ID: 1128193782

View in Genome Browser
Species Human (GRCh38)
Location 15:65731470-65731492
Sequence TTGCAGTTATTAATGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 452}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128193782_1128193783 -3 Left 1128193782 15:65731470-65731492 CCTTTTTTCATTAATAACTGCAA 0: 1
1: 0
2: 1
3: 28
4: 452
Right 1128193783 15:65731490-65731512 CAACCCAAACATTAAGTAAAAGG 0: 1
1: 0
2: 0
3: 14
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128193782 Original CRISPR TTGCAGTTATTAATGAAAAA AGG (reversed) Intronic
901408309 1:9065163-9065185 TTCAAGTTTTTAAAGAAAAAAGG - Intronic
902131864 1:14268773-14268795 TTGCAGGCATTAATTAAAACTGG + Intergenic
902829592 1:19003077-19003099 AGACATTTATTAATGAAAAAGGG + Intergenic
904790892 1:33020059-33020081 TGGCAGTGATTAGTGAAACAGGG + Intronic
905407525 1:37745424-37745446 TTGCAGGTAGGAATGCAAAATGG + Intronic
905551776 1:38847221-38847243 ATGCAGTTTTTAATGAATAGGGG + Intronic
908026888 1:59961515-59961537 TTGCTGGTAGGAATGAAAAATGG + Intergenic
909205699 1:72754796-72754818 TTGCTGATATGAATGTAAAATGG + Intergenic
909262712 1:73513999-73514021 ATGAAACTATTAATGAAAAAGGG - Intergenic
909544474 1:76830171-76830193 TTGAAGTAATTAAAGCAAAAGGG + Intergenic
909699480 1:78506130-78506152 TTGCTGTTAGGAATGGAAAATGG - Intronic
911282333 1:95945548-95945570 TTTCAGTGATTGATGAAAATTGG + Intergenic
911350957 1:96754594-96754616 TTGCAGTAATTCTTGAAAACTGG - Intronic
911942191 1:104060866-104060888 TTCCAGTTATTATCCAAAAATGG - Intergenic
911986524 1:104632570-104632592 TGGCAGTTTATAATGAAAAGAGG + Intergenic
912355516 1:109051920-109051942 TTTCAGTTATTTATCTAAAATGG + Intergenic
913364115 1:118016643-118016665 TTCCTGTTATTACTGACAAAAGG - Intronic
914259098 1:145983888-145983910 TTGCATTTTTTAAAGAAAATAGG + Intergenic
914436485 1:147664728-147664750 TTCAAGTTAGTAAAGAAAAAAGG + Intronic
916308797 1:163371015-163371037 TTGTTGTTATTAATCAAAATGGG + Intergenic
917083642 1:171283238-171283260 TTTCAGTTATAATTTAAAAAGGG - Intronic
918337429 1:183532397-183532419 TTGCAGATATTAAAGTAGAAGGG + Intronic
918498116 1:185162145-185162167 TGCCAGTTAATAATGACAAATGG - Intronic
918768854 1:188525942-188525964 ATGCATTTTTAAATGAAAAATGG + Intergenic
918817362 1:189205806-189205828 TAGCAGTTATTAAGGAAGATTGG - Intergenic
919017193 1:192053959-192053981 TTGCTTTTTATAATGAAAAATGG - Intergenic
919071302 1:192758613-192758635 TTGCTGTTAGGAATGCAAAATGG - Intergenic
919231745 1:194782650-194782672 TTGTAATGATTTATGAAAAATGG - Intergenic
920330052 1:205200616-205200638 TTGATGTTATGAAGGAAAAAAGG - Intronic
922384132 1:225064315-225064337 TTGCAGATGATAATGCAAAATGG + Intronic
922860596 1:228812426-228812448 TTGCTGGTAGAAATGAAAAATGG + Intergenic
923088425 1:230719839-230719861 TTTCAGGTACTTATGAAAAATGG + Intergenic
923556845 1:235007761-235007783 TTGCAATTCTAAATGAACAACGG + Intergenic
923728308 1:236526411-236526433 TTGTAGTTTTTAAAGGAAAATGG + Intronic
923753383 1:236767917-236767939 TTTAAGTTATTCATGAAGAAAGG - Intergenic
