916 TTTCTTATTACTTATTCTCATGG - Intronic
1112135084 13:96569217-96569239 TTCTTTCTGTCACATTATCAGGG - Intronic
1112153908 13:96796651-96796673 TTACTTCTGTATGATTATTAAGG - Intronic
1113087031 13:106579277-106579299 TTGCTTCTGTCTAATTCTCTTGG - Intergenic
1113311746 13:109139928-109139950 TTTCTCCTGTCTTATAAACTAGG + Intronic
1113322770 13:109252460-109252482 TGTATGCTATCTTATTATCATGG - Intergenic
1113683898 13:112265207-112265229 TGTCTTCTTTCTTTTTCTCATGG + Intergenic
1114272248 14:21108082-21108104 TTCCTTCTGAATTATTATAATGG - Intergenic
1114442415 14:22760374-22760396 TTTCTTCTATCTTATTAAAATGG + Intergenic
1114922810 14:27355727-27355749 TCTCTTCTGCCTCATGATCATGG + Intergenic
1115421101 14:33196941-33196963 TTTCTTCTCCCTTGTCATCATGG + Intronic
1116140853 14:40992743-40992765 TTTCTTCTTTTTTATTAGCCTGG - Intergenic
1116197638 14:41750209-41750231 TTTCTTCTCTCTTAATGTCATGG + Intronic
1116273514 14:42802085-42802107 TTTCTACTGACTTATTTTCTTGG - Intergenic
1116990349 14:51269388-51269410 TTATTTCTGGCTTATTATAAAGG - Intergenic
1117510689 14:56448212-56448234 CTTGTTTTGTCATATTATCAGGG + Intergenic
1117940781 14:60961684-60961706 TGTTCTCTGTCTTATTATCAGGG + Intronic
1118117193 14:62793308-62793330 TTTCTTCTGTCCTTTTTTCATGG - Intronic
1118344199 14:64923500-64923522 TTTATTTTGTATTATGATCAAGG + Intronic
1119225486 14:72941868-72941890 TTTCCTGTTTCTTATTTTCATGG + Intronic
1120211802 14:81641138-81641160 TTTCTCCTGTCTTATAAACTAGG + Intergenic
1120784795 14:88523311-88523333 TTTCTTTTGTCTTAGTAATATGG - Intronic
1121266918 14:92610262-92610284 TTTTTTCTTTCTTTTTATAATGG - Intronic
1121378784 14:93441781-93441803 TATTTTCTTTCTTATAATCATGG + Intronic
1121612138 14:95288704-95288726 TTTCTTCTGGCTTATACACAGGG - Intronic
1122085441 14:99298278-99298300 TTTTTTCTCTCTTTTTATCTTGG - Intergenic
1122359045 14:101147629-101147651 TTTCTTTTGTTTTGGTATCAGGG + Intergenic
1122443748 14:101753976-101753998 TTTCTCCTGTCTTATAAACTAGG - Intergenic
1202871568 14_GL000225v1_random:169842-169864 TTTCTTCTGTATTATTAGACGGG - Intergenic
1124046160 15:26152009-26152031 TTTCTTTTGTCTGATTGCCATGG + Intergenic
1124180335 15:27467218-27467240 TTTCATATCTCTTATTATAATGG + Intronic
1125827277 15:42687083-42687105 TTTCTTCTGTAATATTTCCAGGG - Exonic
1126029338 15:44480828-44480850 TTTCTTTTTTCTTTTTTTCATGG - Intronic
1126273252 15:46846472-46846494 TTTCTTCTGATTTATGAACATGG + Intergenic
1126602077 15:50439130-50439152 TAACTTCTGTCTTCTTATTAAGG - Exonic
1126919016 15:53499619-53499641 TTTCTTCTAAATTATTAGCAAGG + Intergenic
1126926068 15:53587905-53587927 TTTCTTGTAGCTTATTCTCAGGG + Intronic
1126932106 15:53665814-53665836 TTTGTTCTGTCTTATTCTGTTGG - Intronic
1127828297 15:62725972-62725994 TTTCTTCTTTTTTACTATTAGGG - Intronic
1128182887 15:65620589-65620611 TTTCTTCTGTCTTATTATCATGG - Intronic
1128585928 15:68850093-68850115 TCTCTTCTGTCTCATTGTAATGG - Intronic
1128638561 15:69318794-69318816 ATTGTTCTGTTTTATTATTATGG - Intronic
1130192954 15:81753762-81753784 TTTCTTTTCTCTCATTTTCATGG - Intergenic
1130387194 15:83422303-83422325 TTTTTTCTGCCTTATGATCCTGG + Intergenic
1130689550 15:86069764-86069786 GATCTTCTGTCTTATGATTATGG - Intergenic
1131806912 15:96132062-96132084 TTTCTGCTCTGTTATTCTCAAGG - Intergenic
1131913500 15:97235196-97235218 TTTCTGCTGTCATAATATGATGG + Intergenic
1132052567 15:98619120-98619142 TTAGTTCTGTTTTGTTATCAAGG + Intergenic
1132172745 15:99678372-99678394 TTTATTCTGTATTATAAGCATGG + Intronic
1133010406 16:2907398-2907420 TTTCTCCTGTCTTATAAACTAGG - Intergenic
1133078620 16:3300111-3300133 TTTCTCCTCTTTGATTATCATGG + Exonic
1133661914 16:7926691-7926713 TTTTTTTTGTCTTTTTGTCAGGG - Intergenic
1135433719 16:22410182-22410204 TTTCTCCTGTGTTATTTTCTAGG + Intronic
1135838271 16:25848803-25848825 TTTCTTCAGTTTTTTTATTATGG + Intronic
1136681128 16:31963110-31963132 TTTCTTCTCTCTCATTATTCAGG + Intergenic
1136796017 16:33020533-33020555 TTTCTTCTGCCTGATTGTCCTGG - Intergenic
1136917527 16:34220659-34220681 ATTCTTCTGTCTAATTTTTACGG - Intergenic
1136917933 16:34228836-34228858 ATTCTTCTGTCTTGTTTTTATGG - Intergenic
1136918030 16:34230706-34230728 ATTCTTCTGTCTTGTTTTTATGG - Intergenic
1136918345 16:34236181-34236203 ATTCTTCTGTCTAATTTTAAAGG - Intergenic
1136918381 16:34237035-34237057 ATTCTTCTGTCTAATTTTTATGG - Intergenic
1138944499 16:61831513-61831535 TTTCTTATGTCTCATCATCCAGG + Intronic
1139140760 16:64259841-64259863 TTTGTTCTGTTTTTTTCTCATGG - Intergenic
1139244837 16:65431643-65431665 TCTCATCTGTTTTATTATCTAGG - Intergenic
1140311771 16:73856295-73856317 TTTCTTTTTTCTTATTATCAAGG - Intergenic
1140788562 16:78367524-78367546 TTTTTTCTGTTTTATTCCCAGGG - Intronic
1140971457 16:80017092-80017114 TCTCTTCTTTCCTATTATGATGG + Intergenic
1141321236 16:83011065-83011087 TTTCTTCTGTTTCATGCTCATGG + Intronic
1141898349 16:86972958-86972980 TTTTTTCTCCATTATTATCATGG + Intergenic
1143271641 17:5679930-5679952 TCTCTGCTGTCTTTTCATCATGG - Intergenic
1143627601 17:8119896-8119918 TTTTTTTTGTCGTATTATCTTGG - Intergenic
1143739376 17:8941459-8941481 TTTCATCTGTCTCAGAATCAGGG - Intronic
1143815645 17:9511734-9511756 TTTCTCTTGTCTGATTACCATGG - Intronic
1144571852 17:16405312-16405334 TTTCTCCTGTCTTATAAACTAGG + Intergenic
1145371219 17:22307819-22307841 TTTTTTCTGTCTTACATTCAAGG - Intergenic
1145864365 17:28230929-28230951 TTTCTCCTGTCTTATAAACTAGG + Intergenic
1145865579 17:28239254-28239276 TTTCTCCTGTCTTATAAACTAGG + Intergenic
1146127584 17:30241056-30241078 TATCTTCTGTCTTATAAACTAGG + Intergenic
1147892053 17:43724316-43724338 TTTCTTCTTTCTGCTTAGCAAGG - Intergenic
1147985385 17:44304206-44304228 TTTCTTTTTTCTTTTTTTCAGGG - Intergenic
1148727922 17:49809133-49809155 TTTCTTCTATCTGCTTATCCCGG - Exonic
1149201564 17:54191867-54191889 TCTCTTTTGTCTTCTTAACAGGG + Intergenic
1149401660 17:56302693-56302715 TATACTCTGTCTTATTAACATGG - Intronic
1150464075 17:65377015-65377037 TTTCTCCTTTCTCATTATCTTGG - Intergenic
1150586854 17:66526623-66526645 TTACTTCTGTCTCATTATGTTGG + Intronic
1150891605 17:69157312-69157334 TTTCTTCTGTCTTCTGCTCCTGG - Intronic
1150909594 17:69374246-69374268 TTTCTTGTGTCTTTTCACCACGG - Intergenic
1152833595 17:82514696-82514718 TTCCTTCTTTCTTTTTATCTTGG + Intergenic
