ID: 1128187976

View in Genome Browser
Species Human (GRCh38)
Location 15:65660001-65660023
Sequence ACCCCAGACGGTTCTCTTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128187971_1128187976 0 Left 1128187971 15:65659978-65660000 CCACCAACCACAAATAGAAGAGA 0: 1
1: 0
2: 1
3: 23
4: 279
Right 1128187976 15:65660001-65660023 ACCCCAGACGGTTCTCTTGGAGG 0: 1
1: 0
2: 2
3: 9
4: 126
1128187972_1128187976 -3 Left 1128187972 15:65659981-65660003 CCAACCACAAATAGAAGAGAACC 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1128187976 15:65660001-65660023 ACCCCAGACGGTTCTCTTGGAGG 0: 1
1: 0
2: 2
3: 9
4: 126
1128187973_1128187976 -7 Left 1128187973 15:65659985-65660007 CCACAAATAGAAGAGAACCCCAG 0: 1
1: 0
2: 1
3: 22
4: 192
Right 1128187976 15:65660001-65660023 ACCCCAGACGGTTCTCTTGGAGG 0: 1
1: 0
2: 2
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128187976 Original CRISPR ACCCCAGACGGTTCTCTTGG AGG Exonic
900336919 1:2169028-2169050 ACCCCAGCTTGTTCCCTTGGAGG + Intronic
900725643 1:4214684-4214706 ACCACAGATAGTTCACTTGGTGG + Intergenic
900847299 1:5114184-5114206 CCCCCATACTGTTCTCATGGTGG - Intergenic
900847994 1:5118933-5118955 CCCCCATACTGTTCTCGTGGTGG - Intergenic
904143354 1:28370374-28370396 ACTCCCGACGTTTTTCTTGGTGG + Intronic
905026658 1:34855151-34855173 AGCCCAGACTGTTCACTTTGGGG - Exonic
906100663 1:43258511-43258533 CCCACAGACTGTTCTTTTGGAGG - Intronic
907318178 1:53585873-53585895 ACCCCAGAAGTTTCTGTAGGGGG - Intronic
909298798 1:73984498-73984520 CCCCCATACTGTTCTCATGGTGG - Intergenic
913226632 1:116706161-116706183 CCCCCATACTGTTCTCATGGTGG + Intronic
916854533 1:168736467-168736489 AGCCCTGCCAGTTCTCTTGGAGG + Intergenic
922742690 1:228023044-228023066 GCCCCAGACCGTCCTCCTGGAGG - Intronic
923338703 1:232990664-232990686 ACCTCAGAGGTTTCCCTTGGTGG + Intronic
923447179 1:234082804-234082826 CCCCCATACTGTTCTCCTGGTGG - Intronic
923935980 1:238760858-238760880 CCCCCATACTGTTCTCGTGGTGG - Intergenic
1064196555 10:13248426-13248448 CCCCCATACCGTTCTCGTGGTGG - Intergenic
1066426771 10:35314406-35314428 ACCCCATACTGTTCTCTTGGTGG - Intronic
1067429783 10:46235472-46235494 CCCCAAGGCTGTTCTCTTGGGGG + Intergenic
1074064514 10:110001773-110001795 ACTCCAAATGGTTCTGTTGGAGG + Intronic
1074081466 10:110171022-110171044 AACCCAGACTATTTTCTTGGAGG + Intergenic
1074707859 10:116151448-116151470 ACCACTGACTCTTCTCTTGGGGG + Intronic
1075225164 10:120622269-120622291 TCCCCATACTGTTCTCGTGGTGG + Intergenic
1079722627 11:23837551-23837573 AGCCCAGAAGATACTCTTGGAGG - Intergenic
1085658277 11:78337510-78337532 AACCCACACCGTTCTCTTAGAGG + Intronic