924245702 1:242082107-242082129 TTGTAGTTATTTATATAAAAAGG - Intergenic
924752543 1:246908564-246908586 TTGCAGCCCTTAATGAAATAAGG + Intronic
924887304 1:248232613-248232635 TGCCAATTATTAATGAAAAATGG - Intergenic
1063820025 10:9823813-9823835 TTGTAGTAATTGATGATAAAAGG - Intergenic
1065128770 10:22599876-22599898 TTCCAGTTATAAATGTAAAAAGG - Intronic
1065202394 10:23325821-23325843 ATGCTGTAATAAATGAAAAAAGG + Intronic
1065265827 10:23974447-23974469 ATGCGGTTATTAATTTAAAAGGG + Intronic
1065576598 10:27126513-27126535 TTGCAGTTACCAAAAAAAAAAGG + Intronic
1065653329 10:27917524-27917546 AGGCAGATATTAATGAAACAGGG + Intronic
1065861376 10:29875225-29875247 TTGTGGATAATAATGAAAAATGG + Intergenic
1065966471 10:30775006-30775028 TGGCAGTTATTAATCTGAAAAGG + Intergenic
1066141690 10:32509859-32509881 TGGCTGTTATTAAGAAAAAATGG + Intronic
1066182743 10:32979363-32979385 TTTCAGTTATCACTGTAAAATGG + Intronic
1066598014 10:37074107-37074129 TTGCTGTTTTTAGTGATAAATGG - Intergenic
1067154369 10:43764317-43764339 TTACAGTTGTTGATGAAAAAAGG - Intergenic
1069270944 10:66526543-66526565 TTGCAGATATGAATACAAAATGG - Intronic
1069478087 10:68754114-68754136 TAGCAGTTATTCATAATAAAAGG + Intronic
1070085410 10:73232324-73232346 TTTCAGTTATTTATGCAAATAGG + Intronic
1071217791 10:83428243-83428265 CTGCAGTAAATAATGAAATAAGG + Intergenic
1071219537 10:83447961-83447983 TTGCCGATGTTAATGTAAAATGG + Intergenic
1071727790 10:88217394-88217416 TTTCATTTTTTAATTAAAAATGG - Intergenic
1073299214 10:102460816-102460838 TTGCCGTTATTAATACAAAGAGG + Intergenic
1073836497 10:107450289-107450311 TACAAGTTATTAATTAAAAAGGG + Intergenic
1074254622 10:111788586-111788608 TTGCAACTATTTACGAAAAAGGG - Intergenic
1074391466 10:113061542-113061564 TCGCAGGTATTAGTGAGAAAGGG + Intronic
1074758121 10:116642771-116642793 GTGCAGTTATTAATGTAAACAGG + Intronic
1075158236 10:119999213-119999235 TTGCAGATATTTTTGCAAAAAGG + Intergenic
1077983657 11:7328822-7328844 TTTCAGTTATTAATGTGAAATGG - Intronic
1080662953 11:34312259-34312281 TTCCAGTGTTTAATTAAAAAGGG - Intronic
1081445291 11:43125367-43125389 CTTCAGTTTTTAATGTAAAAGGG - Intergenic
1082708511 11:56522996-56523018 TTCCAGTTAATAATTAAAACAGG + Intergenic
1085891849 11:80588957-80588979 TTGCTGTTTTTAGTGATAAATGG + Intergenic
1086114709 11:83236430-83236452 TTGCAGTGGTTAATTAAAATGGG + Exonic
1087059027 11:93960543-93960565 TTAAAGTTATTCATGAACAATGG + Intergenic
1088765766 11:112975030-112975052 TTGCAGTTCTTAAAGGAAAAGGG + Intronic
1089965953 11:122655403-122655425 ATGCGGTTATTAATGGAAATTGG - Intergenic
1090546741 11:127774128-127774150 TTGCAGTGATTAAACACAAACGG + Intergenic
1090726992 11:129537156-129537178 TTGAAGTTATTAAAAAAAAAAGG - Intergenic
1092605766 12:10117023-10117045 TTTCAGTAATTACTGTAAAATGG - Intronic
1093163741 12:15781344-15781366 CTGCCCTTATTAAAGAAAAAGGG - Intronic
1093530968 12:20163146-20163168 TTACATGTATAAATGAAAAATGG + Intergenic
1094020970 12:25913812-25913834 TTGCAATCATTGATGAAGAATGG - Intergenic