1152984393 18:308545-308567 TTTCTCCTGTTTTATTAAAAAGG - Intergenic
1153044280 18:841500-841522 TTTCTCCTGTCTTATAAACTAGG - Intergenic
1155371570 18:25107346-25107368 TTTTTACTTTCTTATTATCTAGG + Intronic
1155697461 18:28699445-28699467 TTTCTCCTGTCTTATAAACTAGG + Intergenic
1156059236 18:33053314-33053336 GTTCTTCTTTATTATTATCTAGG - Intronic
1156787331 18:40931517-40931539 TTTTTTCTTTTTTATTTTCATGG - Intergenic
1157127329 18:44969337-44969359 TTTCTTCTTTTTTAATAACAAGG - Intronic
1157364456 18:47051070-47051092 TCTCTTGTGTCTTGTTATTATGG + Intronic
1158017048 18:52796317-52796339 TTTCTTATGGTTTATCATCATGG + Intronic
1158492423 18:57922054-57922076 TTTAATCTGTCTTGTTATAAAGG - Intergenic
1158969433 18:62652635-62652657 TTTCTCCTGTCTTATAAACTAGG - Intergenic
1159557523 18:69960851-69960873 TTTCTAGTGTCTCACTATCAAGG - Intronic
1159628164 18:70718436-70718458 TTTCTTCTGTCTGATTGCCCTGG - Intergenic
1159863703 18:73680421-73680443 TTTCTTGTGACTTATTTTCCTGG + Intergenic
1159919969 18:74219337-74219359 TTTCTTCAGTCTCATAACCAAGG - Intergenic
1160085130 18:75770182-75770204 TATCTTCTGTCTTCTTAACTGGG + Intergenic
1160215825 18:76929709-76929731 TTTTTTCTCACTTATTATGATGG + Intronic
1160299299 18:77665791-77665813 TTTCGTCTATCTTATTTTCTAGG + Intergenic
1161220787 19:3117151-3117173 TTTCTTCTTTTTTATTCACACGG + Intronic
1163965901 19:20747233-20747255 TTTCTCCTGTCTTATAAACTAGG + Intronic
1163967061 19:20755547-20755569 TTTCTCCTGTCTTATAAACTGGG + Intronic
1165184905 19:34009874-34009896 TTTCTTTTGTAGTATTACCATGG - Intergenic
1165368125 19:35382513-35382535 TTTCTCCTGTCTTATAAACTAGG - Intergenic
1165521615 19:36318774-36318796 TTTTTTCTGTCTTACATTCAAGG - Intergenic
1165634157 19:37326447-37326469 TTTTTTCTGTCTTACATTCAAGG + Intronic
1167826928 19:51982030-51982052 TTTCTTTTTTCTTTTTTTCAGGG - Intronic
1167835735 19:52067944-52067966 TTTTTTCTCTCCTATTATGAGGG - Intronic
1167994105 19:53388731-53388753 TTTCTCCTGTCTTATAAACCAGG + Intronic
925493051 2:4416930-4416952 TTTCTTTTTTATTATTATCTGGG + Intergenic
925640224 2:5979892-5979914 TTGCTTATGTCTTATTATATAGG - Intergenic
926064558 2:9827487-9827509 TTTCTTCTGTTTTTTTTTAAAGG - Intergenic
926603614 2:14874314-14874336 TCTCTTATGTTTTGTTATCAGGG - Intergenic
926865793 2:17356905-17356927 GACCTTCAGTCTTATTATCAAGG + Intergenic
927529613 2:23782821-23782843 TGTCTTCTGATTGATTATCAAGG + Intronic
928849484 2:35727499-35727521 TTGGTTCTGTCTTGCTATCAAGG + Intergenic
928886929 2:36159935-36159957 TTTTTTCTGTCACACTATCAGGG + Intergenic
928996855 2:37302143-37302165 TTTCCTCTTTCTTTTAATCAAGG - Intronic
929900335 2:45995445-45995467 TTTCTTCTATATTATCTTCAAGG + Intronic
930066525 2:47332106-47332128 TTTCTTCTTTTTTTTTTTCAGGG - Intergenic
930356369 2:50325601-50325623 AGTCTACTGTCTTATTCTCATGG + Intronic
930512665 2:52365516-52365538 TTTCTTCTCTTTTCTTTTCAAGG + Intergenic
930941745 2:57022193-57022215 TTTCTCCTGTCTTATAAACTAGG - Intergenic
931090369 2:58879443-58879465 TTCCTACTATCTTATCATCATGG + Intergenic
931312425 2:61094945-61094967 TCTCTTCTTTCTTATTACCTAGG + Intronic
931334393 2:61324408-61324430 TTATTTATGTATTATTATCAGGG - Intronic
931756245 2:65377238-65377260 TTTCTTCTGTCTTTGTATCATGG - Intronic
932214268 2:69956408-69956430 TTTCTTCTTTCTTCTTCACAGGG - Intergenic
933105123 2:78315400-78315422 TTTTTTCTGTATGATTATCAAGG + Intergenic
933499995 2:83099339-83099361 TTTCTTTTCTTTTATTATTATGG - Intergenic
933640778 2:84757152-84757174 ATTTTTCTGTCCTATTCTCATGG - Intronic
934336228 2:92189998-92190020 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934336980 2:92202059-92202081 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934337803 2:92215314-92215336 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934338293 2:92222958-92222980 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934338721 2:92229757-92229779 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934339436 2:92240964-92240986 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934340461 2:92257281-92257303 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934341079 2:92267310-92267332 TTTCTTCTGTCTAGTTTTCAGGG - Intergenic
934341439 2:92272443-92272465 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934341901 2:92279926-92279948 TTGCTTCTGTCTACTTTTCAGGG - Intergenic
934342740 2:92293353-92293375 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934342897 2:92295730-92295752 ATGCTTCTGTCTTGTTTTCAGGG - Intergenic
934343949 2:92312547-92312569 ATACTTCTGTCTTGTTTTCAGGG - Intergenic
934344967 2:92328854-92328876 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934345534 2:92337695-92337717 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934345839 2:92342453-92342475 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934345977 2:92344491-92344513 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934347805 2:92373723-92373745 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934348212 2:92380176-92380198 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934348439 2:92383919-92383941 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934348984 2:92392588-92392610 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934349627 2:92402949-92402971 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934350657 2:92419261-92419283 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934350930 2:92423509-92423531 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934351184 2:92427417-92427439 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934356150 2:92505410-92505432 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934357565 2:92528176-92528198 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934357959 2:92534457-92534479 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934358847 2:92548564-92548586 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934359943 2:92565897-92565919 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934360231 2:92570484-92570506 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934363633 2:92624867-92624889 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934363675 2:92625546-92625568 