1094176061 12:27542852-27542874 AGCACAGACGGCTCTCTTGAAGG + Intronic
1097803525 12:63940616-63940638 ACCACAGACAGTTCTCCTTGTGG - Intronic
1097861384 12:64521898-64521920 ACCCCAGAGGGTTCTGAAGGTGG - Intergenic
1101696566 12:107132731-107132753 CCCCCATACTGTTCTCATGGTGG + Intergenic
1103485241 12:121278559-121278581 CCCCCATACTGTTCTCATGGTGG + Intronic
1103987127 12:124774995-124775017 ACCCCATACTGTTCTCCTGGTGG + Intergenic
1107728632 13:43325837-43325859 ATTCTAGACTGTTCTCTTGGGGG + Intronic
1111685942 13:91500866-91500888 CCCCCATACTGTTCTCATGGTGG + Intronic
1111692444 13:91581059-91581081 CCCCCATACTGTTCTCTTGATGG - Intronic
1112116968 13:96366680-96366702 ACCCCAGATGATTCTGGTGGGGG + Intronic
1113636656 13:111923524-111923546 GCTGCAGACGGTTCTCTTGGAGG - Intergenic
1115007009 14:28498407-28498429 TCCCCATACTGTTCTCGTGGTGG - Intergenic
1115504176 14:34078575-34078597 CCCCCACACTGTTCTCGTGGTGG + Intronic
1115883235 14:37944357-37944379 CCCCCATACTGTTCTCATGGTGG - Intronic
1118443434 14:65831556-65831578 ACCCCAGGCGGGTCCCTTGAGGG - Intergenic
1122633933 14:103121689-103121711 TCCCCAGCCGGTGCTCTGGGCGG + Intergenic
1126894711 15:53245847-53245869 TCCCCATACTGTTCTCATGGTGG + Intergenic
1128187976 15:65660001-65660023 ACCCCAGACGGTTCTCTTGGAGG + Exonic
1128609988 15:69065628-69065650 ACCCCAGGCGGTGGTCTTGAAGG + Intergenic
1129857943 15:78838258-78838280 GCCCCAGCCTGCTCTCTTGGGGG + Intronic
1131915471 15:97260652-97260674 CCCCCATACTGTTCTCGTGGTGG + Intergenic
1134642204 16:15838139-15838161 GACCCAGACGAGTCTCTTGGCGG + Exonic
1135661942 16:24304549-24304571 ACCCCAGTCTGTGCTGTTGGAGG - Intronic
1137392794 16:48095190-48095212 CCCCCATACTGTTCTCATGGTGG + Intronic
1137414026 16:48255700-48255722 CCCCCATACTGTTCTCTTGGTGG + Intronic
1138335021 16:56246174-56246196 ACTCCACACTGTGCTCTTGGAGG + Intronic
1141714392 16:85718397-85718419 ACCCCAGACGTTTCACTTGGAGG + Intronic
1143915771 17:10291740-10291762 CCCCCATACTGTTCTCGTGGTGG + Intergenic
1146828631 17:36047255-36047277 ACCACAGACAATTCTGTTGGTGG + Intergenic
1146952013 17:36913383-36913405 GCCCCAGACTGATCTCTTGCAGG + Intergenic
1148584098 17:48764846-48764868 ACCCCATACGGTATTCTAGGAGG + Intronic
1149002613 17:51772868-51772890 TCCCCAGAAGCTTCTGTTGGTGG - Intronic
1151129798 17:71884796-71884818 CCCCCATACTGTTCTCATGGAGG + Intergenic
1151948929 17:77337602-77337624 GGTCCAGACGGTTTTCTTGGTGG - Intronic
1151957548 17:77387985-77388007 ACCCCAGACCCCTCTCTTGTAGG + Intronic
1155644013 18:28055231-28055253 TCCCCACACTGTTCTCATGGTGG - Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1158670900 18:59472959-59472981 TCCCCATACTGTTCTCATGGTGG - Intronic