1094731902 12:33186398-33186420 TTGGAGCTATTAATAGAAAAAGG + Intergenic
1094801737 12:34045231-34045253 TAGCAGTCATTAAGGAAAGAAGG + Intergenic
1095114871 12:38341138-38341160 TAGCAGTCATTAAGGAAAGAAGG + Intergenic
1095784171 12:46091632-46091654 TTCCAGTTATAAATGACAATGGG + Intergenic
1097653505 12:62333054-62333076 TCGCAGTTATAAATGCAAACAGG - Intronic
1098114264 12:67157861-67157883 TTACATTCATTAAAGAAAAATGG - Intergenic
1098244162 12:68499174-68499196 CTTCAGTTATTGATGAAAATAGG + Intergenic
1098857117 12:75665541-75665563 TTACAGCTATCTATGAAAAAGGG - Intergenic
1098934143 12:76458386-76458408 TTGCATTTAAGAATGAAAAAAGG + Intronic
1099062210 12:77925890-77925912 TTTCAGGTATTTATGAAAATAGG + Intronic
1099095058 12:78364988-78365010 ATGCTGTTATTAAAGATAAAAGG - Intergenic
1099342957 12:81461215-81461237 ATGGAGTTATTCATGTAAAATGG - Intronic
1099513055 12:83561907-83561929 GAGCAATTATTAATGATAAATGG - Intergenic
1099754629 12:86829052-86829074 TTTCAGATATTAATAAAAAATGG + Intronic
1099847404 12:88045305-88045327 GTTCAGTTCTTAATGAATAAGGG + Intronic
1100135762 12:91551549-91551571 TTGCAGTCATTTAAGAGAAAAGG + Intergenic
1100233079 12:92629720-92629742 TTGCAGTTAAAAAAAAAAAAAGG - Intergenic
1100483804 12:95005297-95005319 TTGTTGTTAGTAATGTAAAATGG - Intergenic
1100622291 12:96289730-96289752 TTACAGTTTTTGATAAAAAATGG - Intronic
1101037459 12:100719086-100719108 TTTCAGTAATTAAAGGAAAAAGG + Intronic
1101164773 12:102017703-102017725 TTGCAGGTACAAATGTAAAATGG - Intronic
1101804942 12:108055504-108055526 TTGAAGGTTTTAATTAAAAAAGG + Intergenic
1102071376 12:110022723-110022745 TTTCTGGTATTAATGATAAAAGG + Intronic
1102838506 12:116091356-116091378 TTTAAGTTATTAAGAAAAAAAGG + Intronic
1103185636 12:118954782-118954804 TTGAAGTAATTAAGGAAAATAGG + Intergenic
1103249098 12:119484789-119484811 TTTCAGTTACTGATGGAAAATGG - Intronic
1103379899 12:120486026-120486048 TTGTAATTTTTAATAAAAAACGG + Intronic
1104654402 12:130562763-130562785 TGGCAGGAATAAATGAAAAATGG + Intronic
1105889223 13:24670126-24670148 TTTCACTTGTTAAAGAAAAAGGG - Intergenic
1106004750 13:25758174-25758196 TTGCAGTTTTTGATCAAAAGGGG - Intronic
1109120794 13:58453754-58453776 TTCCAGTTATTATTCACAAAAGG + Intergenic
1110754074 13:79151293-79151315 ATGCATTTTTTATTGAAAAAGGG - Intergenic
1110815115 13:79852636-79852658 TTGCAGTGAGTCATGAAACAAGG + Intergenic
1111400540 13:87728630-87728652 TTGCAGTTATTATTGCATGAAGG - Intergenic
1111476244 13:88751986-88752008 TTGCAGTGATCAATGAATGATGG - Intergenic
1111526825 13:89482876-89482898 GTGCAGGTCTTAATGTAAAAAGG - Intergenic
1113303887 13:109055040-109055062 TTACAGTTATTAAAAAAGAAAGG + Exonic
1114261697 14:21041687-21041709 TTGCAATTTTCAATAAAAAAGGG + Intronic
1114676736 14:24445893-24445915 CTTCAGTTAATAATGTAAAAAGG + Intergenic
1114767925 14:25395478-25395500 GTTCATTTATTCATGAAAAAAGG - Intergenic
1115413307 14:33101291-33101313 TAGCAGATATTATTTAAAAAGGG + Intronic
1115699323 14:35934785-35934807 TTGCAGTATTTCATGCAAAATGG - Intergenic