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934363975 2:92630471-92630493 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934364818 2:92644065-92644087 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934365267 2:92651032-92651054 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934366771 2:92674978-92675000 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934368127 2:92697050-92697072 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934368286 2:92699605-92699627 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934369985 2:92726469-92726491 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934371334 2:92748049-92748071 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934372078 2:92760112-92760134 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934372225 2:92762487-92762509 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934374494 2:92799171-92799193 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934376113 2:92824830-92824852 ATGCTTCTGTCTAATTTTCAGGG - Intergenic
934376349 2:92828575-92828597 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934377535 2:92847598-92847620 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934377605 2:92848783-92848805 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934379292 2:92875630-92875652 ATGCTTCTGTCTAATTTTCAGGG - Intergenic
934380918 2:92901357-92901379 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934381781 2:92915460-92915482 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934383286 2:92939908-92939930 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934385106 2:92969311-92969333 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934388562 2:93025330-93025352 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934391552 2:93073551-93073573 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934391742 2:93076610-93076632 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934395453 2:93136685-93136707 ATGCTTCTGTCTAATTTTCAGGG - Intergenic
934396573 2:93154852-93154874 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934397592 2:93171173-93171195 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934398407 2:93184428-93184450 ATGCTTCTGTCTAATTTTCAGGG - Intergenic
934399190 2:93197173-93197195 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934399969 2:93209911-93209933 ATGCTTCTGTCTAATTTTCAGGG - Intergenic
934400082 2:93211779-93211801 ATGCTTCTGTCTTGTTTTCAGGG - Intergenic
934400362 2:93216356-93216378 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934401351 2:93232656-93232678 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934402860 2:93257266-93257288 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934403180 2:93262363-93262385 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934406159 2:93309922-93309944 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934406533 2:93315872-93315894 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934408067 2:93340342-93340364 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934408224 2:93342882-93342904 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934409247 2:93359031-93359053 ATGCTTCTGTCTTGTTTTCAGGG - Intergenic
934411046 2:93387581-93387603 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934417099 2:93486024-93486046 ATACTTCTGTCTTGTTTTCAGGG - Intergenic
934417411 2:93490947-93490969 ATGCTTCTGTCTAGTTATCAGGG - Intergenic
934419030 2:93516608-93516630 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934421332 2:93553476-93553498 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934423933 2:93595276-93595298 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934424671 2:93606705-93606727 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934427728 2:93655930-93655952 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934429617 2:93686157-93686179 ATGCTTCTGTCTAATTTTCAGGG - Intergenic
934431487 2:93716490-93716512 ATGCTTCTGTCTTGTTTTCAGGG - Intergenic
934435308 2:93778298-93778320 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934436571 2:93798666-93798688 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934444051 2:93919595-93919617 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934444518 2:93926890-93926912 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934452713 2:94059477-94059499 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934453672 2:94074916-94074938 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
934455027 2:94146605-94146627 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
934455853 2:94159865-94159887 ATGCTTCTGTCTAGTTATCAGGG - Intergenic
934456108 2:94163945-94163967 ATGCTTCTGTCTAGTTATCAGGG - Intergenic
934505140 2:94884946-94884968 GTTCTTCTGTGTTTTTTTCATGG - Intergenic
935886254 2:107623038-107623060 TTTGTTCTGTTTTATTCACAAGG + Intergenic
936228480 2:110679363-110679385 TTTCTCCTGTCTTATAAACTAGG - Intergenic
936899057 2:117463306-117463328 GTTCTTCTCTCTTCTTTTCATGG + Intergenic
937449473 2:121989948-121989970 TGACTTGTGTCTTATCATCAGGG - Intergenic
937457912 2:122058795-122058817 TTGCTTCTGTCTTATAAAAATGG + Intergenic
937994593 2:127683486-127683508 TTTCTCCTGTCTTATAAACTAGG - Intergenic
938123467 2:128651838-128651860 TTTCTTTGGTTTTAGTATCAAGG + Intergenic
938535819 2:132244591-132244613 ATTCTTCTGTCTAGTTATTATGG - Intronic
940008960 2:149035406-149035428 TTTCTCCTGTCTTATAAACTAGG - Intergenic
940320295 2:152369801-152369823 TTTCTTCTTTCTTTTTAACATGG + Intronic
941318579 2:164026147-164026169 TTTCTTCTGTCTCAGTCTCTAGG - Intergenic
941529445 2:166648192-166648214 TCTCTTTTCTCTTATTTTCAAGG - Intergenic
942369890 2:175272317-175272339 TTTGTTTTGTCTTATTATTAAGG + Intergenic
942465469 2:176203261-176203283 TTGCTTCTGGCTTAGTTTCATGG + Intergenic
942476134 2:176323480-176323502 TTTCTTCTCTGTTAATATTATGG + Intronic
942587768 2:177502902-177502924 TTTCTTTTGTCTTGTTATGCAGG - Intronic
943002066 2:182340697-182340719 TTCCTTCTGTTTTAACATCAGGG - Intronic
943882136 2:193159062-193159084 TTTCAGCTGTCCTATTATAATGG + Intergenic
