ID: 1128182892

View in Genome Browser
Species Human (GRCh38)
Location 15:65620613-65620635
Sequence TGGGTTTACCCCCAGCGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128182887_1128182892 1 Left 1128182887 15:65620589-65620611 CCATGATAATAAGACAGAAGAAA 0: 1
1: 0
2: 4
3: 61
4: 810
Right 1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 51
1128182885_1128182892 9 Left 1128182885 15:65620581-65620603 CCAGAATCCCATGATAATAAGAC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 51
1128182886_1128182892 2 Left 1128182886 15:65620588-65620610 CCCATGATAATAAGACAGAAGAA 0: 1
1: 0
2: 2
3: 875
4: 2185
Right 1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 51
1128182884_1128182892 30 Left 1128182884 15:65620560-65620582 CCTGCTGAATTTCAAAATGTGCC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128182892 Original CRISPR TGGGTTTACCCCCAGCGGGT AGG Intronic
901988181 1:13092197-13092219 TGGGTTTCCCCCCAGTGGGAGGG + Intergenic
901993631 1:13134570-13134592 TGGGTTTCCCCCCAGTGGGAGGG - Intergenic
1063975009 10:11408091-11408113 TGGGTTCACACACAGAGGGTGGG + Intergenic
1066689288 10:38010780-38010802 TGGGGTAAGCCCCAGTGGGTTGG + Exonic
1068753416 10:60623097-60623119 TGGGTCTTCCCCCAGAAGGTAGG + Intronic
1075563063 10:123482403-123482425 TGGGTTTAATCCCAGCTGGGTGG + Intergenic
1075709553 10:124523295-124523317 GGGGTTTCCCCCCAGTGGGGTGG + Intronic
1089966509 11:122657913-122657935 TGGGTGTAACCCCAGCAGTTTGG + Intronic
1097201696 12:57284365-57284387 TGGGATTACCCTCAGAGGGTGGG - Intronic
1103322823 12:120101784-120101806 TGGGTTTTTCCCCAGGGGCTTGG - Intronic
1122864761 14:104598636-104598658 TGGGTTTATCCTCAGCACGTTGG - Intronic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1130674084 15:85937113-85937135 TGGGTTCACCCCCTGCATGTGGG - Intergenic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG + Intergenic
1136878763 16:33885482-33885504 TGGGCTTCCCCCGAGCGGTTGGG - Intergenic
1139649605 16:68355760-68355782 TGGGTACTCCCACAGCGGGTGGG - Exonic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1152377359 17:79925652-79925674 TGGGGGTTCCCCCAGCAGGTTGG + Intergenic
1164207854 19:23072837-23072859 GGGGTTTACCCACACCAGGTTGG + Intergenic
1166255137 19:41599015-41599037 TGGATTTACTCCCAGCAGGGAGG - Intronic
1167288209 19:48610692-48610714 GGGGTTCACCCCCAGCTGCTGGG + Exonic
925396556 2:3537460-3537482 TGGCTCTAACCCCAGCGTGTTGG + Intronic
925894066 2:8457731-8457753 TGGGTTCACCCACCGCGGGGAGG - Intergenic
926258196 2:11229415-11229437 TTGGTTTACCAACAGTGGGTGGG + Intronic
927738669 2:25546587-25546609 TGGATTTAGCCCCAGAGGTTAGG - Intronic
928411493 2:31057859-31057881 TGGGTTGAGCCTCAGCTGGTTGG + Intronic
935051950 2:99531590-99531612 TGTGTTGACCCGCAGTGGGTCGG + Intergenic
936508556 2:113127699-113127721 TGGATTTTCTCCCAGAGGGTCGG - Exonic
943568803 2:189547684-189547706 TTGGTTTCCCCTCAGCTGGTGGG + Intergenic
1175831399 20:61966986-61967008 TGGGTCCACCCCGAGCGGGTAGG + Intronic
1185379957 22:50503742-50503764 TGGGTTTACCCCGGGAGGCTGGG + Intronic
961674644 3:128557137-128557159 TGGGTTTCCACCCAGCTGGACGG - Intergenic
968605243 4:1532297-1532319 AGGGTTGCCCCCCAGCAGGTTGG + Intergenic
974838458 4:67277024-67277046 TGGGGTTTCCCCCAGAGGTTAGG + Intergenic
978981493 4:114952002-114952024 TAGGTTTCCCCCCAGGGGATAGG - Intronic
987331748 5:16863286-16863308 TGGGCTTCTCCCCAGTGGGTGGG - Intronic
988577843 5:32444257-32444279 TGGATTCACCCACAGCGGGGCGG - Exonic
992433699 5:76734546-76734568 TGTGTTTACACCCAGTGGATGGG - Exonic
995341630 5:111067315-111067337 TTGTTTTACCCCCACCGGCTGGG + Intergenic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
999520582 5:152346753-152346775 TGGGTTCACCCCCAGTGGAAAGG - Intergenic
1013760387 6:113511092-113511114 TGGGGTTTCCTCCAGCTGGTGGG - Intergenic
1024524561 7:50337059-50337081 TGGGTTTCCCACAAGCGGCTCGG + Intronic
1029618257 7:101673632-101673654 TGGGTATACCTCCAGTGGGCAGG - Intergenic
1034419418 7:150981140-150981162 TGGGGTTACCCACAGGGGATTGG + Intergenic
1036076621 8:5509116-5509138 TGGGTTTTCCCTCAGCCGTTGGG + Intergenic
1037810016 8:22081509-22081531 AGGGTTTTTCCCCGGCGGGTTGG + Exonic
1040408480 8:47132776-47132798 TGGGCTTCCCCCCGCCGGGTGGG - Intergenic
1045400488 8:101811718-101811740 TGGGTTCACTCCCAGCTGGAAGG - Intronic
1051904548 9:22080204-22080226 TGGGTTTTCCCCAAGCTGTTTGG + Intergenic
1055458030 9:76491408-76491430 TGGGTGTCCCCCCAGAGGTTAGG + Intronic
1188097908 X:26045401-26045423 TGGGGTTTCCCCCAGGGGTTGGG - Intergenic
1192266667 X:69543443-69543465 TGGGTTGACTCCCAGAGGCTGGG + Intergenic
1198671710 X:139088206-139088228 TGGGTAAACCCCCAGAGGCTGGG - Intronic
1201271820 Y:12263221-12263243 TGGGTCTTCCCCCAGAGGTTAGG + Intergenic