ID: 1128183790

View in Genome Browser
Species Human (GRCh38)
Location 15:65626872-65626894
Sequence CTCTAAAGTGAGGGTACCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128183786_1128183790 -1 Left 1128183786 15:65626850-65626872 CCAAGTTTTTTGTTCCTTGAGAC 0: 1
1: 0
2: 1
3: 61
4: 674
Right 1128183790 15:65626872-65626894 CTCTAAAGTGAGGGTACCTTAGG 0: 1
1: 0
2: 1
3: 5
4: 89
1128183782_1128183790 18 Left 1128183782 15:65626831-65626853 CCACCACACCCGGATCATTCCAA 0: 1
1: 0
2: 1
3: 36
4: 502
Right 1128183790 15:65626872-65626894 CTCTAAAGTGAGGGTACCTTAGG 0: 1
1: 0
2: 1
3: 5
4: 89
1128183784_1128183790 10 Left 1128183784 15:65626839-65626861 CCCGGATCATTCCAAGTTTTTTG 0: 1
1: 0
2: 0
3: 24
4: 230
Right 1128183790 15:65626872-65626894 CTCTAAAGTGAGGGTACCTTAGG 0: 1
1: 0
2: 1
3: 5
4: 89
1128183783_1128183790 15 Left 1128183783 15:65626834-65626856 CCACACCCGGATCATTCCAAGTT 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1128183790 15:65626872-65626894 CTCTAAAGTGAGGGTACCTTAGG 0: 1
1: 0
2: 1
3: 5
4: 89
1128183785_1128183790 9 Left 1128183785 15:65626840-65626862 CCGGATCATTCCAAGTTTTTTGT 0: 1
1: 0
2: 1
3: 21
4: 264
Right 1128183790 15:65626872-65626894 CTCTAAAGTGAGGGTACCTTAGG 0: 1
1: 0
2: 1
3: 5
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128183790 Original CRISPR CTCTAAAGTGAGGGTACCTT AGG Intronic
901366512 1:8755520-8755542 CACTCAAGTGAGGGTCTCTTTGG + Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
907861194 1:58355348-58355370 CTCTAGATAGAGTGTACCTTTGG + Intronic
912631526 1:111250384-111250406 CTCTAAAGTGAGTGAACCCCGGG + Intergenic
912798221 1:112705641-112705663 CTCCAAAAAGAGGGTTCCTTGGG + Exonic
924453168 1:244197770-244197792 CTCTAAAGTGAGTTTACCTTGGG - Intergenic
924775787 1:247113843-247113865 CTGTAAAGTGGGGGTGCCATGGG + Intergenic
1069419857 10:68237615-68237637 CTCTTGAGTGCTGGTACCTTAGG + Intergenic
1071162134 10:82759638-82759660 CTCTAAAGTGAGAGCACCAGTGG + Intronic
1072503342 10:96041268-96041290 CTCTAAAGTGAAGGCATGTTTGG - Intergenic
1073127591 10:101161411-101161433 CTCTAAAGTGAGTGTAGCCTTGG + Intergenic
1077112604 11:868617-868639 TTCTCAAGTGTGGGTGCCTTGGG + Exonic
1078552893 11:12292649-12292671 CACAGAAGTGAGGGTCCCTTTGG + Intronic
1078928235 11:15893120-15893142 CCCTAAAGAGAGGGAACCATTGG - Intergenic
1079828852 11:25235030-25235052 CTCTAGAGTGACTGTCCCTTGGG + Intergenic
1081353099 11:42079726-42079748 CTCTAAAGTAAGGTTACCATTGG - Intergenic
1090626126 11:128610521-128610543 TTCTAAAATGAGGGTTTCTTGGG - Intergenic
1101934677 12:109047726-109047748 ATTTAAAGAGAGGGTACTTTGGG + Intronic
1104104471 12:125645873-125645895 CTCAAATGTGAGCGTGCCTTTGG + Intronic