1159381027 18:67659352-67659374 CCCCCATACAGTTCTCTTGGTGG + Intergenic
1159915474 18:74183711-74183733 CCTCCAGACAGTGCTCTTGGAGG - Intergenic
1160003976 18:75054554-75054576 AGCCCAGCCGGTCCTCCTGGAGG - Intronic
1162421188 19:10567019-10567041 ACCCCACGGGGTTCTCTTGCTGG + Exonic
926420278 2:12689203-12689225 ACTTCAGAGGGTTGTCTTGGTGG + Intergenic
930222227 2:48756190-48756212 ACCCCAGTAATTTCTCTTGGTGG + Intronic
933764139 2:85695610-85695632 ACCCCAGAGGATCCTCCTGGAGG - Intronic
934054843 2:88242935-88242957 CCCCCATACTGTTCTCATGGTGG + Intergenic
934602072 2:95665312-95665334 ATCCCAGAAAGTTCTCTTGTGGG + Intergenic
934776375 2:96940228-96940250 ACCCCATACCGTTCTCATGCCGG - Intronic
935496920 2:103793432-103793454 ACCCCATACCGTTCTCATGGTGG - Intergenic
936379681 2:111973356-111973378 AACCCAGACGCTTGTCTTGGTGG - Intronic
936535426 2:113307467-113307489 ATCCCAGAAAGTTCTCTTGTGGG + Intergenic
945144435 2:206722229-206722251 CCCCCATACTGTTCTCATGGTGG + Intergenic
946480915 2:220055716-220055738 CCCCCATACTGTTCTCGTGGTGG + Intergenic
948064774 2:235069406-235069428 CCCCCATACTGTTCTCATGGTGG - Intergenic
1169526741 20:6436405-6436427 ACCCCAGATGGTTCTGTTGCAGG - Intergenic
1170031636 20:11950026-11950048 ACCCCAGACGGTTTTATCTGAGG + Intergenic
1174448354 20:50605268-50605290 GCCACAGAGGGTTGTCTTGGGGG - Intronic
1179827048 21:43971973-43971995 AACCCAGGCAGGTCTCTTGGTGG + Intronic
949745920 3:7291907-7291929 CCCCCATACTGTTCTCATGGTGG + Intronic
950412347 3:12847260-12847282 TCCCCATACTGTTCTCGTGGTGG + Intronic
952247234 3:31607428-31607450 TCCCCATACTGTTCTCCTGGTGG + Intronic
952561351 3:34597295-34597317 AACCAACATGGTTCTCTTGGTGG + Intergenic
953225139 3:41011780-41011802 GCCCCAGACTGTGCTTTTGGGGG - Intergenic
958423816 3:93958668-93958690 CCCCCATACTGTTCTCATGGTGG + Intronic
958660682 3:97062640-97062662 CCCCCATACTGTTCTCATGGTGG + Intronic
959459132 3:106603154-106603176 ACCCTAAAAGGTTCTCTTTGAGG - Intergenic
965169313 3:165240634-165240656 CCCCCATACTGTTCTCATGGTGG + Intergenic
968323346 3:197791170-197791192 ACCCCGGACGGTTCCCGTGATGG - Intergenic
968387371 4:154039-154061 CCCCCATACTGTTCTCATGGTGG + Intronic
968749933 4:2383284-2383306 CCCCCATACTGTTCTCATGGTGG + Intronic
969596981 4:8155000-8155022 CCCCCATACTGTTCTCATGGTGG - Intronic
970966698 4:21936249-21936271 CCCCCATACTGTTCTCTTGATGG + Intronic
971721236 4:30247336-30247358 ACCCCAGATCGTTCTGCTGGTGG - Intergenic
972629070 4:40827936-40827958 CCCCCATACTGTTCTCGTGGTGG + Intronic
972646115 4:40968919-40968941 CCCCCATACTGTTCTCATGGTGG + Intronic
973162329 4:47032941-47032963 AACCCAGACTGTGCTCTCGGTGG - Intronic
