ID: 1128189891

View in Genome Browser
Species Human (GRCh38)
Location 15:65682196-65682218
Sequence ATGCCCATCTAGGACTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128189891_1128189894 -6 Left 1128189891 15:65682196-65682218 CCATCAAAGTCCTAGATGGGCAT 0: 1
1: 0
2: 1
3: 5
4: 101
Right 1128189894 15:65682213-65682235 GGGCATCTTCTTCCAATACAGGG 0: 1
1: 16
2: 277
3: 560
4: 673
1128189891_1128189893 -7 Left 1128189891 15:65682196-65682218 CCATCAAAGTCCTAGATGGGCAT 0: 1
1: 0
2: 1
3: 5
4: 101
Right 1128189893 15:65682212-65682234 TGGGCATCTTCTTCCAATACAGG 0: 1
1: 0
2: 2
3: 18
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128189891 Original CRISPR ATGCCCATCTAGGACTTTGA TGG (reversed) Intronic
900327017 1:2113378-2113400 CTCCCCATCTTGGGCTTTGAGGG + Intronic
900748177 1:4375596-4375618 ATGGTCACCTAGGATTTTGATGG + Intergenic
903224678 1:21887844-21887866 GAGCCCATCAAGGACTATGAGGG - Intronic
903375449 1:22863038-22863060 TTGTCCATCTGGGACTTTCAAGG + Exonic
905885749 1:41491004-41491026 GTGCCCATCTAGGTCATTCATGG - Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
910819265 1:91328618-91328640 AAGCCCATGTATGTCTTTGAGGG + Intronic
911339530 1:96619793-96619815 ATTCCCAAATAGGACTTTGTAGG - Intergenic
913741004 1:121844414-121844436 AGGCTCAACTCGGACTTTGAAGG + Intergenic
917044633 1:170845555-170845577 AAACCCATGTAGGGCTTTGATGG - Intergenic
918392149 1:184077084-184077106 AATGCCATCTAGGACTTTCATGG + Intergenic
918880945 1:190120026-190120048 ATGCTCGTCTAGCAGTTTGAAGG - Intronic
924827066 1:247550690-247550712 ATGCTCATCCTGAACTTTGATGG - Intronic
1064293144 10:14053651-14053673 CTGCCCATCTTTGACTTGGAAGG + Intronic
1064917558 10:20477494-20477516 ATGCTCATGGATGACTTTGAGGG + Intergenic
1071754439 10:88520915-88520937 AAGCCCAGCCAAGACTTTGATGG - Intronic
1075103749 10:119523843-119523865 AAGCCCCTGTAGGACTTTAATGG - Intronic
1075698888 10:124455707-124455729 ATGTCCATCAAGGGCTATGATGG - Intergenic
1083715616 11:64574386-64574408 GTGCCCATCTAGGGCATGGATGG - Intergenic
1087517870 11:99188164-99188186 ATGTCCAACTAGTCCTTTGATGG + Intronic
1087593366 11:100221009-100221031 ATGCCCATCGTGGACCTTGGGGG + Intronic
1089130737 11:116209932-116209954 ATGCCCATCTAGCTCTGTGCCGG + Intergenic
1091105604 11:132916723-132916745 AAGACCATCTAAGACTTTGTAGG + Intronic
1096226954 12:49872217-49872239 ATGCACAATTAGGACTATGAAGG + Intronic
1102748783 12:115273708-115273730 ATGCCCAAGAATGACTTTGAGGG - Intergenic
1105241715 13:18614688-18614710 TTCCCCATTTAGGACTTTGGGGG + Intergenic
1110282531 13:73711963-73711985 ATCCTCATCGATGACTTTGAGGG + Intronic
1110521634 13:76486085-76486107 ATGCCCATCTAGGACTTGAATGG + Intergenic
1114081121 14:19201907-19201929 TTGCCCACCTAGGACTTCGGGGG - Intergenic
