ID: 1128192914

View in Genome Browser
Species Human (GRCh38)
Location 15:65720732-65720754
Sequence CAGTTAACAAGGATGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128192914 Original CRISPR CAGTTAACAAGGATGAAGCT GGG (reversed) Intronic
901138278 1:7011628-7011650 AAGTAGACAGGGATGAAGCTGGG - Intronic
901585014 1:10282903-10282925 CTGTTAATAAAGATGAAGTTTGG + Intronic
901748709 1:11392383-11392405 GAATTCACAAGGAAGAAGCTGGG - Intergenic
901924157 1:12555350-12555372 CACTTAACAAGAATGAGGCCAGG - Intergenic
901940612 1:12658800-12658822 AAATTAACAAGGATGAAGCCGGG - Intronic
902224607 1:14988710-14988732 CAGTTTACAAGGATGGTCCTTGG + Intronic
903532138 1:24039023-24039045 CAGTCAACAAGGATGATGAATGG + Intergenic
906087064 1:43144989-43145011 CACTTACCAAGGCTGAAGGTGGG - Intergenic
906814351 1:48862641-48862663 CAGTTAACAAAAATGAAGTCTGG - Intronic
907543067 1:55234199-55234221 AACTTAAAGAGGATGAAGCTTGG + Intergenic
907786695 1:57619801-57619823 CATTTTCCCAGGATGAAGCTTGG - Intronic
908177382 1:61569230-61569252 CTGTTAACAAGGAGGAAAGTCGG + Intergenic
909366850 1:74834664-74834686 GAGTTAAGAAGGATGGAGTTTGG + Intergenic
909885004 1:80930313-80930335 CAGTTATCAAGGGTGTAGGTAGG - Intergenic
910342861 1:86207974-86207996 CAGATAATATGGATGAAGCTGGG + Intergenic
912323027 1:108732369-108732391 CAGCTACCATGGATGAAGCGTGG + Intronic
912650452 1:111434023-111434045 CACTTAACTATGAGGAAGCTGGG + Intergenic
912863561 1:113236708-113236730 GAGTAACCAAGGATGAAGCTGGG - Intergenic
913397263 1:118385755-118385777 TGATTAAGAAGGATGAAGCTTGG - Intergenic
915092243 1:153434755-153434777 CAGGTAACAGGGATGAGGGTGGG - Intergenic
916013412 1:160726937-160726959 CAGTTAACAAGAACGAGGCCTGG - Intergenic
916657702 1:166891976-166891998 GAGTTCATAAAGATGAAGCTAGG - Intergenic
921290497 1:213652429-213652451 CAGTTAACAATGTGGATGCTGGG - Intergenic
921357112 1:214295506-214295528 TAATTTACAAGGAGGAAGCTGGG - Intronic
1063222942 10:3987846-3987868 CAGTTAAAAAGCATGAAACTAGG - Intergenic
1063871167 10:10419446-10419468 TTGACAACAAGGATGAAGCTGGG - Intergenic
1066071738 10:31822680-31822702 CAGGTCACGAGGAGGAAGCTAGG - Intronic
1066501580 10:36000304-36000326 CAGTCAACAAGGATGGAGAAAGG - Intergenic
1066615830 10:37293867-37293889 AAGTTAACAGGGATGAAGACAGG - Intronic
1068729273 10:60338193-60338215 CAGTTAACTAGTATAAAGATTGG + Intronic
1069594143 10:69659732-69659754 CACTCAACAAGCATGAAACTCGG + Intergenic
1071906699 10:90182093-90182115 GAGGTGACAAGGATGAAGCTTGG - Intergenic
1073553609 10:104426473-104426495 CAGCTATCCAGGCTGAAGCTTGG + Intronic
1078657395 11:13254388-13254410 CATATAACAAGGTGGAAGCTGGG - Intergenic
1079850357 11:25525723-25525745 CCTTTAACAATGATAAAGCTAGG - Intergenic
1082027369 11:47582599-47582621 CAGGTTACAAAAATGAAGCTAGG - Intronic
1089175920 11:116548876-116548898 CAGCTAACAAGCATGGAGCCTGG + Intergenic
1089785480 11:120904144-120904166 CAGAGATCAAGGCTGAAGCTGGG - Intronic