1115923027 14:38397885-38397907 TTACATTTATCAGTGAAAAAAGG + Intergenic
1116298030 14:43137271-43137293 CTGCAGATATTAATGAACAGAGG - Intergenic
1116445904 14:45011110-45011132 TTGGCTTTCTTAATGAAAAAAGG + Intronic
1117271068 14:54144025-54144047 TTTCAGATATTAATGAAAAGAGG - Intergenic
1117890474 14:60416519-60416541 TTGAAGGAATGAATGAAAAAGGG - Intronic
1120257006 14:82133255-82133277 TTTCAGTTTTTAATGAAATTAGG - Intergenic
1120716350 14:87845112-87845134 TTTCTGTTATTAATGAATGATGG - Intronic
1120739527 14:88092169-88092191 GTGAAGTCATCAATGAAAAAAGG + Intergenic
1121113673 14:91329278-91329300 CAGCAGTTATTAAGGAACAAGGG + Intronic
1121531286 14:94656032-94656054 TTGCTTTGATTAATGAAATATGG + Intergenic
1124090595 15:26596273-26596295 AAACAGTTATAAATGAAAAAGGG + Intronic
1124405149 15:29385419-29385441 TTGTAGTTATTAATGATACTTGG - Intronic
1124690681 15:31819202-31819224 TTGCTGTTATAAATCACAAATGG + Intronic
1125190660 15:36988935-36988957 TTGCATTAAGAAATGAAAAAAGG + Intronic
1125242363 15:37590037-37590059 TTGCTGTTAGGAATGAAAAGTGG - Intergenic
1126267821 15:46775005-46775027 TTGCAATTATAAATGACTAATGG - Intergenic
1126347297 15:47709518-47709540 TTGCTGCTATTAATAATAAATGG + Intronic
1127290448 15:57565732-57565754 TGCCAGTTATTAAAGAAAAATGG + Intergenic
1127765247 15:62179556-62179578 TTCCACTTATTGATGAAATAGGG - Intergenic
1128193782 15:65731470-65731492 TTGCAGTTATTAATGAAAAAAGG - Intronic
1128492619 15:68164403-68164425 TTAGAGTTATAAAAGAAAAAGGG + Intronic
1128777347 15:70331318-70331340 TTTTAGATATTAATGTAAAATGG + Intergenic
1129592266 15:76927619-76927641 TAGCAGTTATTTATGAGAATGGG + Intergenic
1130006349 15:80102415-80102437 TTGCAGTTACTTTTGAATAAAGG + Intronic
1130448441 15:84027139-84027161 TTGCATTTTTTAATGACTAATGG - Intronic
1131104677 15:89724853-89724875 TTGCATTTAGCAATGAAAACTGG + Intronic
1131430543 15:92384860-92384882 TTGCAGTTTTTAAGGTATAAGGG - Intergenic
1133603606 16:7364299-7364321 TTGCAGTTACTATGGAGAAAGGG + Intronic
1134390158 16:13812403-13812425 TTGGAGTTATTTATGAAATGTGG + Intergenic
1135093790 16:19544950-19544972 TTTCAGTGATTAAATAAAAAAGG - Intronic
1137871553 16:51954676-51954698 TTTCAGTAACTAATGAGAAAGGG - Intergenic
1138291496 16:55851541-55851563 TTGCTGGTAGTAATGTAAAATGG + Intronic
1138947403 16:61868444-61868466 TTGAATTTATTAAAGAATAACGG + Intronic
1140616151 16:76666877-76666899 TTTCACTAATTAATGATAAACGG - Intergenic
1140713361 16:77698711-77698733 TTGCAGTTCTTATTGATAATAGG - Intergenic
1140885969 16:79243358-79243380 TTGCAATAAAAAATGAAAAAGGG + Intergenic
1141029995 16:80579328-80579350 TTGAAGTTATTAAAAAAAGAAGG - Intergenic
1145118745 17:20236483-20236505 TTGCAGTTATAAAAGCAAGAAGG + Intronic
1145410778 17:22660813-22660835 TTGCAGATTCTAAAGAAAAAAGG + Intergenic
1145961658 17:28889944-28889966 TTGAATTAATTAATTAAAAATGG - Intronic
1146339836 17:32009028-32009050 TTGCAGGTAAGAATGAAAAATGG - Intronic
1147004800 17:37393959-37393981 TTGAAGTTATTAATGGATTAGGG - Intronic