943958352 2:194223406-194223428 TGTCTTCTGCCTTATTGTCAGGG + Intergenic
944636638 2:201681567-201681589 TTTCTCCTCTCTTATTTTCCAGG - Exonic
944639451 2:201708197-201708219 TTTCTCCTGTCTAGTTACCAAGG + Intronic
944948786 2:204722680-204722702 TTTCTCCTTCCTTATTAACAAGG - Intronic
945386951 2:209212621-209212643 TTTATTCTTTCTTAATATCCTGG + Intergenic
945755591 2:213842347-213842369 TATCTTCTGTTTTATTTTCACGG + Intronic
945850885 2:215005391-215005413 TGTCTTTTGTTTTATTGTCATGG + Intronic
946148579 2:217749027-217749049 TTTGTTCTGTCTCATCAGCAAGG + Intronic
947116245 2:226774166-226774188 TTTATTCTTTCTTACTATAACGG - Intronic
947138469 2:226998573-226998595 TTTCTTCTCTTTTTTTTTCATGG + Exonic
947408110 2:229802459-229802481 TTTCATCTCTGTTATTATAAAGG - Exonic
947541290 2:230981531-230981553 TGTCTCCTGTCTTATCATCTAGG + Intergenic
947594256 2:231400775-231400797 TTTCTCCTGTCTTATAAACTAGG - Exonic
948286065 2:236786301-236786323 TTTTTTCTGCCTTTCTATCATGG - Intergenic
948945974 2:241219036-241219058 TTTCTCCTGTCTTATAAACTAGG + Intronic
949085749 2:242153320-242153342 TTACTTCTGTCATATTAGGATGG + Intergenic
1169015245 20:2287099-2287121 TTTCTTCTCTTTTTTTATGATGG - Intergenic
1169473332 20:5907739-5907761 TTTCCTATGTCTTATTTTCCTGG + Intergenic
1169611903 20:7390510-7390532 TTTCTTCTATTTTATTATAAGGG + Intergenic
1170297350 20:14842550-14842572 TTTGTAATGTCTTATTATTAAGG + Intronic
1170959967 20:21016508-21016530 TTTTTTCTCTCTTATTAACATGG - Intergenic
1171008213 20:21489302-21489324 TTTTTTGTGTCTTTTTATAAGGG + Intergenic
1171248102 20:23629441-23629463 TTTCCTCAGTCTTTTCATCAGGG + Exonic
1171407185 20:24919286-24919308 TTTCTACTGTCTTATAAACTAGG - Intergenic
1171545087 20:25994185-25994207 TTTTTTCTGTCTTATATTCAAGG - Intergenic
1171658826 20:27619071-27619093 ATGCTTCTGTCTAATTTTCATGG - Intergenic
1171697039 20:28190980-28191002 ATTCTTCTGTCTAGTTTTCATGG - Intergenic
1171740848 20:28885613-28885635 TTTCTTCTGTCTTGTTCTTATGG + Intergenic
1172491054 20:35338332-35338354 TTTCTCCTGTCTTATTACCAAGG - Intronic
1173183065 20:40819167-40819189 GTTCTTCTGTCTTATTGGCTGGG - Intergenic
1174980946 20:55393961-55393983 TCTCTTCTAGCTTATGATCATGG + Intergenic
1175562727 20:59944798-59944820 TTTCTTCTGTCCTCATTTCAAGG - Exonic
1176036492 20:63041091-63041113 TGTCTTCTCTCTTTTTTTCATGG + Intergenic
1176422719 21:6529010-6529032 TCTCTTCTCTCTTCTTATAAAGG + Intergenic
1176431042 21:6575891-6575913 TTTCTTGTGTCTCCTCATCAAGG - Intergenic
1176763684 21:12991291-12991313 TTTCTTCTGTCTGGTTTTTATGG + Intergenic
1177207885 21:18031409-18031431 CTTCTTCTCTATTATTACCAAGG - Intronic
1177425137 21:20913104-20913126 TTTCTTATTTCTGATTATTATGG - Intergenic
1177661886 21:24095226-24095248 TTTCTTCTGGCATGTTTTCAGGG + Intergenic
1177951045 21:27538062-27538084 AATCTTCTGTCTTATTTTCATGG - Intergenic
1178240536 21:30894445-30894467 TATATTGTGTCTTAATATCACGG + Intergenic
1178789229 21:35683224-35683246 TTTTTTTTGTCTTGTTATGAAGG - Intronic
1179066314 21:38028043-38028065 TTAATTCAGTCTTATCATCATGG - Intronic
1179698212 21:43137326-43137348 TCTCTTCTCTCTTCTTATAAAGG + Intergenic
1179706436 21:43183353-43183375 TTTCTTGTGTCTCCTCATCAAGG - Intergenic
1180029488 21:45195499-45195521 TTTCTTCTGTGTTATCTTCTAGG + Intronic
1180502196 22:15940654-15940676 ATTCTTCTGTCTAGTTTTCATGG + Intergenic
1180502502 22:15946114-15946136 ATTCTTCTGTCTAGTTTTCATGG + Intergenic
1180502733 22:15950209-15950231 ATTCTTCTGTCTAGTTTTCATGG + Intergenic
1181620002 22:24084557-24084579 TGCCTTCTGTCTTTTTTTCAAGG + Exonic
1181843072 22:25681849-25681871 TTTATTCTGACTTGTAATCAAGG + Intronic
1182195670 22:28513892-28513914 TTTCTAATGTCCTATTATGAAGG + Intronic
1182407233 22:30145896-30145918 TGTCTTCAGTTTTAGTATCAGGG - Intronic
1182439367 22:30353400-30353422 TTTCTCCTGTCTTATAAACTAGG - Intronic
1202720494 2_KI270715v1_random:72054-72076 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
1202722670 2_KI270715v1_random:106720-106742 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
1202722716 2_KI270715v1_random:107400-107422 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
1202725435 2_KI270715v1_random:150568-150590 ATGCTTCTGTCTTGTTTTCAGGG - Intergenic
1202725566 2_KI270715v1_random:152608-152630 ATGCTTCTGTCTTGTTTTCAGGG - Intergenic
1202725652 2_KI270715v1_random:153967-153989 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
1202725785 2_KI270715v1_random:156007-156029 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
1202725807 2_KI270715v1_random:156349-156371 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
1202726131 2_KI270715v1_random:161447-161469 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
1202733692 2_KI270716v1_random:115041-115063 ATGCTTCTGTCTAATTTTCAGGG - Intergenic
1202734152 2_KI270716v1_random:122518-122540 ATGCTTCTGTCTAATTTTCAGGG - Intergenic
1202734238 2_KI270716v1_random:123877-123899 ATGCTTCTGTCTAATTTTCAGGG - Intergenic
1202735065 2_KI270716v1_random:137128-137150 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
1202735516 2_KI270716v1_random:144261-144283 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
1202735714 2_KI270716v1_random:147318-147340 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
1202735891 2_KI270716v1_random:150038-150060 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
1202736132 2_KI270716v1_random:153775-153797 ATTCTTCTGTCTAGTTTTCAGGG - Intergenic
949689192 3:6615006-6615028 TTTGTTCTGTTTTATTCTCAGGG - Intergenic
949745048 3:7281366-7281388 TGTCTTCTGTCTTATTAGTGAGG + Intronic
949913150 3:8932048-8932070 TTTCTCCTGTGTTATTTTCTAGG - Intronic
951361748 3:21732984-21733006 TTTCTTCTATGTTATTTTCCAGG + Intronic
951715280 3:25636280-25636302 TTTTGTCTGTAATATTATCAAGG - Intronic
951724873 3:25746498-25746520 TTTTTTCTTTCTAATTATAAAGG - Intronic
951921271 3:27856932-27856954 TTTCTCTTGTCTGATTATCCTGG - Intergenic
951947619 3:28158261-28158283 TTTGTTTGGTTTTATTATCAAGG - Intergenic
952009732 3:28886702-28886724 TTTTTTCTTTCCTATTATCAAGG + Intergenic
952067356 3:29586996-29587018 TTTCTTCTGACATATTACCCTGG - Intronic
952180392 3:30910730-30910752 TTTTTTCTGTCTTACCATGAAGG + Intergenic
954978343 3:54719426-54719448 TTTCTTCTTTTTTAATGTCATGG + Intronic