1090475328 11:127015006-127015028 CTGTTAGTAAGGATGAAGCTGGG - Intergenic
1091372451 11:135072422-135072444 CAGGTACCCAGGAGGAAGCTGGG - Intergenic
1092104953 12:5914720-5914742 CTGCCCACAAGGATGAAGCTTGG + Intronic
1093347469 12:18056726-18056748 CAGTTAAGAAATATGATGCTAGG + Intergenic
1096872057 12:54599149-54599171 GAGTGAACAAGGATGAAACTGGG + Intergenic
1096913769 12:55010263-55010285 GAGTTAACTAGGATGAACCAGGG + Intergenic
1098155590 12:67594391-67594413 CAGTCAACACTGATGAAGGTTGG + Intergenic
1101000114 12:100349053-100349075 CAGTGAACAAGGATGATATTTGG - Intergenic
1101560928 12:105857352-105857374 GAGTTACAAAGGATGAAGCATGG + Intergenic
1101918402 12:108913500-108913522 CAGATAATAAGGATGGGGCTGGG + Intronic
1104358047 12:128105842-128105864 CGCTTGACAAGGATGAATCTTGG - Intergenic
1106018438 13:25891643-25891665 CAGTTAATAGGGATGAAGGCAGG - Intronic
1106786395 13:33112072-33112094 CAGTTCACAAGGAAAAATCTTGG + Intronic
1108878483 13:55078186-55078208 AAATTAATAAGGATGAAGCATGG - Intergenic
1109528482 13:63606924-63606946 CAGTTCACATGGTTGATGCTGGG - Intergenic
1110521622 13:76485873-76485895 CAGATAAAAAGTGTGAAGCTAGG + Intergenic
1111815915 13:93152401-93152423 CAGAAAAAAAGGATGCAGCTGGG + Intergenic
1112920005 13:104600789-104600811 CAGATAAAAAGGATGAGGCTCGG - Intergenic
1114570346 14:23662631-23662653 TAGTTAAAAAGAATGAGGCTAGG + Intergenic
1115693397 14:35870374-35870396 CAATTAACCATGATGAAGTTTGG + Exonic
1116629750 14:47314985-47315007 ATGTTAACAATGATGATGCTTGG + Intronic
1116881411 14:50173130-50173152 CAGTTAAAAAGTTGGAAGCTGGG - Intronic
1117835221 14:59797782-59797804 GTGTTAACAAAGATGACGCTAGG - Intronic
1118688344 14:68313880-68313902 CAGAGAAAAAGGAGGAAGCTAGG - Intronic
1118978223 14:70695493-70695515 AACTTAAGAAGGATGAAGCTGGG + Intergenic
1118985001 14:70746578-70746600 CAGTTAATGATGGTGAAGCTGGG - Intronic
1119791002 14:77349709-77349731 CAGTGAAGAAAAATGAAGCTGGG - Intronic
1121158150 14:91706788-91706810 GAATTAACAAGGATGATGCCTGG - Intronic
1122107839 14:99472160-99472182 CAGTTCCCAAGGATGAGGCTGGG + Intronic
1124145218 15:27118884-27118906 CAGTCAACTAGGTTGAAACTAGG - Intronic
1125690480 15:41592132-41592154 CAGTTAACAAAAATGTAGATTGG + Intergenic
1126800249 15:52291626-52291648 AAGTCAACAAGGATGAAGGCTGG - Intronic
1128192914 15:65720732-65720754 CAGTTAACAAGGATGAAGCTGGG - Intronic
1129125348 15:73435671-73435693 CAGTGAGCAAGGATAAAGCCAGG - Intergenic
1131363652 15:91818349-91818371 CTGCTAAAAAGGATAAAGCTGGG + Intergenic
1133369223 16:5235348-5235370 CAGTTACGAAGGCTGAAGCCCGG + Intergenic
1134426263 16:14149488-14149510 CAGTTAAGAAGAATGTTGCTTGG + Intronic
1138073684 16:54019334-54019356 CTGTTAACAAGGAAGAAGGTGGG + Intronic
1138267080 16:55667313-55667335 CAACTAGCAAGTATGAAGCTTGG - Intronic
1140089611 16:71826960-71826982 GAGTAAACAAGGAGGAAGGTTGG + Intergenic
1140170221 16:72597000-72597022 CAGTTAAGAAGAATGAAGTGTGG + Intergenic
1143451211 17:7037954-7037976 CAGTTGAGAAGGTTGAGGCTGGG + Intronic