1147357752 17:39910995-39911017 TTTAATTTATTAATAAAAAAGGG + Intronic
1147424193 17:40338006-40338028 ATGGAGTTTTTAATGAAAATGGG + Intronic
1147775694 17:42899351-42899373 TTTCAGTTATTTTTGAAAAAGGG - Intergenic
1148176533 17:45570343-45570365 TTGCAGGTAAGAATGCAAAATGG + Intergenic
1148294844 17:46492601-46492623 TTGCAGGTAAGAATGCAAAATGG - Intergenic
1149621170 17:58046415-58046437 TTGCAGCTACTATTGCAAAAGGG - Intergenic
1150407760 17:64917326-64917348 TTGCAGGTAAGAATGCAAAATGG + Intronic
1150748739 17:67839876-67839898 TTGCAGGTAAGAATGCAAAATGG - Intronic
1150975091 17:70076958-70076980 TTCCATTTATAAATGGAAAATGG - Intronic
1151250009 17:72826891-72826913 TTGCTGATAGGAATGAAAAATGG + Intronic
1154023953 18:10689408-10689430 TTGTAGTTATTTTTAAAAAACGG - Intronic
1155012467 18:21793434-21793456 ACACAGTTATTATTGAAAAAAGG + Intronic
1155368411 18:25072390-25072412 TTTAAGTTCTTAATGGAAAATGG - Intronic
1155818904 18:30350522-30350544 TAGCAGTTAAAAATGATAAAAGG + Intergenic
1156124864 18:33891788-33891810 TACCAGTTAATAATGAAAGAAGG - Intronic
1156873507 18:41977187-41977209 TTGGAGTTATGAATGATATATGG + Intronic
1157836407 18:50907342-50907364 GAGCAGTTATTCAGGAAAAATGG - Intronic
1158089706 18:53696481-53696503 AAGCAGATCTTAATGAAAAATGG - Intergenic
1158294013 18:55973750-55973772 TTTCAGGTATAAAAGAAAAAGGG + Intergenic
1159860823 18:73647268-73647290 TTATAGTTATTTATGAAATAAGG - Intergenic
1159990092 18:74896119-74896141 TTGAAGTTCTTAAAGAATAAAGG + Intronic
1163683364 19:18696462-18696484 TTGCAGTAACTCATGAGAAAGGG + Intronic
1164970020 19:32523873-32523895 TTTTAGTTATTGATAAAAAATGG + Intergenic
1165889466 19:39101796-39101818 TGGTAGTTATTAATTAAAAAGGG - Intronic
1166009377 19:39930318-39930340 TTGCATTTATTGAAGATAAATGG + Intronic
926955734 2:18293980-18294002 TTCCACTTTTAAATGAAAAAGGG - Intronic
927441460 2:23121268-23121290 TTGGAGTTATCAATGACCAAGGG + Intergenic
928353645 2:30586982-30587004 TTGAAGTTATTAGGGAATAAGGG - Intronic
929350796 2:40951776-40951798 TTGTAGTTATTAGTAAACAATGG - Intergenic
929516781 2:42610550-42610572 TGGCAGTTGTTGAGGAAAAACGG + Intronic
929605253 2:43229633-43229655 CTGAAATTATAAATGAAAAATGG + Intergenic
929834992 2:45387510-45387532 TTGCAGTTATAAATGAGATGTGG + Intergenic
930562339 2:52975346-52975368 TTGCAGTGGTTAATAAAAAGTGG - Intergenic
931838079 2:66120710-66120732 TTGCTGGTAGAAATGAAAAATGG - Intergenic
932134626 2:69217680-69217702 TTGCAGTAGTTAATTAATAAGGG - Intronic
932168310 2:69528993-69529015 TTCCATTTATTAACAAAAAAAGG - Intronic
932386675 2:71340143-71340165 TTGCAGTTAGTAGTGAAATTTGG + Intronic
933349162 2:81131033-81131055 TTGCAGTAATTTTTGAAATAAGG + Intergenic
933572872 2:84034456-84034478 TTGCAATTCATAAAGAAAAAAGG - Intergenic
933630937 2:84656515-84656537 TTGCAATTTCTAATGACAAATGG + Intronic
933677641 2:85071109-85071131 TTGCTGGGATTAATGTAAAATGG - Intergenic
934031298 2:88050022-88050044 TTGTATTTATTAATGAAATTAGG - Intronic
934651606 2:96094880-96094902 TTGCTGTTAAGAATGTAAAACGG + Intergenic