956359534 3:68432154-68432176 TTTCTCCTGTCTTATAAACTAGG + Intronic
956556003 3:70523576-70523598 TTTCTTTTGTTCTATTCTCAGGG - Intergenic
956845389 3:73177649-73177671 TTTGTGCTGTCATATTATCCTGG - Intergenic
957256503 3:77844493-77844515 TTTTTTCTTTCTCATTTTCATGG + Intergenic
957428273 3:80068759-80068781 GTTCTTCTGTCTTATATTGATGG - Intergenic
957840921 3:85668251-85668273 ATTATTCTGTCTCATTCTCAGGG - Intronic
957843799 3:85704548-85704570 TCTCTACTGTCTTTTTATAAGGG + Intronic
958041277 3:88229826-88229848 TTTCTTCTTTCTGTTTATCGAGG + Intergenic
959145559 3:102540349-102540371 CTTCTTCTGTCTTATTCACCTGG - Intergenic
959413387 3:106053418-106053440 TTTCTTCTATATTATTTTCTAGG - Intergenic
959523800 3:107352708-107352730 TTTCTTCTATTTTATTCTCCAGG + Intergenic
960347893 3:116557200-116557222 TGTCTTCTGTTTTATTATATGGG - Intronic
960596536 3:119412721-119412743 TCTCTTTTTTCTTATTACCAAGG - Intronic
960647939 3:119910320-119910342 TTTATTGTGTCTTATTGTTATGG - Intronic
961023091 3:123526354-123526376 TTTCTGCTGTCCTAGGATCATGG - Intronic
961618562 3:128204891-128204913 TTTCTTTTGTATTATCATCCAGG - Intronic
962633008 3:137299082-137299104 TTTCTGCTCTCTTATTAATATGG + Intergenic
963467242 3:145698898-145698920 TTTCTTATTTCTTGTTATTATGG + Intergenic
963508060 3:146212901-146212923 TTTCTTAAGTGTTTTTATCATGG + Intronic
964103610 3:153016663-153016685 TTTCTTCTGTCTCAATGTCCAGG - Intergenic
964536943 3:157732593-157732615 TTTCTTCTGTGTTATCTTCTAGG - Intergenic
965043811 3:163548769-163548791 ATTCTTCTGCATTAATATCATGG - Intergenic
965174006 3:165307043-165307065 TTTCTCTTGTCTGATTATGATGG - Intergenic
965864323 3:173186092-173186114 TTTCTTTTTTTTTAATATCATGG + Intergenic
967854483 3:194106420-194106442 TCTCTTCTTTCTTCTTATAAAGG + Intergenic
967894606 3:194385868-194385890 ATTCTTCTTTCTTATTATAAAGG - Intergenic
968291358 3:197542183-197542205 TTTCTGCTGTGTTATTCTGAAGG - Intronic
968328595 3:197844037-197844059 TTTCTACTGAAATATTATCATGG - Intronic
968639515 4:1705494-1705516 TTTATTTTGTCAGATTATCATGG + Intronic
969332504 4:6485745-6485767 TATCTTCTCTCTTATTGTCCTGG + Intronic
970271644 4:14354342-14354364 TTTCTTCTCTCTTATTGTTGTGG - Intergenic
970490295 4:16565635-16565657 TTTCTTTTGTCTAATTATATTGG - Intronic
970864757 4:20745650-20745672 TTTCCATTCTCTTATTATCAAGG + Intronic
971038719 4:22725950-22725972 TTTTTTCTTTCTTATTTTCTGGG + Intergenic
971309076 4:25508252-25508274 GCACTTTTGTCTTATTATCACGG + Intergenic
971608691 4:28692604-28692626 TTCCTTCTATGTTATTTTCATGG + Intergenic
971900952 4:32657872-32657894 CTTCTTTTGTCATATTACCAGGG + Intergenic
972018913 4:34283100-34283122 TTTCATTTGTCTATTTATCATGG - Intergenic
972305387 4:37825633-37825655 TTTCTCCTGTCTTATAAACTAGG - Intergenic
972431417 4:38986163-38986185 TTTAATATGTCTTATTATCAGGG - Intronic
972515931 4:39810652-39810674 TTTCTTCTTTTTTATTTTCGAGG + Intergenic
972535915 4:39999866-39999888 TTTCTTCTGTCTTTGTAAGAAGG + Intergenic
972858956 4:43143253-43143275 TTTCATCTCTCATATTTTCAAGG - Intergenic
973840869 4:54859233-54859255 CTTCTTCTGTGTTCTAATCAAGG - Intergenic
974156234 4:58077014-58077036 TTTGTTCTGTCTTTTTATTTTGG - Intergenic
974224703 4:59024146-59024168 TTTCTCCTGCCTGATTATCTTGG - Intergenic
974593151 4:63982599-63982621 TATCTTGTCTATTATTATCAAGG - Intergenic
974853585 4:67432624-67432646 TTTCCTCTGTATTATTTTGAAGG + Intergenic
974964039 4:68738007-68738029 TTTTTTCTGTCTTTTTTTAATGG + Intergenic
975075520 4:70203257-70203279 TTTCTTTTGTCTTCTTATGTAGG - Intronic
975298232 4:72758767-72758789 TTTCTTTTCTCATATTCTCAAGG + Intergenic
976106414 4:81623684-81623706 TTTTTTTTATCTTATTATGAAGG - Intronic
976465800 4:85367538-85367560 TTTCTTCCCTGTTATTATCTTGG + Intergenic
976686248 4:87818884-87818906 TTTGTTTTGTCATATTACCAGGG + Intergenic
976690343 4:87862061-87862083 TTTCTCCTGTCTTACCATCCTGG - Intergenic
977005095 4:91557948-91557970 TTTTTTGTGTATTTTTATCATGG - Intronic
977019897 4:91746275-91746297 TTTGTTGTGTCATATTACCAGGG + Intergenic
978218196 4:106234131-106234153 ATTATTCTGGCTTATTATCATGG + Intronic
978481930 4:109202510-109202532 TTTCTCCTGTGTTATTTTCTAGG - Intronic
978930002 4:114298427-114298449 TTTCTTTGGTTTTAGTATCAAGG + Intergenic
979214354 4:118144939-118144961 TTTCTTCTATCTCATTTTCTAGG - Intronic
979237448 4:118418221-118418243 TTACTTCTGTCATATTAGGATGG + Intergenic
979404882 4:120297553-120297575 TTTTTTCCTTCTTATTTTCAGGG + Intergenic
979646696 4:123077911-123077933 TTTCTTCAGTCTTATGAGCAAGG - Intronic
980105021 4:128579395-128579417 TTTCTTCTTTCCTATCATCAAGG - Intergenic
980153123 4:129072876-129072898 CTTGTTTTGTCATATTATCAGGG + Intronic
980278741 4:130690435-130690457 TTACTTCTGTGTTATTTTCTAGG + Intergenic
980342862 4:131573286-131573308 ATGCTTCTGTCTTATTTTAAAGG + Intergenic
980433575 4:132738171-132738193 TTTCTAGTGTCTTTTTATAATGG + Intergenic
980492335 4:133544110-133544132 TTTGTTGTCTCTTATTAACAAGG + Intergenic
980677399 4:136105026-136105048 TTTTTTCTGTTTTAGTATCGAGG + Intergenic
981275113 4:142890456-142890478 TTTTTTCTATATTATTAACATGG - Intergenic
981346742 4:143684572-143684594 TTTGTTTTGTCATATTACCAGGG - Intronic
981626091 4:146757105-146757127 CTTGTTTTGTCATATTATCAGGG + Intronic
981942336 4:150295506-150295528 TTTATTGTCTCTGATTATCAAGG + Intronic
982966464 4:161914280-161914302 TTTCTTTTTTCTTAGTTTCAAGG - Intronic
983853827 4:172617205-172617227 ATTTTTCTGTCTTTTCATCAAGG - Intronic
983859093 4:172682295-172682317 TTTATTGTGTCTTAATATGATGG + Intronic
984020556 4:174479885-174479907 TTTCTTGGGTTTTGTTATCATGG - Intergenic
984366629 4:178807018-178807040 TTTCTTTTCTATTATTATAAAGG + Intergenic
984404277 4:179307268-179307290 TTTCTTCTATCTTCTGCTCATGG - Intergenic
985223578 4:187734137-187734159 TTTCTTTTTTCTTGTTTTCATGG + Intergenic
986340759 5:6787394-6787416 TTTTTTCTTTTTAATTATCATGG + Intergenic
986429572 5:7667969-7667991 TTTTTCCTGTCTTATTCTCCAGG - Intronic
987431440 5:17838959-17838981 TTTCTTCTCATTTATTATCAAGG + Intergenic
987694559 5:21311202-21311224 TTTTTTCTGGATTATTATCAGGG + Intergenic
988007002 5:25427305-25427327 TTTCCTCTGTGTTAATCTCATGG - Intergenic
988203620 5:28103566-28103588 TTTATTCTATCTTATTTTTAAGG + Intergenic