1145746629 17:27324926-27324948 CAGAAACCAAGGAGGAAGCTGGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1150533713 17:66013733-66013755 CAGCTAACAAGGGTGAACCCTGG - Intronic
1151482969 17:74380937-74380959 CAGTTCACAAGGAAGACGTTTGG + Intergenic
1155590434 18:27421279-27421301 AAGTGAAGAAGTATGAAGCTTGG - Intergenic
1155755203 18:29485504-29485526 GAGTAAACAAGGATGAAGAAGGG - Intergenic
1156517221 18:37690771-37690793 CACTTAGCATGAATGAAGCTCGG - Intergenic
1158379147 18:56909154-56909176 CAGTTACCAAATATTAAGCTTGG + Intronic
1162896353 19:13766684-13766706 CAGTTCCCAGGGATGAAGGTGGG - Intronic
1167077728 19:47259425-47259447 CAGAGACCAAGGAGGAAGCTGGG + Intronic
926645471 2:15286045-15286067 AAGTGAACAAGGAAGAACCTAGG + Intronic
927555652 2:24029646-24029668 CAGTTTACCAAGATGGAGCTGGG - Exonic
928218497 2:29382559-29382581 CAGTTAACAAGAATGTGGCAGGG - Intronic
930045820 2:47171816-47171838 CATTTAAAAAGAATGAAGCCAGG - Intronic
930676692 2:54209045-54209067 CAGTTCTTAAGAATGAAGCTAGG + Intronic
932910040 2:75796821-75796843 CTGTGAACAAAAATGAAGCTGGG + Intergenic
932949189 2:76272602-76272624 TAGCTAACAAGGATGAAAGTGGG + Intergenic
933377040 2:81492775-81492797 CAGTTTATGAGGATGCAGCTGGG + Intergenic
937138365 2:119575380-119575402 CAGATAACATGGAGGAAGGTGGG - Intronic
937223286 2:120354021-120354043 CAGGTAACAGGTATAAAGCTCGG - Intergenic
940629380 2:156218333-156218355 CTGTGAACCAGGAAGAAGCTGGG + Intergenic
942782674 2:179663931-179663953 GATTTTACAAGGAGGAAGCTGGG - Intronic
944340208 2:198587227-198587249 CAGTTATCATGGATGAGGCAGGG - Intergenic
944962777 2:204894490-204894512 CTGTTAATAATGAGGAAGCTGGG - Intronic
945878440 2:215302775-215302797 CAGTTCATAAGCATGAAGTTTGG + Intergenic
945885676 2:215373285-215373307 CAGGTAACAAGGAGAAAGATAGG - Intronic
946067598 2:217002075-217002097 CAGTGACCAAGGATGAGGTTAGG - Intergenic
946601059 2:221360806-221360828 CAGATAAGAGGGAAGAAGCTGGG + Intergenic
947858567 2:233341821-233341843 CACTTTAAAATGATGAAGCTGGG + Intronic
1169223925 20:3844344-3844366 CAGTTAACAATAATCTAGCTGGG - Intergenic
1170223261 20:13963777-13963799 CTGGTAACAAGGGTGAAGTTAGG - Intronic
1172301998 20:33856887-33856909 CTGTTAACAAGGAAGAAGGAGGG + Intergenic
1172649557 20:36493151-36493173 CATTTTACAAGGAGGAAACTGGG + Intronic
1172656099 20:36539431-36539453 CACTAAACATGGATGAACCTGGG + Intergenic
1173397676 20:42695676-42695698 AACTTAACAAGGAAGAAGATGGG + Intronic
1174091035 20:48047789-48047811 CAGTTAATAAGGAAGAAGGAAGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1178510168 21:33198448-33198470 CAGAGCCCAAGGATGAAGCTTGG + Intergenic
1178737464 21:35165975-35165997 CAGATAAGAAAAATGAAGCTCGG - Intronic
949367709 3:3301126-3301148 CAGTGAACAAGGAGGAAATTAGG - Intergenic
950890859 3:16402436-16402458 CATTTAAAAAAGATGAACCTGGG - Intronic
950959829 3:17093947-17093969 CATTTAAGAAGAATAAAGCTGGG - Intergenic