934944282 2:98526629-98526651 TAGCATTTATTTAAGAAAAATGG + Intronic
936658056 2:114510898-114510920 TTGTAGTTATTAATTTAAATTGG + Intronic
937200394 2:120200207-120200229 TTGCTGGTAGTAATGTAAAATGG + Intergenic
940053304 2:149487040-149487062 TAGCAGTTATTGCTGAAGAATGG - Intergenic
940952777 2:159694918-159694940 TTGCTGTTAGGAATGTAAAATGG - Intergenic
941102721 2:161314063-161314085 TTGCAATTATGAAGGAAAGATGG - Intronic
942166871 2:173249925-173249947 TTTGAGTTATGTATGAAAAAGGG - Intronic
942599625 2:177627505-177627527 TTACAGATATTAAAGAAATAGGG - Exonic
943149044 2:184086586-184086608 TTTCAGTAATTCATTAAAAATGG - Intergenic
943948130 2:194093559-194093581 TTGCAGTGATTATTTCAAAAGGG - Intergenic
943999786 2:194818996-194819018 TTACAGTAATTAATGAACATGGG - Intergenic
944387025 2:199178813-199178835 TTGCAGGTAGAAGTGAAAAATGG + Intergenic
944753909 2:202739787-202739809 TGGTATATATTAATGAAAAATGG - Intronic
944980409 2:205112267-205112289 TTGCATTTCTTAATGATAATAGG + Intronic
946985802 2:225271572-225271594 TTGTAGTTATTAAACAAATAGGG + Intergenic
947067271 2:226241771-226241793 TTGCTGGTATGAATGCAAAATGG - Intergenic
948226407 2:236313447-236313469 TTGCAGTTGGGAATGTAAAATGG + Intergenic
1169968721 20:11246082-11246104 TTATTGTTATTAAAGAAAAATGG + Intergenic
1170081616 20:12482821-12482843 TTCCAGTGGTTAATGTAAAAAGG - Intergenic
1170948163 20:20910417-20910439 TTGCAGGTATTAAGCAAAAGGGG + Intergenic
1173393744 20:42658827-42658849 TTGCATTTATTGAAGTAAAAAGG + Intronic
1173400651 20:42723263-42723285 TTGCCAATATTAAAGAAAAAGGG + Intronic
1174329188 20:49804320-49804342 TTGAAATTATTATTGAAATATGG - Intergenic
1175458074 20:59130172-59130194 TTGCTGTTATTAAAGAGACAGGG + Intergenic
1175589303 20:60174963-60174985 CTTCAGTTAATAATGGAAAAAGG - Intergenic
1176914917 21:14613626-14613648 TTTCATTTTTTAATGCAAAATGG + Intronic
1177567164 21:22839293-22839315 TTGTTGGTAGTAATGAAAAATGG - Intergenic
1178135616 21:29623632-29623654 TTGAGGTTATTCATGAAATAAGG - Intronic
1178276257 21:31240351-31240373 CTGCATTTATTAAAGACAAATGG + Intronic
1179223512 21:39430894-39430916 TTGCATTTTTTAAAGAAAAAAGG - Intronic
1180750366 22:18120118-18120140 TTGAAATTATTAAAGAAAAAGGG - Intronic
1181658760 22:24324488-24324510 TTGCATTTAGTAATAAAATAGGG + Intronic
1181983165 22:26780896-26780918 TTGAATATAATAATGAAAAAAGG - Intergenic
1183132977 22:35857258-35857280 CTGCAGGTAAGAATGAAAAAGGG + Intronic
1183783617 22:40016073-40016095 TTCAAGTTTTTAAAGAAAAAAGG + Intronic
1183892262 22:40939323-40939345 TTGCAGGTAGAAATGCAAAATGG - Intergenic
1184124397 22:42476803-42476825 CTGGAGTTTTTAAAGAAAAAAGG - Intergenic
949216916 3:1582138-1582160 TAGCAGTCATTCAAGAAAAATGG + Intergenic
949642829 3:6058431-6058453 TTGTATTTTTTAATGTAAAAAGG + Intergenic
949667754 3:6360736-6360758 TTGAAGTGATAAATGAAAAATGG - Intergenic
949680866 3:6512880-6512902 TTTCATTTATGAATAAAAAAAGG + Intergenic
949964756 3:9346025-9346047 TTACAGTTAATAATGAACAAAGG - Intronic
950243982 3:11398117-11398139 TCTCAGTAATTGATGAAAAAAGG + Intronic