1115379097 14:32713441-32713463 AATGCCATCTAGGACTTTCATGG - Intronic
1117094295 14:52281972-52281994 ATCCCCATCTAGGCCTCTGTAGG - Intergenic
1117790827 14:59340029-59340051 ATGTCCCTGTTGGACTTTGATGG + Intronic
1120960707 14:90122102-90122124 ATGCCCATCATAGACTATGATGG - Intronic
1121219258 14:92273921-92273943 AAGCCTATCTAGGAATCTGAAGG - Intergenic
1123705436 15:22947642-22947664 CTGCCCCTCCAGCACTTTGAGGG - Intronic
1124791904 15:32735632-32735654 ATGGCCTTCTTGGACTTGGAGGG + Exonic
1124954276 15:34349762-34349784 CTGTACATCTAGGACTTTGGGGG - Intronic
1125043658 15:35221587-35221609 TTTCCCATCTAGGACCTTAAGGG - Intronic
1128189891 15:65682196-65682218 ATGCCCATCTAGGACTTTGATGG - Intronic
1128744562 15:70104265-70104287 ATGCCCACCTGAGACTTTGTGGG + Intergenic
1128952224 15:71897648-71897670 ATGCCAATCTAGTACTGTCAAGG - Exonic
1131059376 15:89395263-89395285 CTGCCCATCTGGGACTTGGCAGG + Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1133899227 16:9957747-9957769 ATGCCCCTCGATGACTCTGAAGG + Intronic
1136043799 16:27600284-27600306 ATGTTCATCTAGGAATTTAAAGG - Intronic
1136742901 16:32555119-32555141 AAGCCCATTTAGGCCTGTGAAGG + Intergenic
1203026697 16_KI270728v1_random:520110-520132 AAGCCCATTTAGGCCTGTGAAGG - Intergenic
1203045024 16_KI270728v1_random:814321-814343 AAGCCCATTTAGGCCTGTGAAGG + Intergenic
1146721504 17:35127259-35127281 GTGGCCATCTGGGACTTCGATGG - Exonic
1147968040 17:44204581-44204603 AGGACCATCTAGGCCTCTGATGG - Intergenic
1149160988 17:53692682-53692704 TGGCCCATCTAGCACTTTTATGG + Intergenic
1150833776 17:68546327-68546349 ATCCCCATGGATGACTTTGAGGG - Intronic
1151232608 17:72695467-72695489 ATGCCCAGTTAGTACTTGGATGG - Intronic
1154447247 18:14445218-14445240 TTCCCCATTTAGGACTTTGGGGG - Intergenic
1155332342 18:24731045-24731067 ATTGCCATATAGTACTTTGATGG + Intergenic
1155400659 18:25435509-25435531 ATGCACAAATAGAACTTTGAGGG - Intergenic
1155626520 18:27841347-27841369 ATCCCCATGGATGACTTTGAGGG + Intergenic
1155652862 18:28161659-28161681 ATGCCCATCTCGCCCTCTGAGGG + Intronic
1155717606 18:28965982-28966004 ATGCCCATCTTCAACTTTGCTGG - Intergenic
1161853413 19:6750612-6750634 GTGGCCATCTACCACTTTGAAGG + Exonic
1164954535 19:32370831-32370853 ATTCTCTTCTAGGAATTTGATGG + Intronic
926810624 2:16752452-16752474 ATGCCCACCTTTGCCTTTGATGG + Intergenic
927133351 2:20079357-20079379 AGGACCATATAGGACTTTGAGGG - Intergenic
931414835 2:62071342-62071364 ATCACCATCTTGGACTTGGAGGG + Intronic
936518009 2:113194241-113194263 TTGCCCTTCTCAGACTTTGAAGG - Intronic
939706508 2:145460154-145460176 ATGCCAAAGTAGGAATTTGAAGG + Intergenic
940377531 2:152972383-152972405 ATGCCCTTCTAGGACATCCAGGG - Intergenic
1175902277 20:62364695-62364717 ATGCCCACCTGGGGCTGTGAGGG + Intronic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