977391740 4:96418611-96418633 AACCCAGAAGGTACTATTGGTGG + Intergenic
979547635 4:121955458-121955480 CCCCCATACTGTTCTCATGGTGG - Intergenic
981512400 4:145572324-145572346 CCCCCATACTGTTCTCATGGTGG - Intergenic
981863038 4:149379935-149379957 CCCCCATACTGTTCTCATGGTGG + Intergenic
981976193 4:150731212-150731234 CCTCCAGACTGTTCTCATGGTGG - Intronic
983083144 4:163412578-163412600 ACCCCATACTGTTCTCCTGTTGG + Intergenic
984762629 4:183376372-183376394 GCCCCAGAGGGTCCACTTGGAGG - Intergenic
988834453 5:35017450-35017472 CCCCCATACTGTTCTCATGGTGG + Intronic
999794646 5:154977678-154977700 ACTCCATACTGTTCTCATGGTGG + Intergenic
1003661722 6:8068467-8068489 ACACCAGAAGCTTCTCTAGGGGG - Intronic
1014825078 6:126040788-126040810 ACTCCAGACGGTTACCTTGGTGG + Intergenic
1015555120 6:134453129-134453151 ACCCCAGAAGATTCTGATGGAGG + Intergenic
1016565021 6:145442534-145442556 CCCCCATACTGTTCTCATGGTGG - Intergenic
1026433218 7:70368857-70368879 ACCCCTCACGCTGCTCTTGGTGG - Intronic
1026557262 7:71419375-71419397 ACCTCATACGATTATCTTGGGGG + Intronic
1027728554 7:81839767-81839789 CCCCCATACTGTTCTCATGGTGG + Intergenic
1028134033 7:87207961-87207983 CCCCCATACTGTTCTCGTGGTGG - Intronic
1035990356 8:4483106-4483128 CCCCCATACTGTTCTCCTGGTGG + Intronic
1037141605 8:15526518-15526540 CCCCCATACTGTTCTCCTGGTGG + Intronic
1037494819 8:19428455-19428477 CCCCCACACAGTTCTCATGGTGG - Intronic
1038848489 8:31251812-31251834 CCCCCATACTGTTCTCGTGGTGG - Intergenic
1039320272 8:36422347-36422369 CCCCCATACTGTTCTCATGGTGG + Intergenic
1039989342 8:42474948-42474970 ATTCCAGATGGTTCTCATGGTGG + Intronic
1043088069 8:75861914-75861936 CCCCCATACTGTTCTCATGGTGG + Intergenic
1045270276 8:100655453-100655475 CCCCCATACTGTTCTCGTGGTGG + Intronic
1045646885 8:104308068-104308090 CCCCCATACTGTTCTCATGGTGG - Intergenic
1046606910 8:116381556-116381578 CCCCCATAACGTTCTCTTGGTGG - Intergenic
1055252144 9:74320580-74320602 CCCCCATACTGTTCTCGTGGTGG + Intergenic
1055394536 9:75860033-75860055 ACCTCAGAGGATTTTCTTGGAGG + Intergenic
1055815100 9:80195608-80195630 CCCCCATACTGTTCTCATGGTGG + Intergenic
1056367034 9:85915900-85915922 CCCCCATACTGTTCTCATGGTGG + Intergenic
1058892810 9:109375277-109375299 CCCCCATACTGTTCTCGTGGTGG + Intergenic
1061386804 9:130295291-130295313 ACCCCAGTGGATTCTCATGGTGG + Intronic
1062466217 9:136682781-136682803 ACCCCAGAGGGGTCTCTTACGGG - Intronic
1188684628 X:33054613-33054635 ACCGCAGAAGGTTTTCTAGGGGG + Intronic
1190286098 X:48962368-48962390 ACCCCAGACATTTTTCCTGGTGG - Exonic
1192132763 X:68568394-68568416 ACCCCATACTGTTCTCCTGGTGG - Intergenic
1199147180 X:144381676-144381698 CCCCCATACTGTTCTCATGGTGG + Intergenic