950276136 3:11662708-11662730 TTGCTTTTCTTAATTAAAAAAGG + Intronic
951597428 3:24333260-24333282 TTCCAGTTATTCATGAGAATGGG - Intronic
951829737 3:26912875-26912897 TTGCAGTTATTAATAAATTAGGG - Intergenic
951997291 3:28745231-28745253 TAGGTGTTATTAATGAAGAATGG - Intergenic
954336340 3:49920313-49920335 TTGCAGTTCTTACTGTAAAGGGG + Intronic
956201835 3:66714387-66714409 TCTCAGTTATTAATGAGAATTGG - Intergenic
956828224 3:73018850-73018872 TGGCAGTTTTTATTGAGAAAAGG - Intronic
957239907 3:77645401-77645423 TTCCATTTATGAATGAAAACTGG + Intronic
957791286 3:84944223-84944245 TTGTAGTTACTAAAGAAACATGG + Intergenic
958021150 3:87997703-87997725 TTGCAGTTATGAATTTAATAGGG - Intergenic
958161780 3:89825947-89825969 TTGCAGGTGTTAAGGATAAATGG + Intergenic
959209235 3:103355403-103355425 TTGCAGCTATGAATCCAAAATGG - Intergenic
959397929 3:105865058-105865080 TTGCAGTTATTTTTTTAAAAAGG + Intronic
960122576 3:113962149-113962171 TTGCAGTGTTTAATACAAAAGGG - Exonic
960256283 3:115514723-115514745 TAGCAATTTTTAATGAAAAAGGG + Intergenic
960332068 3:116372695-116372717 TTGCCCTTATTAAAAAAAAATGG + Intronic
960441067 3:117689586-117689608 GTGCAAGTATAAATGAAAAAAGG - Intergenic
960723487 3:120647514-120647536 TTGCAGTTACTAATGATAAATGG + Intronic
960909875 3:122638823-122638845 TTGTAATGTTTAATGAAAAATGG - Intronic
963466383 3:145687317-145687339 TTGCAGTTAGAAATAAGAAAAGG - Intergenic
963489291 3:145978995-145979017 TTTAACTTTTTAATGAAAAAAGG + Intergenic
963612860 3:147494145-147494167 TTGCATATATTCATGAAAACTGG - Intronic
964231272 3:154471339-154471361 TTGCAAGTATTAATGAGAAGGGG - Intergenic
964530546 3:157663160-157663182 ATGCATTTATTTATGAAACAGGG - Intronic
965213900 3:165833728-165833750 CTGCATTTATTAAAGAGAAAAGG - Intronic
965555706 3:170016388-170016410 TTGCTGGTATGAATGAAAACTGG - Intergenic
967351837 3:188522654-188522676 TGGCAGATATTATTTAAAAATGG + Intronic
970621035 4:17819237-17819259 TTGCTTTTATCAGTGAAAAATGG - Intronic
970622952 4:17845029-17845051 TACCAGTTTTGAATGAAAAATGG - Intronic
971511237 4:27427084-27427106 TTAGAGTTATTAAAGATAAATGG - Intergenic
971526996 4:27632577-27632599 TTGTAGTTATAAATAAAAACAGG - Intergenic
972058765 4:34839259-34839281 TTGCAGTTTGGAATGAAGAATGG + Intergenic
973099939 4:46253888-46253910 TTGCAGTTATTACTTTTAAATGG - Intronic
973781214 4:54289882-54289904 TTGAAGTTATTGTTGAAAATAGG + Intronic
973902622 4:55493243-55493265 TTAAAATTATTAATTAAAAATGG + Intronic
974700280 4:65434677-65434699 TTGCATTAATTTATGTAAAAGGG - Intronic
974879683 4:67739579-67739601 TCTCAGTTATTTATGAAATATGG + Exonic
975221288 4:71815005-71815027 TTGCAATAATTCATGATAAAGGG - Intergenic
975285278 4:72610121-72610143 CTTCAGTTAATAATGTAAAAAGG + Intergenic
975666187 4:76737527-76737549 TTGCAGGTGGTAATGCAAAATGG - Intronic
976228769 4:82818528-82818550 TAGCAGATATTAATAAAAATGGG - Intergenic
976534461 4:86194565-86194587 TTGTATTTAATAATGAAATAAGG + Intronic
976770224 4:88644168-88644190 TTGCTGGTGTTAATGCAAAATGG + Intronic