951454641 3:22876643-22876665 ATGCCCCTCTTAGACTTGGATGG - Intergenic
956231336 3:67019929-67019951 AAGCCCATCTAGGAATCTAAAGG - Intergenic
957500477 3:81050938-81050960 ATTTCCTTCTAGGACTTTTAAGG + Intergenic
959209464 3:103358426-103358448 ATTTCCATCTGGGACTTTGGAGG - Intergenic
962882348 3:139590059-139590081 ATGTCCAGCTAGGACCTGGAGGG + Intronic
964160196 3:153637342-153637364 ATGCACATCTAGAACATTGCTGG - Intergenic
972075857 4:35086216-35086238 ATATCCATCCAAGACTTTGAAGG + Intergenic
979672582 4:123376142-123376164 ATTCCCATCTGGGATTTTTAAGG - Intergenic
991456907 5:66813836-66813858 ATGCAAATCTAGTAGTTTGATGG + Intronic
993257792 5:85616154-85616176 AAGCCCATTTAAGACTTTGGGGG - Intergenic
996464943 5:123789400-123789422 GAGGCCATCTAGGACTTTCATGG + Intergenic
997073982 5:130650221-130650243 ATGCCTATCTAGGACAATAAAGG - Intergenic
998471684 5:142388673-142388695 ATGCCCAACTAGGTCTTTGCTGG - Intergenic
1002166542 5:177351252-177351274 ATGCCCCTCTGGGACTTCCAGGG - Exonic
1004188452 6:13443092-13443114 ATCCCCATGAATGACTTTGAGGG + Intronic
1004474173 6:15955794-15955816 ATGTCTATCAAGGACTGTGAAGG - Intergenic
1005399164 6:25413845-25413867 ATGCACATCTTTGGCTTTGAAGG - Intronic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1010335522 6:74678143-74678165 AAGCCAATCAAGGAATTTGATGG - Intergenic
1011760614 6:90561504-90561526 ATGCCCTTTTGGGACTCTGACGG + Intronic
1015144932 6:129975319-129975341 ATGCTCATAGATGACTTTGAAGG + Intergenic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1020565006 7:9784418-9784440 ATGCACATCAAGGGTTTTGATGG + Intergenic
1022862184 7:34378950-34378972 ATGCCCACCTAGAAAGTTGAAGG + Intergenic
1026396666 7:69962188-69962210 AGGCCCATCCAGGATTTTGAAGG - Intronic
1029630627 7:101748003-101748025 ATGATGATCTAGGACTTTGGGGG - Intergenic
1030567592 7:111178840-111178862 ATGCTCATGGATGACTTTGAGGG - Intronic
1032861910 7:135888149-135888171 ATGCTCATGGATGACTTTGAGGG + Intergenic
1033778650 7:144643560-144643582 ATGTTCTTCTAAGACTTTGAAGG + Intronic
1035652736 8:1281238-1281260 ACCCACATCTACGACTTTGAAGG - Intergenic
1040732298 8:50463190-50463212 ACCCCCATGGAGGACTTTGAGGG - Intronic
1042195426 8:66227975-66227997 AGGGCAAGCTAGGACTTTGAGGG - Intergenic
1044946651 8:97395905-97395927 AGGCTGATCTAGGAATTTGAAGG - Intergenic
1050121614 9:2314203-2314225 ATGCACCTCTGGGACTTTGCCGG - Intergenic
1050251490 9:3749501-3749523 ATGCCCATCTAGGGCATCTATGG - Intergenic
1051063706 9:13075780-13075802 GTGCCCACATAGGAATTTGAGGG - Intergenic
1052392209 9:27893315-27893337 ATGCCCATCAAGGACTTTACAGG - Intergenic
1187437644 X:19287386-19287408 CTGCCCATCATGGGCTTTGAAGG + Intergenic
1198979691 X:142380960-142380982 AAGACAATCTAGGACTTTGAGGG + Intergenic