1104858918 12:131914813-131914835 CTTTAGGGTGAGGGTGCCTTGGG + Intronic
1107247166 13:38310168-38310190 CTCTACAGTGAAGGGACCGTGGG + Intergenic
1108365485 13:49707580-49707602 CTTTTAAGTGAGGGTATCGTGGG - Intronic
1109224312 13:59674024-59674046 ATCAAAAGTGAGGGTAACCTAGG + Intronic
1109413617 13:62007271-62007293 CTCCAAAATGAGGCTACCTTAGG - Intergenic
1110004173 13:70245458-70245480 CTATAAAGTATGTGTACCTTAGG - Intergenic
1110760268 13:79223408-79223430 CTCTACAGTGAGGGTTCTTGAGG + Intergenic
1111944455 13:94648909-94648931 CTCGAAAGTGTGGGTCCCTGGGG + Intergenic
1116178563 14:41506646-41506668 CTCTTCAGTGAGGGAAACTTTGG + Intergenic
1124347584 15:28932793-28932815 CCCCAAAGTGATGGGACCTTTGG + Intronic
1128183790 15:65626872-65626894 CTCTAAAGTGAGGGTACCTTAGG + Intronic
1132923665 16:2415252-2415274 GTCCAAAGGGAGGGTGCCTTCGG + Intergenic
1137997565 16:53235418-53235440 ATTTAAAGTGAGGTTACCTCAGG + Intronic
1143061833 17:4208434-4208456 CTCTCATGTGAGGCTCCCTTGGG - Intronic
1143816306 17:9518470-9518492 CTCTGAAATGTGGGTTCCTTGGG + Intronic
1153690333 18:7586040-7586062 CTGTAAACTGAGGGTAATTTAGG - Intronic
1155274951 18:24178021-24178043 CTCCAAGGTGATGGTTCCTTTGG + Exonic
1155334336 18:24749239-24749261 CTCCAAAATGAGGCTACCCTTGG - Intergenic
1157661621 18:49449798-49449820 GTCAAAAGAAAGGGTACCTTAGG + Intronic
1158865296 18:61632531-61632553 CTCTGTAGTGAGAGTACATTTGG + Intergenic
1162212117 19:9100560-9100582 TTCATAAGTGAGGATACCTTAGG - Intergenic
1166964961 19:46523959-46523981 TTCAAAAGTCAGAGTACCTTAGG + Intronic
925472087 2:4173800-4173822 GTCAAAAGAAAGGGTACCTTAGG - Intergenic
926820784 2:16849335-16849357 CTGCAAAATGAGGGTTCCTTTGG + Intergenic
928642491 2:33314870-33314892 GTCTAAAATAAGGGTAGCTTTGG + Intronic
933011324 2:77067793-77067815 TTCTGATGTGAGGCTACCTTTGG - Intronic
935493154 2:103745738-103745760 CTATAAAGTGAAGGTAATTTAGG + Intergenic
936838066 2:116732176-116732198 TTCTAAAGTGAAGGTAAGTTTGG + Intergenic
938948881 2:136239262-136239284 CTCTAGAATGAGGGTGCTTTGGG + Intergenic
941108546 2:161391688-161391710 CTGTAGAGTGAGGATCCCTTGGG - Intronic
941601189 2:167545671-167545693 GTCTGAAGTGAGGGTGCCCTGGG - Intergenic
945719821 2:213406034-213406056 GTCAAAAGTGAGGTTGCCTTAGG + Intronic
947315973 2:228858827-228858849 CTCTAAACAGAGGGTGCCTCTGG - Intronic
1170418151 20:16166477-16166499 CTTCAAAGTGTGGGTAGCTTTGG - Intergenic
1171222034 20:23407139-23407161 TTTTAAAGTGAGGCTACCTCTGG - Intronic
1172849951 20:37954400-37954422 CTTTGAAGAGAGGGCACCTTTGG + Intergenic
1182142945 22:27978320-27978342 ATCTAAAATGAGTGTACCTGTGG - Exonic
1182163247 22:28145013-28145035 CTTCAAAGTGAGGTGACCTTGGG - Intronic
1183420996 22:37711069-37711091 CTTTAAGGTCATGGTACCTTGGG + Intronic