988205022 5:28123180-28123202 TTTCTTATGTCTCATGATGAAGG + Intergenic
988221579 5:28353179-28353201 TTTCTCCTGCCTGATTATCTTGG - Intergenic
988345567 5:30033907-30033929 TTTCTTCTTTCCGATTTTCATGG - Intergenic
988709198 5:33756505-33756527 TTTCTGCTGACTTATTATTTTGG - Intronic
988711678 5:33784590-33784612 TTTGTTCTTTCTGATTATCTTGG - Intronic
988767923 5:34402347-34402369 TTTTGTTTGTTTTATTATCAAGG - Intergenic
989222133 5:38978772-38978794 TTTCTTCTAACTCATCATCAGGG + Intronic
989373792 5:40738054-40738076 TTTCTTCTGAATTAGTATCTAGG + Intronic
989914778 5:49710287-49710309 TTGCTTCTGTCTAGTTTTCAGGG - Intergenic
989922250 5:49821305-49821327 ATGCTTCTGTCTAATTTTCAGGG - Intergenic
990841286 5:60082258-60082280 TTTCTTATTTCTTCTTATAAGGG - Intronic
991268555 5:64751225-64751247 TTTCTTCTGCCATATTTTCCCGG + Intronic
991285734 5:64973648-64973670 TTTCTCCTGCTTTATTATAAAGG - Intronic
991464885 5:66901128-66901150 TTTCTTTTGTCTCATCATGATGG - Intronic
991670414 5:69041754-69041776 ATTCTTCTGTCTTGTTCACAAGG - Intergenic
991745681 5:69738269-69738291 TTTTTTCTGGATTATTATCAGGG - Intergenic
991752025 5:69816964-69816986 TTTTTTCTGGATTATTATCAGGG + Intergenic
991797281 5:70318226-70318248 TTTTTTCTGGATTATTATCAGGG - Intergenic
991825059 5:70613583-70613605 TTTTTTCTGGATTATTATCAGGG - Intergenic
991831312 5:70691866-70691888 TTTTTTCTGGATTATTATCAGGG + Intergenic
991889626 5:71317554-71317576 TTTTTTCTGGATTATTATCAGGG - Intergenic
992075264 5:73186999-73187021 TTTCTTCTGTATTTTTAAAATGG + Intergenic
992342698 5:75841752-75841774 TTTCTTCTGTTTTCTTTTCCTGG + Intergenic
992389992 5:76321920-76321942 TCTCTTCTGTCATATTTTCTTGG + Intronic
992589781 5:78282445-78282467 ATTCTTCTGTGTGATTATCAAGG - Intronic
992663896 5:78986864-78986886 TTTCTTCTTAATTTTTATCAAGG - Intergenic
992687225 5:79210669-79210691 TTTCTTCTCTCTTTTAATCTGGG + Intronic
993239718 5:85366831-85366853 TTTCTTCTTTTTGGTTATCATGG - Intergenic
993352725 5:86869560-86869582 TCTCTTCTGCCTTATAGTCATGG + Intergenic
994127603 5:96186342-96186364 TTTCTTCTGTCTGATTGCCCTGG + Intergenic
994264819 5:97702272-97702294 TTTCTCTTGTCTTATTGTCCTGG + Intergenic
994272221 5:97792093-97792115 TTTTTTCTGTCATATTTTAATGG + Intergenic
994498835 5:100548040-100548062 TTTGTTTTGTTTTATAATCAGGG + Intronic
994907998 5:105866044-105866066 TTTTTTCAGACTTTTTATCAGGG - Intergenic
994965319 5:106662727-106662749 TTTCTTCTTTATAATTGTCAAGG + Intergenic
995561225 5:113384017-113384039 TTTCTTCCGTCTCTTTGTCAAGG + Intronic
995949045 5:117687308-117687330 TGTCTTCTGTCTTCTTATGGTGG + Intergenic
996817469 5:127589650-127589672 TTTCTTATGTGTTATTGTCTTGG - Intergenic
997269078 5:132520515-132520537 TTTATTCTGTTCTATTAGCATGG - Intergenic
997730567 5:136170181-136170203 TTTCTCCTGTATTATTTTCTAGG + Intronic
998012493 5:138706565-138706587 ATTCATCTGTCTCATTTTCAGGG - Intronic
998253742 5:140569457-140569479 TGTCATCTGTCTTAAAATCATGG + Intronic
998523426 5:142820742-142820764 ATTCTTATGTTTTATTATTATGG - Intronic
998661965 5:144248669-144248691 CTTCTTCATTCCTATTATCATGG - Intronic
999418619 5:151421246-151421268 TTTCTTCTTTTTTTTTTTCAAGG + Intergenic
999695071 5:154181510-154181532 TTTATTCTTTCTTATGATGAGGG + Intronic
999822778 5:155245010-155245032 TATCTTCTGTCTTCTTTTCTTGG + Intergenic
1001779128 5:174352516-174352538 TTATTTCTGCCTTCTTATCAAGG + Intergenic
1002671060 5:180867677-180867699 TTTCTCCTGTCTTATAAACTAGG - Intergenic
1002737888 5:181410188-181410210 TTACTTCTGTCATATTAGGATGG + Intergenic
1002777271 6:339840-339862 TTTCTTTTATTTTATTATAAAGG + Intronic
1004011164 6:11689179-11689201 TTGCTTTTGTCTAATGATCAGGG - Intergenic
1004103175 6:12636242-12636264 TTTTTTCTTTCTTATTTTGAAGG + Intergenic
1004668605 6:17773654-17773676 TTTCTTCTGTTTTTTTTTAATGG + Intronic
1004804285 6:19184863-19184885 TTTCTGCTGTCTCTTTTTCATGG - Intergenic
1004957423 6:20744833-20744855 GTTTTTCTGTGTTATTAACAAGG + Intronic
1005556344 6:26988736-26988758 TTTTTTCTGGATTATTATCAGGG - Intergenic
1005603683 6:27453639-27453661 TTTGTTCTGTCTTTAAATCATGG - Intronic
1006084117 6:31584142-31584164 TTTAAACTGTCTTGTTATCAAGG - Intergenic
1008073305 6:47119325-47119347 TTTCTTCTGTGTTCTTTTTAAGG - Intergenic
1008596397 6:53046522-53046544 TATAGTCTGTCATATTATCAAGG + Intronic
1008712603 6:54246929-54246951 TTTGTTCTGTTTTATTTTTACGG + Intronic
1008836641 6:55840352-55840374 TTTCTCCTGACTTATTTTCCTGG + Intronic
1009097992 6:59009052-59009074 TTGCTTCTGTCTTGTTTTTATGG - Intergenic
1009707983 6:67279616-67279638 TTTCTTTTGTTTTATTTCCATGG - Intergenic
1010094747 6:72028628-72028650 TTTCGTTTGTCTTTTTAGCAGGG - Intronic
1010188938 6:73175001-73175023 TTTGTTCTGTCTTTGAATCAGGG + Intronic
1010477347 6:76304457-76304479 TTTCTCCTGTCTTATATCCATGG + Intergenic
1010477697 6:76308707-76308729 TTTCTTCAGTTTTATTTGCATGG + Intergenic
1010618084 6:78038683-78038705 TTTATTTTTTCTTTTTATCATGG + Intergenic
1011162347 6:84405235-84405257 TTTCCCCTGTCTTATTACCTAGG - Intergenic
1011868415 6:91861321-91861343 TTTCTTTTTTCTTTTCATCATGG - Intergenic
1012077738 6:94713733-94713755 TTTTTTCTGTTTTTTTATTATGG + Intergenic
1012374051 6:98539609-98539631 TTTCTTTTCTCCTATTAACAAGG - Intergenic
1012650680 6:101748972-101748994 TTTCATCTTTCTTATTTTAAAGG + Intronic
1012922772 6:105236018-105236040 CTTGTTCTGTCATATTACCAGGG - Intergenic
1013143754 6:107366591-107366613 TGTCTTCTTTCTTATTTTCTTGG - Intronic
1013647397 6:112158958-112158980 TCTGTTCTTTCTTATTATGAAGG + Intronic
1013893520 6:115055461-115055483 TTTGTTTTATCTTATTATTATGG - Intergenic
1013931177 6:115534892-115534914 TTTCTCCTATTTTATTTTCAGGG + Intergenic
1014051696 6:116962585-116962607 TTTATTTTGTCTTACTATAAAGG - Intergenic
1014531288 6:122563037-122563059 TTTTTTTTGTCATATTACCAGGG + Intronic
1014868834 6:126565384-126565406 TTTCTTCTGTAATCTTATAAAGG + Intergenic
1015124993 6:129744331-129744353 TTTCTTCTATTTTATGATCCTGG - Intergenic
1015768283 6:136742548-136742570 TTTCTTCTATGTTATTTTCCAGG - Intronic
1016601716 6:145869433-145869455 TTTCTTCTATGTTATTTTCAAGG + Intronic
1016615050 6:146038151-146038173 TTTCTTCTTTCATTTTAACAAGG - Intronic
1017477405 6:154812039-154812061 TTATTTCTGTTTTATTTTCATGG + Intronic
1018004381 6:159607245-159607267 TGTCTTCTGTCTTTTTTTCCTGG + Intergenic
