ID: 1128185973

View in Genome Browser
Species Human (GRCh38)
Location 15:65643778-65643800
Sequence TCGGGCTCTTGTTGTGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128185961_1128185973 20 Left 1128185961 15:65643735-65643757 CCTCCAGCAAAGCATGTGCATAG 0: 1
1: 0
2: 1
3: 18
4: 143
Right 1128185973 15:65643778-65643800 TCGGGCTCTTGTTGTGCCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1128185959_1128185973 29 Left 1128185959 15:65643726-65643748 CCCTGTGGGCCTCCAGCAAAGCA 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1128185973 15:65643778-65643800 TCGGGCTCTTGTTGTGCCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1128185960_1128185973 28 Left 1128185960 15:65643727-65643749 CCTGTGGGCCTCCAGCAAAGCAT 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1128185973 15:65643778-65643800 TCGGGCTCTTGTTGTGCCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1128185964_1128185973 17 Left 1128185964 15:65643738-65643760 CCAGCAAAGCATGTGCATAGGGA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1128185973 15:65643778-65643800 TCGGGCTCTTGTTGTGCCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128185973 Original CRISPR TCGGGCTCTTGTTGTGCCTG GGG Intronic
904818618 1:33224963-33224985 TCTGGCTCTTGTGGTTTCTGTGG - Intergenic
910365836 1:86464441-86464463 TTGTGCTTTTGTTGTGCATGAGG - Intergenic
910715081 1:90222101-90222123 TAGGTCTCTTGTTAGGCCTGGGG + Intergenic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
917807832 1:178629794-178629816 CCTGGCTCTTCTTGTGCCTGAGG - Intergenic
1066109381 10:32182700-32182722 TCGGGCAGTTGCTGTGTCTGCGG - Intergenic
1067692669 10:48511943-48511965 TCAGGCTGTTGTTGAGACTGGGG - Intronic
1068766584 10:60770917-60770939 TCAGGGTCTTGTAGTGCCTGAGG - Intergenic
1069557098 10:69405708-69405730 TCAGGATCTTGTAGAGCCTGGGG + Intronic
1075400599 10:122158924-122158946 TGGGGCTCTGGCTGTGCTTGGGG + Intronic
1077269563 11:1669125-1669147 TGGGGCTCTTCTTATGCCTCGGG + Intergenic
1084164738 11:67370322-67370344 TCAGGCTCATGTTGTGCAGGTGG + Intronic
1088996816 11:115007610-115007632 AGTGGCTCTTGTTGTGCCTTAGG - Intergenic
1093567423 12:20624527-20624549 GGGGGCTCTTGCTATGCCTGTGG - Intronic
1094622103 12:32089606-32089628 TTGTGCTCTTGATGTGACTGAGG + Intergenic
1097706479 12:62874065-62874087 TGGGGCTCATGATCTGCCTGTGG - Intronic
1102417613 12:112778120-112778142 TCTGGCTCTTCTTGTGTTTGGGG - Intronic
1110153629 13:72286010-72286032 TCAGCCTCTAGTTGTACCTGTGG - Intergenic
1122088244 14:99321655-99321677 CAGGGCTCTTGGTGTGCCTGTGG - Intergenic
1128185973 15:65643778-65643800 TCGGGCTCTTGTTGTGCCTGGGG + Intronic
1129267640 15:74402607-74402629 CTGGGCTCTTGTGGTGGCTGGGG + Intergenic
1132567534 16:630339-630361 TCGGGCTGTTCTTATGCTTGTGG + Intronic
1134892893 16:17856642-17856664 TCAGGCTCTTTTTGTACATGCGG - Intergenic
1135571415 16:23552185-23552207 TCAGACTCGCGTTGTGCCTGGGG - Exonic
1139464579 16:67147463-67147485 TGGGGCTCTTTCTGTGACTGAGG + Exonic
1143400082 17:6638045-6638067 TGGGGTTCCTGTGGTGCCTGAGG - Intronic
1144848239 17:18231102-18231124 TCAGGTTCTTTTTGAGCCTGAGG - Intronic
1144850161 17:18240182-18240204 TCGGGGTCTTGTGGGGCTTGGGG + Intronic
1145760366 17:27422076-27422098 TCGGGCTCTGGTCCTGGCTGGGG + Intergenic
1146160385 17:30556370-30556392 TCGGGCTCTGGTTCTCGCTGGGG + Intergenic
1149243310 17:54676512-54676534 TCTACCTCTTGTTTTGCCTGAGG - Intergenic
1151518816 17:74614184-74614206 AAGGGCTCTTTTTGTCCCTGAGG - Intronic
1158165523 18:54535360-54535382 GCTGGCTGTTGTTGTGGCTGTGG - Intergenic
1159609600 18:70511028-70511050 TTGGGTTCTTACTGTGCCTGTGG + Intergenic
1161574534 19:5048376-5048398 CCGGGCTCTGCTTGTGACTGCGG + Intronic
1165390647 19:35536857-35536879 GTGGGCTCTGGTTGTGGCTGGGG - Exonic
925237817 2:2294310-2294332 CCAGGCTTTTGTTGTGCTTGGGG - Intronic
927098286 2:19764787-19764809 TTGGGCTCTGGTTGAGCCTGAGG - Intergenic