949986261 3:9543635-9543657 CTATAAAGTCAGAGTACTTTGGG - Intronic
951045790 3:18037077-18037099 CTCTACAGTGAAGACACCTTTGG + Intronic
963174356 3:142282521-142282543 GTCAAAAGAAAGGGTACCTTAGG + Intergenic
963704777 3:148671937-148671959 CTCTTAAGAGAGAGAACCTTTGG - Intergenic
964642109 3:158919594-158919616 CTCTAAAATGAAGATACCATTGG + Intergenic
970641832 4:18075390-18075412 CTTTTAACTGAGGCTACCTTGGG + Intergenic
971968688 4:33594421-33594443 GTCAAAAGAAAGGGTACCTTAGG + Intergenic
972281163 4:37603328-37603350 AGCTACAGTGAGGGTACCCTGGG + Intronic
979958786 4:126990636-126990658 GTCAGAAGTGAAGGTACCTTGGG - Intergenic
981926864 4:150149892-150149914 CTCTAAAATTTGGGTTCCTTTGG - Intronic
983539426 4:168892889-168892911 CTCTCAAGTGTGGATACCTGTGG - Intronic
997372091 5:133368548-133368570 GTCAGAAGTGAGGGTACCTTAGG + Intronic
999844993 5:155469834-155469856 CTCTCAAGTGTGGGAAGCTTGGG - Intergenic
1000881555 5:166703690-166703712 CCCTAAACTGAGGCTGCCTTAGG + Intergenic
1004213286 6:13674817-13674839 CTTTAAAGTAAGGGTAACATGGG - Intronic
1005181663 6:23113873-23113895 GTCAAAAGAAAGGGTACCTTAGG - Intergenic
1005773694 6:29105202-29105224 CTCTCAAGTTAGGTTACCTGTGG + Intergenic
1010981521 6:82375260-82375282 CTCTACAGTGAGGGAATCTCTGG + Intergenic
1015190707 6:130468672-130468694 TTCTAAAGGGAGGGAACCTGGGG - Intergenic
1016513197 6:144865940-144865962 ATCAAAAGTTAGGGTATCTTTGG - Intergenic
1017286284 6:152680369-152680391 CTCTAAAGTTAGGGTTGGTTAGG + Intergenic
1021308439 7:19061309-19061331 CTCTAAAATAAGTGTTCCTTTGG - Intronic
1025076984 7:55951998-55952020 CTCTCACGCGAGGGTGCCTTGGG - Intronic
1030150149 7:106396280-106396302 GGCTAAAGTGAGGGTAAATTGGG + Intergenic
1030474157 7:110007169-110007191 CTGTAAAGTGTGACTACCTTAGG - Intergenic
1041588060 8:59544842-59544864 ATCTATATTGAGGGTCCCTTAGG + Intergenic
1046354518 8:113063344-113063366 CCATGAAGTGAGGATACCTTTGG - Intronic
1046572451 8:115983548-115983570 CTCTAAAGTGTAGGCAACTTTGG + Intergenic
1048675562 8:136775306-136775328 CTGTAAAGGGAGAGTATCTTAGG + Intergenic
1048717759 8:137287015-137287037 CTATAAAAAGAGGGTGCCTTTGG - Intergenic
1050046269 9:1549422-1549444 CTCTATAGTGAAGAAACCTTTGG + Intergenic
1190823729 X:53997797-53997819 CTCTCAGGTGTGGCTACCTTGGG - Intronic
1190962363 X:55265086-55265108 ATCTAAAGTAAGGGTCCCTGAGG + Intronic
1191911985 X:66161122-66161144 CTCTAATGTGAAGGTCCCTGGGG + Intergenic
1194041344 X:88945408-88945430 CTTTGAACTGAGGGTACTTTGGG - Intergenic
1195621384 X:106959220-106959242 CTCTAAAGTGTAGGTAACTGAGG - Intronic
1198418671 X:136447019-136447041 CTCAATAGTCAGGGTACCTTTGG - Intergenic
1200067997 X:153514194-153514216 CTCTGAAGTGAGGACCCCTTTGG - Intergenic