1018102678 6:160455482-160455504 TTTCTTCTCCCTAATTGTCAAGG - Intergenic
1018110598 6:160533773-160533795 TTTCTTCTCCCTAATTGTCAAGG - Intronic
1018559071 6:165082429-165082451 TCGGTTCTGTCTTACTATCATGG - Intergenic
1018958009 6:168425265-168425287 TTTTTTTTGTCTTATTATTGTGG + Intergenic
1019242987 6:170685746-170685768 TTACTTCTGTCATATTAGGATGG + Intergenic
1019493900 7:1327786-1327808 TTTCTCCTGTCTTATAAACTAGG - Intergenic
1020353803 7:7254836-7254858 TTTCTTCTGTTTCATTTTTATGG + Intergenic
1020375520 7:7480597-7480619 TTTCATTTGTCATATTATTAGGG - Intronic
1020597929 7:10233599-10233621 TTTTTTCTGGTTTGTTATCAGGG + Intergenic
1021261006 7:18457166-18457188 TCTCTTCTTTCTCATTAGCAAGG - Intronic
1023184905 7:37523217-37523239 TTTCTTTTCTCTTATTTTGATGG + Intergenic
1023355114 7:39358829-39358851 TTTCTTTTGTCCTATTCTCAGGG - Intronic
1024203893 7:47135539-47135561 TTTCTTCTTTGTTATAATCTTGG + Intergenic
1024607566 7:51034840-51034862 TTTGTTCTGGCTTAAGATCAAGG + Intronic
1024632866 7:51263512-51263534 TTTTTTCTGTTTTATTGTCTTGG - Intronic
1024695943 7:51856876-51856898 GTTCTGCTATTTTATTATCAGGG - Intergenic
1024696129 7:51858396-51858418 TTTCTTCTGACTTGCTATCTTGG - Intergenic
1024800738 7:53074603-53074625 TTTATTCTGTCTTATTTCAAAGG - Intergenic
1024906323 7:54386140-54386162 TTTCTCCTGTGTTATTTTCTAGG + Intergenic
1025253611 7:57368390-57368412 TTTCTCCTGTCTTATAAACTAGG - Intergenic
1025296498 7:57779254-57779276 TTTTTTCTGTCCTATATTCAAGG - Intergenic
1025313204 7:57978882-57978904 ATTCTTCTGTCTAGTTTTCATGG + Intergenic
1025780203 7:64594871-64594893 TTTCTCCTGTCTTATAAGCTAGG - Intergenic
1026103108 7:67398901-67398923 TTGCTTCTGTCACATTGTCATGG + Intergenic
1026593873 7:71718139-71718161 TTTCTCCTGTCTTATAAACTAGG + Intergenic
1027614963 7:80410854-80410876 TTACATCTGTCTAATTAACATGG + Intronic
1027812867 7:82927638-82927660 TTTATTCTTTCTTCTCATCATGG + Intronic
1028196811 7:87916589-87916611 TTTCTTCTATGTTATTGTCTAGG + Intergenic
1028314954 7:89389442-89389464 ATTCTTTTGTCTTAATATGATGG + Intergenic
1028728977 7:94123062-94123084 TTTCATTTGTTTTATTTTCATGG - Intergenic
1028734522 7:94192204-94192226 TTTCTCCTGACTGATTATCCTGG - Intergenic
1028805907 7:95025969-95025991 ATTCCTCTGTCCTTTTATCAAGG + Intronic
1030557566 7:111045927-111045949 TTTGTTCTGTATTTTTATCTTGG - Intronic
1031024963 7:116670479-116670501 TTTCTTTTATATTTTTATCATGG + Intergenic
1031188862 7:118520181-118520203 TGTCTTCTGATTTATTAACATGG + Intergenic
1031532208 7:122888313-122888335 ATTATACTGTCTTATTATCAAGG - Intergenic
1031761154 7:125715385-125715407 TTTGTTTTGTCATATTACCAGGG + Intergenic
1032946300 7:136856708-136856730 TCTATTCTGACTTATAATCAAGG - Intergenic
1032996037 7:137447877-137447899 TTTTTTCTGTGTTACTAACATGG - Intronic
1033024139 7:137756380-137756402 TTTCTTCTGTGTTTGCATCATGG - Intronic
1033676770 7:143548800-143548822 TGTCTTCTCTCTTTTTATCTTGG + Intergenic
1033695065 7:143780635-143780657 TGTCTTCTCTCTTTTTATCTTGG - Intergenic
1033807780 7:144974322-144974344 TTTGTTCTGCCCTATTATAAAGG + Intergenic
1033947762 7:146743207-146743229 TTTCCTTTTTCTTATTATTATGG + Intronic
1033968501 7:147008505-147008527 TTTCTTCAGTCTAATTTGCAGGG - Intronic
1034058481 7:148063142-148063164 TTTTTTCTTTCTTATTTTAAAGG + Intronic
1035304137 7:157919443-157919465 GTCCTTCTCTCTTATCATCATGG - Intronic
1035505134 8:122416-122438 TTACTTCTGTCATATTAGGATGG - Intergenic
1035861701 8:3035831-3035853 TTTCTTCTTTTTTATTTTTAAGG + Intronic
1036666734 8:10749355-10749377 TTTCTTCTTTCTTCTTATTTTGG + Intronic
1036817329 8:11912033-11912055 TTTCTCCTGTCTTATAAACTAGG + Intergenic
1036928412 8:12929905-12929927 TTTCTTTTGTTTTAATATCATGG - Intergenic
1037102707 8:15066363-15066385 TTACTTCTGAGTTATTTTCAAGG + Intronic
1037103010 8:15071357-15071379 TTTCTTATGAGTTATTATTAAGG - Intronic
1037867189 8:22454620-22454642 TTTCACCTGTCTTAACATCACGG - Intronic
1037939230 8:22939100-22939122 TTTCTTTTGTTTTTTTCTCAGGG + Intronic
1038016754 8:23522126-23522148 TTTTTTCTTTTTTATTAACACGG - Intergenic
1038203096 8:25434561-25434583 TTTATTCTGTCTTATCATGAAGG - Intronic
1038798397 8:30728644-30728666 TTTCTCCTGTCTTATAAACTAGG - Intergenic
1038820676 8:30949138-30949160 TTTCTTGTATGTTATTCTCATGG - Intergenic
1038914969 8:32011047-32011069 TCTTTTGTATCTTATTATCATGG - Intronic
1039261129 8:35773121-35773143 TCCCTTTTGTCTTATAATCATGG + Intronic
1039537129 8:38326856-38326878 TTTCTTTTGCCTTATTTTAAAGG - Exonic
1039655591 8:39401432-39401454 TTTTTTCTGTTTTATTAAAATGG - Intergenic
1039801086 8:40954979-40955001 TTTCTTCTCTTCTTTTATCATGG - Intergenic
1040005615 8:42618402-42618424 TTTTTTTTGTCTTATGATCCAGG + Intergenic
1040721795 8:50333549-50333571 TTTCTTATTTCTTATTATGCTGG + Intronic
1040726859 8:50391065-50391087 TTTCTTCTGTCTGATTGCCCTGG + Intronic
1040975276 8:53186677-53186699 TATCTTCTGTCTGATTGTTAGGG - Intergenic
1041034329 8:53772994-53773016 TTTGTTCAGCCTTATTATTAGGG - Intronic
1041383037 8:57272367-57272389 ATTCTTCTGACCTTTTATCAAGG + Intergenic
1042166320 8:65949221-65949243 TTTCTTCTGGCTCAAGATCACGG + Intergenic
1042247885 8:66725951-66725973 TATCTTGTATCTTATCATCATGG + Intronic
1042801631 8:72724130-72724152 TTTGTTCTGTCCTCTTGTCATGG + Intronic
1042911036 8:73826778-73826800 TATCTTCTGTTTTATTATTGAGG - Intronic
1042930299 8:74006850-74006872 TTCGTACTGTCTTATTATCTTGG - Intronic
1043177363 8:77039139-77039161 TATCTTCGTTCTTATTACCATGG + Intergenic
1043247521 8:78023864-78023886 TTTTTTCTGTCTCATTTTCTTGG - Intergenic
1043488371 8:80721299-80721321 TTTCTTCCTTTTTATTATAAAGG - Intronic
1043785659 8:84396821-84396843 TTGTTTCTGTTTTATAATCAAGG + Intronic
1044206659 8:89498744-89498766 TTTCTTCCTTCCTATTGTCAGGG + Intergenic
1044477512 8:92645716-92645738 TTTTTTCTATCTTATGATAATGG + Intergenic
1044687696 8:94843608-94843630 TTTCTTCAGTCTTATGATGGGGG + Intronic
1044950398 8:97430449-97430471 TGTCTTCTGTCTTCTTCTCTGGG - Intergenic
1045605664 8:103770792-103770814 TTTCTTCTTTCTTATCAGAATGG + Intronic
1045790844 8:105982278-105982300 TCTTGTCTGACTTATTATCAGGG - Intergenic
1046000202 8:108411446-108411468 TTTATTATGTCTTATTAAGATGG - Intronic
1046233440 8:111389247-111389269 TTTTTTATGTCTTATTGTGATGG + Intergenic
1047001995 8:120582542-120582564 TGTCTTCTCTCTCATTTTCATGG - Intronic