931201944 2:60106086-60106108 TCGGGCTCTGGTTGGGGGTGGGG - Intergenic
932671613 2:73742076-73742098 CCGGGCTTCTGTTGTGCCTCAGG - Intergenic
938061790 2:128260856-128260878 TCCAGCTCTTGCTGTGCCTGAGG + Intronic
938078396 2:128354454-128354476 TCGGGGTCTTGCTGTGGGTGGGG - Intergenic
940023485 2:149180772-149180794 CCGGGTCCTTTTTGTGCCTGTGG - Intronic
941156387 2:161983068-161983090 ACGGGCTCTTGTGGTGCTTTGGG + Intronic
947610981 2:231525053-231525075 TCGGTCTCTTGCTGCGCCTCTGG + Exonic
1170575758 20:17660186-17660208 GCGGGCTCCTGCTGTGGCTGTGG - Exonic
1173662408 20:44743818-44743840 TCGGGCTCTTGTTGGGCTGTGGG + Intergenic
1176090271 20:63315483-63315505 TCGGGCTCTTCCTGGGCGTGGGG + Intronic
1178227183 21:30734818-30734840 TCTGGCTCCTGTTGAGTCTGTGG - Intergenic
1178228703 21:30755293-30755315 TCTGGCTCTGGCTGTGGCTGTGG - Exonic
1179726514 21:43344182-43344204 TCTGGCTTTTGCTGTGCCTGAGG - Intergenic
1181133245 22:20746837-20746859 TCTGGCTTTTGTGGGGCCTGAGG - Intronic
1181163578 22:20971711-20971733 TCGGGCCCATGCTGTGCCAGGGG + Intronic
953339650 3:42122769-42122791 TTGGGCTATTGCTCTGCCTGGGG + Intronic
954412627 3:50377691-50377713 TGGGGCTATGGGTGTGCCTGGGG - Intronic
961780289 3:129316851-129316873 CCGGGTTCTGGTTGTGCCTCTGG + Intergenic
962461058 3:135612985-135613007 TTGGGCTGGTGTTGTGTCTGTGG - Intergenic
963268399 3:143261508-143261530 TTCTGCTGTTGTTGTGCCTGTGG - Intergenic
968443570 4:636678-636700 TCCGTGTCTTGTTCTGCCTGCGG + Intronic
971303730 4:25462816-25462838 TTGGGCTCCTGTTGTGCCCTGGG + Intergenic
980532539 4:134073466-134073488 ACGGGCTGGTGTTGTGTCTGAGG + Intergenic
985685848 5:1281062-1281084 TGGGACTGTTGTTCTGCCTGGGG - Intronic
985984551 5:3503983-3504005 AGGGGCTCTTGCTGGGCCTGCGG - Intergenic
986716849 5:10531059-10531081 GCGGGGTCTTGCTGTACCTGGGG + Intergenic
992487018 5:77207339-77207361 TCAGGATCTTGCAGTGCCTGTGG + Intergenic
998639006 5:143988037-143988059 TGTGGCTCTTGTTCTTCCTGTGG + Intergenic
999830537 5:155314851-155314873 TTTGGCTGTTGTTATGCCTGAGG + Intergenic
1009036967 6:58129280-58129302 ACAGCCTCTTGATGTGCCTGAGG - Intergenic
1009212771 6:60882885-60882907 ACAGCCTCTTGATGTGCCTGAGG - Intergenic
1011810977 6:91132005-91132027 TCTTGCTATTCTTGTGCCTGGGG + Intergenic
1019587663 7:1813949-1813971 GCGGGCTTCTGTTCTGCCTGAGG + Intergenic
1020118198 7:5488037-5488059 CCGGGCTCAGCTTGTGCCTGAGG + Intronic
1022321173 7:29289266-29289288 TCGGCCACTTGTTGAGGCTGAGG + Intronic
1023162604 7:37311891-37311913 TGGGAATCTTGTTTTGCCTGAGG - Intronic
1027202267 7:76071733-76071755 CCAGGCTCGTGTTCTGCCTGTGG - Intergenic
1027678967 7:81195095-81195117 TTGGACTCTTGGTTTGCCTGGGG + Intronic
1029482613 7:100822421-100822443 TCGGGAGCTGGTTGTGCCCGTGG - Exonic
1029490065 7:100866157-100866179 TCCGGATCTTCCTGTGCCTGGGG + Exonic
1035419101 7:158712163-158712185 TCTGGCTCACGTTGTCCCTGAGG - Intergenic
1035923317 8:3701835-3701857 TCTGGCTTTTGTTGTGGCTCAGG - Intronic
1037061949 8:14524231-14524253 TCTTGCTCTTGTGGTGCCAGAGG - Intronic
1037654490 8:20871578-20871600 TGGGTCTCTTGCTGTGTCTGTGG - Intergenic
1049010571 8:139884452-139884474 TTGGGCCCCTGTTCTGCCTGTGG + Intronic
1052836900 9:33257172-33257194 TCTGCCTCTTCTTGTGACTGGGG - Intronic
1053208140 9:36205356-36205378 TGGGGCTGTTGTTGAGCCTGTGG + Intronic
1055142784 9:72895119-72895141 TTGGGCACTTGTTGTGTCTTAGG + Intergenic
1055935050 9:81597007-81597029 TTGGGCACTTGATTTGCCTGTGG - Intronic
1060144261 9:121237625-121237647 TTGGGTTGTTGATGTGCCTGTGG - Intronic
1060163349 9:121387575-121387597 TCAGGCTCTTGCTCTGCCTATGG - Intergenic
1186626151 X:11295920-11295942 TGGAACTCTGGTTGTGCCTGGGG - Intronic
1190784678 X:53634037-53634059 TTGGGCTCTTGATGTGCTGGTGG - Intronic
1194932187 X:99901551-99901573 TCGGGCTGTTGCAGGGCCTGGGG - Intergenic
1199982420 X:152928334-152928356 AAGGGCCCTTGCTGTGCCTGAGG + Intronic