952287908 3:31985641-31985663 CAGATGACAGGAATGAAGCTTGG + Intronic
952451569 3:33439011-33439033 CAGTTAAAAAGGATAAAGGGCGG + Intronic
953496216 3:43389477-43389499 CAGTTAACTTGGATGGATCTAGG + Intronic
956620158 3:71214028-71214050 CAGTTAGCAAGGATTGAACTTGG + Intronic
958126853 3:89367453-89367475 CAGCAAACATGGATAAAGCTAGG - Intronic
958945322 3:100355441-100355463 TAGTTAAAAAGGATGCAGCCTGG + Exonic
959804090 3:110530092-110530114 CTGTTAACAATGATAAATCTGGG + Intergenic
960392920 3:117101308-117101330 CAGTTAACATGGATAAAAATAGG + Intronic
963969623 3:151415322-151415344 AAGTTAATAATGATGAAGTTGGG + Intronic
966328546 3:178784388-178784410 CAGTTTACAAAGAGGAAGCATGG - Intronic
966622959 3:181985520-181985542 CAGGTCTCAAGCATGAAGCTTGG + Intergenic
966837509 3:184060167-184060189 GAGTTAGCAGGGAAGAAGCTGGG + Exonic
966875022 3:184316596-184316618 CACTTAGTAAGGAAGAAGCTGGG - Intronic
969145130 4:5115902-5115924 CAGTTAAGATGACTGAAGCTCGG - Intronic
970352312 4:15214986-15215008 CTGTTACCAAGGATGAAGATGGG - Intergenic
971068555 4:23063429-23063451 CTGTGACCAAGCATGAAGCTTGG - Intergenic
971071493 4:23098011-23098033 CAGTTACCAAGGATTGAGATAGG - Intergenic
973097183 4:46216711-46216733 CAGTTAATGATGAAGAAGCTTGG + Intergenic
974667367 4:64981777-64981799 AAGTTAGAAATGATGAAGCTTGG + Intergenic
974745128 4:66062864-66062886 CAGTAACCAAGAATGAAGCTAGG - Intergenic
981176236 4:141687205-141687227 CTGCTTACAAGGATGAAGATGGG - Intronic
982337066 4:154251875-154251897 TATTTATCAAGCATGAAGCTGGG - Intronic
984576569 4:181455259-181455281 CACTTAACATGGATGAAGAAAGG - Intergenic
986097044 5:4568464-4568486 AAGTTAAAAAGGAAGAAGCCAGG - Intergenic
986273327 5:6252932-6252954 CAGAGATAAAGGATGAAGCTGGG - Intergenic
987454721 5:18129403-18129425 CAATAAACAATGATTAAGCTTGG - Intergenic
989269358 5:39513887-39513909 CAGTGAAGAAGAATGAAGATGGG - Intergenic
989408732 5:41092622-41092644 CAGATAAAAGGGATAAAGCTGGG - Intergenic
991023235 5:62002833-62002855 CATTGATCAAGGATGAAGGTAGG - Intergenic
991570859 5:68051930-68051952 CAGTGAACCAGAAGGAAGCTAGG - Intergenic
992363951 5:76072471-76072493 GAGCTAACAAGTGTGAAGCTGGG + Intergenic
993132220 5:83913074-83913096 CAGTTTCCAGGGAAGAAGCTTGG - Intergenic
995216213 5:109597777-109597799 CAGTTATCTGGGATGAAGCCTGG - Intergenic
998003162 5:138640276-138640298 TAAATCACAAGGATGAAGCTGGG - Intronic
998364158 5:141618332-141618354 CAGGTAAAAAGGATGAATCATGG + Intronic
999615388 5:153417475-153417497 CAGTTAGCTTGGCTGAAGCTAGG - Intergenic
1000999516 5:167992833-167992855 TAGTTAACTAGGATTATGCTAGG + Intronic
1001049461 5:168402777-168402799 GAGTTATCAGGGATGATGCTGGG - Intronic
1001305628 5:170570477-170570499 CACTTGAGAAGGCTGAAGCTGGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005362768 6:25047274-25047296 CATTTGTCAAGGATGAAGCCAGG - Intergenic
1006502859 6:34469183-34469205 CAGATAAGAAGGATGCTGCTTGG + Intronic
1007559194 6:42792074-42792096 CAGTTACCATGAATGAAGCTTGG + Intronic