1047830269 8:128621991-128622013 TTTATCCTGTCTGATCATCATGG + Intergenic
1047891788 8:129320211-129320233 TTTTTTCTGTCTTATTTTTCTGG - Intergenic
1049328340 8:142036064-142036086 TTTCTTCTGTCTTGTAGCCAGGG - Intergenic
1049609525 8:143547635-143547657 TTTCTCCTGTCTTATAAACTAGG - Intergenic
1049854888 8:144855227-144855249 TTTCTCCTGTCTTATAAACTAGG + Intergenic
1050039132 9:1470233-1470255 CTTCTTCTCTTTTATTCTCAAGG - Intergenic
1050133367 9:2436555-2436577 TGTCTTCTGTCTTCTTTTCTTGG + Intergenic
1050202912 9:3167168-3167190 TTTCTTCTGTATTTTTATGGTGG + Intergenic
1050368645 9:4898070-4898092 TTTCTTTTGTCTGATTGTCCTGG + Intergenic
1051402755 9:16700791-16700813 TTTCTTTTGTATTTTTAGCAGGG - Intronic
1051758084 9:20427417-20427439 TTTCTTGTGTCTTTGTATTATGG - Intronic
1052147434 9:25067514-25067536 TTCCTTGTGTTTTCTTATCATGG - Intergenic
1052168947 9:25370045-25370067 TTTCTCCTGTCTTATAAACTAGG + Intergenic
1053505763 9:38642054-38642076 TTTCTTATGTCTGATTGACAGGG + Intergenic
1054855363 9:69893349-69893371 TTTCTCTTGTCTTCTTTTCAAGG - Intronic
1054941322 9:70745754-70745776 TTGCTTCTTTCTTATCATCTGGG + Intronic
1055005550 9:71501591-71501613 TTTCTTCTCTGTTATTTTCTAGG - Intergenic
1056197327 9:84240929-84240951 TTCCTTCTCTCTGATCATCAGGG - Intergenic
1057431115 9:94995053-94995075 TCTCATGTGTCTTATTATAAAGG - Intronic
1057639626 9:96805477-96805499 TGTCTTTTGTTTCATTATCAAGG - Intergenic
1058018197 9:100060566-100060588 TTTCTTCTGTCTTAGAAACATGG - Intronic
1058703839 9:107622742-107622764 TTCCTCCTGTGTTATTCTCAAGG + Intergenic
1058840336 9:108901323-108901345 TTTATTTTGGCTTTTTATCAAGG - Intronic
1059320586 9:113465287-113465309 TTTTTTCCTCCTTATTATCATGG + Intronic
1059770914 9:117424358-117424380 TTACTTCTATCTTCTTTTCATGG + Intergenic
1059818629 9:117947048-117947070 TTTCTTTTGTTTTAGCATCAAGG - Intergenic
1060491146 9:124085262-124085284 TTTCTTCTGTTTTGTAAGCAGGG - Intergenic
1060714163 9:125906233-125906255 TTTTATCTGTATTATTATAAAGG - Intronic
1061523028 9:131132899-131132921 TTTCTGCTGGATTATAATCAGGG - Intronic
1061728526 9:132595348-132595370 TTTGTTCTGTGTTGTTTTCATGG + Intronic
1061950476 9:133933157-133933179 TTTCCTCTGTGATTTTATCATGG - Intronic
1062188689 9:135234061-135234083 TTTCTTCTGTTTTGGCATCAGGG - Intergenic
1062672313 9:137718547-137718569 TTTCTTCTGTTTTCTTCCCATGG + Intronic
1203732881 Un_GL000216v2:106757-106779 TTTCTTCTGTATTATTAGACGGG + Intergenic
1203414048 Un_KI270589v1:32576-32598 ATTCTTCTGTCTAGTTTTCATGG + Intergenic
1203603176 Un_KI270748v1:34970-34992 TTACTTCTGTCATATTAGGATGG + Intergenic
1203684016 Un_KI270757v1:23210-23232 TTTCTTCTGTCTTGTTTTTATGG - Intergenic
1203684231 Un_KI270757v1:27302-27324 ATTCTTCTGTCTAGTTTTCATGG - Intergenic
1185451980 X:286831-286853 TTTCTCCTGTCTTATAAACTAGG + Intronic
1185794352 X:2952249-2952271 TTTCTTATTTTTTTTTATCATGG + Intronic
1185932417 X:4217778-4217800 TTTCTTCTCTATTATTAATAGGG + Intergenic
1186502049 X:10059272-10059294 TCTCTTCTGTTTTATTGTGAGGG + Intronic
1186971151 X:14845096-14845118 TTTCCTCTTTCTTGCTATCAGGG + Exonic
1187311481 X:18148193-18148215 TTTTTTCTTCTTTATTATCAGGG + Intergenic
1187829323 X:23364912-23364934 TTTCTTCTGGCTGATGATAAAGG - Intronic
1188603243 X:31995437-31995459 TTTCTTTTTTCTTATTATAAAGG - Intronic
1188643392 X:32534698-32534720 TTTGTTGTGTCTTCTTATAAGGG + Intronic
1189605690 X:42675368-42675390 TTTCTTCTTACTTAAAATCATGG - Intergenic
1189668793 X:43385789-43385811 TTTGGTCAGTCTTATTTTCAGGG + Intergenic
1189740313 X:44110972-44110994 TGTCTTCTGACTTGTTATGAGGG - Intergenic
1189765007 X:44362500-44362522 TTTCTCCTGTCTTATAAACTAGG - Intergenic
1189946277 X:46182902-46182924 TGTCATCTGTCTTATTTTCTGGG + Intergenic
1190139140 X:47826381-47826403 TTACTTTTGTCTTAGTATGAGGG - Intergenic
1190438525 X:50452367-50452389 TTTCTTCTTTCATATAATCTAGG + Intronic
1190805957 X:53836889-53836911 TATCTTCTGTCTTTTTATCTTGG + Intergenic
1191580068 X:62751041-62751063 TTTCTTCTTTGTTTTTATCTGGG + Intergenic
1191952761 X:66611308-66611330 TTTCCTTATTCTTATTATCATGG - Intronic
1193428885 X:81375632-81375654 TTTCCGCTCTATTATTATCAGGG + Intergenic
1193469681 X:81884678-81884700 GATCTTCTGTCTTATTTTCTTGG + Intergenic
1193507306 X:82360895-82360917 TTTCTCCTGTCTTATAAACTAGG + Intergenic
1193621754 X:83761376-83761398 TTTCTTTGGTTTTATTATAAAGG + Intergenic
1194341533 X:92712076-92712098 TATCTTCCATCTTATTATAAAGG - Intergenic
1194399822 X:93429731-93429753 TTTCTCCTGTCTTATAAACTAGG - Intergenic
1194486301 X:94491310-94491332 TTTCTCCTGTCTTATTGCCATGG + Intergenic
1194703503 X:97145370-97145392 TTTCTTTTGTCTTATTAGAAGGG + Intronic
1194914648 X:99690594-99690616 TGTCCTCTGTCTTCTTCTCAAGG - Intergenic
1195837383 X:109132329-109132351 ATTCTTCACTCTTATTACCATGG - Intergenic
1195982534 X:110594795-110594817 TTTGTTCGGTTTTAGTATCAAGG - Intergenic
1196439832 X:115708507-115708529 TTTCTCCTGTCTTATAAACTAGG - Intergenic
1196480707 X:116143815-116143837 ATTCTTCTGTATCATTTTCATGG - Intergenic
1196494052 X:116303092-116303114 CTTCTTCTGGTTTATTATCAGGG + Intergenic
1197060082 X:122168076-122168098 TTTCTCCTGTTTTATTTTAATGG - Intergenic
1197303472 X:124810211-124810233 TTTCTACTGTCTAATTATTCTGG - Intronic
1197552626 X:127912252-127912274 TTTTTTCTGTCTTATGATCTTGG - Intergenic
1197641288 X:128970963-128970985 TTACTTCTGTCTTACTGTCTGGG - Intergenic
1197711207 X:129670127-129670149 TTTTTCCTTTTTTATTATCAGGG + Intergenic
1198617605 X:138476840-138476862 TTTCTTCTATGTTGTTTTCATGG - Intergenic
1198638919 X:138734272-138734294 TGTCATCTGTCTTATTATCTTGG + Intronic
1198928773 X:141829473-141829495 TTTCTTCTGGGAAATTATCACGG + Intergenic
1199651462 X:149948926-149948948 TCCCTTCTGTCTCATTATCTGGG + Intergenic
1200901071 Y:8432639-8432661 TTACTTCTGTCTTTTTTTTATGG - Intergenic
1201275331 Y:12291735-12291757 TTTCTTCTTTTTTTTTGTCAGGG - Intergenic
1201596190 Y:15672188-15672210 TTTCTTCTTCCTTATTAGCCTGG + Intergenic
1202385247 Y:24320024-24320046 TTACTTCTGTCATATTAGGATGG + Intergenic
1202485538 Y:25350104-25350126 TTACTTCTGTCATATTAGGATGG - Intergenic
1202581474 Y:26385526-26385548 TTTCCTTTGTCTTATTATTAAGG - Intergenic
1202628068 Y:56880913-56880935 TTTCTTCTGTATTATTAGACGGG - Intergenic