1008730554 6:54477269-54477291 CATGTAACATGGATGAATCTCGG - Intergenic
1011049049 6:83123679-83123701 CAGTTAAAAAGCATCATGCTAGG + Intronic
1013085714 6:106855384-106855406 CTGTCATCAAAGATGAAGCTTGG - Intergenic
1013919481 6:115384855-115384877 CAATTAAAAACGATAAAGCTAGG - Intergenic
1016616856 6:146060149-146060171 AAGTTAAAAATGATTAAGCTTGG - Intronic
1016652044 6:146473212-146473234 AAGCTAACAAGGATCTAGCTGGG + Intergenic
1018654062 6:166015706-166015728 CAGTTCACAACTAGGAAGCTAGG + Intergenic
1019871031 7:3761587-3761609 CATTGTACAAGGATGAAGGTAGG + Intronic
1020820554 7:12962117-12962139 CAGATCACAAGGCTAAAGCTAGG - Intergenic
1020838885 7:13189352-13189374 CTGTGAACAAGGATGAACTTTGG + Intergenic
1022018280 7:26373677-26373699 CATTCAACATGGATGAAACTTGG - Exonic
1022744370 7:33154976-33154998 CAGTTTTCAAGGATCAAGCCAGG - Intronic
1024308256 7:47946133-47946155 CAGTTAACTAAGAGGAAGCCAGG - Intronic
1024434428 7:49333278-49333300 CATTTAGCAAGGAATAAGCTGGG + Intergenic
1024941615 7:54768786-54768808 CAGTTATAACTGATGAAGCTGGG - Intergenic
1027427481 7:78076133-78076155 CAGTTAACAATGCTGATGATTGG + Intronic
1028409210 7:90509636-90509658 CAGTTTACAAACATGAAGCCAGG + Intronic
1029240196 7:99155312-99155334 CAGCTGAGAAGGATGAAGGTGGG - Intergenic
1031911755 7:127524256-127524278 CAGTTAAAAAAGACAAAGCTAGG + Intergenic
1034092007 7:148372251-148372273 CACCTAACAGGAATGAAGCTTGG + Intronic
1038270782 8:26073777-26073799 CAGATAGCATGGATAAAGCTTGG - Intergenic
1039456045 8:37707550-37707572 CAGTTAAAGAGCATGAAGCCAGG + Intergenic
1040076814 8:43245118-43245140 CAGATAACAAGCAAGAAGATTGG - Intergenic
1040439568 8:47427266-47427288 CAGTTAACAAGGATTACCATTGG + Intronic
1040440191 8:47433421-47433443 CAGTTCAGAATGATGAAGCAGGG - Intronic
1041126799 8:54649586-54649608 GAGGTAACAAAGATGAAGCAGGG + Intergenic
1041212855 8:55570018-55570040 CAGTTTACAAATATGAATCTTGG - Intergenic
1042457918 8:69027054-69027076 CAGATACCCAGGATGAAACTAGG + Intergenic
1042699777 8:71599633-71599655 CATTTCACAATGATGAAGATGGG - Intergenic
1043523034 8:81066863-81066885 CAGTTTAAAAGTATGAGGCTGGG + Intronic
1051675732 9:19556543-19556565 CAGTTCACAAGGAGCAATCTCGG + Intronic
1055002220 9:71464639-71464661 ATGTTAACAATGAGGAAGCTTGG + Intergenic
1057381926 9:94576367-94576389 CAGTTAACAAGAGTGAGGCCTGG - Intronic
1059079535 9:111233720-111233742 CAGTGAAGAAGGACGAAGTTTGG - Intergenic
1061855084 9:133437661-133437683 CAGATGCAAAGGATGAAGCTGGG + Intronic
1187330793 X:18337505-18337527 AAGTTATCAAGGATAAAGCCGGG + Intronic
1187631296 X:21175565-21175587 CAGTTAACAAATATGAATATTGG - Intergenic
1194272621 X:91836328-91836350 CAGATTAAAAGAATGAAGCTGGG - Intronic
1194967357 X:100303802-100303824 CTGCTAACAAGGACGAGGCTAGG - Intronic
1196176235 X:112641992-112642014 CAGTTCACCAGGGTGAGGCTAGG + Intronic
1200093603 X:153647195-153647217 CAGTTTCCAAGGTGGAAGCTGGG + Exonic
1200589865 Y:5057746-5057768 CAGATTAAAAGAATGAAGCTGGG - Intronic