977177391 4:93834271-93834293 TTGCAGTTATTTTTGTGAAAAGG + Intergenic
977421338 4:96803534-96803556 TTGCTGGTATGAATGTAAAATGG + Intergenic
977480515 4:97568928-97568950 TTGCAGTTGTTACTGGAAAGGGG + Intronic
978011493 4:103691024-103691046 TTGCTGTTATGAATACAAAATGG + Intronic
978472799 4:109089021-109089043 TTTCAGAGATAAATGAAAAAGGG + Intronic
978484875 4:109241175-109241197 TTGCATTTATAGATTAAAAAAGG - Intronic
978679747 4:111365533-111365555 TTAAAATTATTAAAGAAAAAAGG + Intergenic
979014350 4:115413542-115413564 TTGGAGTGAGTAATGATAAATGG + Intergenic
979027906 4:115600162-115600184 TGGCAAATATTTATGAAAAAGGG - Intergenic
980312647 4:131153575-131153597 TTGTTGTTATTGTTGAAAAAGGG - Intergenic
980498092 4:133610651-133610673 CTGCAGTTAGTAATACAAAATGG + Intergenic
981078492 4:140615007-140615029 TTGCTGTTATTAATTAAATAGGG + Intergenic
981582822 4:146267611-146267633 TGGCAGTTTTTAGTTAAAAATGG - Intronic
981928297 4:150163459-150163481 TAGTAGTTATTGAAGAAAAAAGG - Intronic
982381638 4:154755243-154755265 TTGCAATTTTAAATGAAAGACGG - Intergenic
983293668 4:165838349-165838371 TTGCTGTTAAAAAAGAAAAATGG - Intergenic
983832476 4:172345312-172345334 TTACAGATATCAATGTAAAAAGG + Intronic
983960996 4:173754190-173754212 TTTCAGTTTTCAATTAAAAATGG - Intergenic
984502891 4:180578613-180578635 TTCCATTTATTAATTAACAATGG - Intergenic
984714607 4:182914814-182914836 TTCCAGTTGTTGATGACAAAAGG + Intronic
985344708 4:188991503-188991525 TTGAATATATTACTGAAAAATGG + Intergenic
985616468 5:925539-925561 TTTCAGTCATGAATGAAAACTGG - Intergenic
985930993 5:3057831-3057853 TTGTAGTTGTAAAAGAAAAAAGG - Intergenic
986527135 5:8691643-8691665 TTGCAGAAATTCATGAATAATGG - Intergenic
987960876 5:24806604-24806626 TTCAAGATAATAATGAAAAAAGG - Intergenic
988159857 5:27504857-27504879 TTACAAATATTCATGAAAAAGGG + Intergenic
988270892 5:29015230-29015252 ATGTAGATTTTAATGAAAAATGG + Intergenic
988896569 5:35680738-35680760 TTAAAGGTATTAATGCAAAACGG + Intronic
989418869 5:41211939-41211961 TTGCAGTTTTTGATGATAATTGG - Intronic
989473911 5:41852554-41852576 TTGGAGTTATTCATAAAGAAAGG - Intronic
989747001 5:44840607-44840629 TTGCAGCAATGAAGGAAAAAGGG - Intergenic
989775196 5:45198336-45198358 CTGCGGTTTTTAATCAAAAAAGG - Intergenic
990416740 5:55594137-55594159 TTAGAGTTTTTAATGAAAATAGG - Intergenic
990460626 5:56027997-56028019 CTCCAGTTTTTAAAGAAAAAAGG + Intergenic
990501678 5:56402647-56402669 TTGCAGGTCTTTTTGAAAAAAGG - Intergenic
991108838 5:62874484-62874506 TTGCTGGTATGAATGCAAAATGG + Intergenic
991387356 5:66105104-66105126 TTGAAATTAGTAATGAAAGAGGG + Intergenic
991523355 5:67526754-67526776 TTGCAGGTAGGAATGTAAAATGG + Intergenic
991773978 5:70066426-70066448 TTAGAGTTTTTAAAGAAAAAGGG - Intronic
991853272 5:70941850-70941872 TTAGAGTTTTTAAAGAAAAAGGG - Intronic
993831663 5:92767605-92767627 ATACATTTATTTATGAAAAAAGG - Intergenic
993867520 5:93213079-93213101 TTTCAATTATTAATAAAAACAGG - Intergenic
993975867 5:94479697-94479719 TTGCTGTTAGGAATGCAAAATGG - Intronic
994402181 5:99295143-99295165 TTAAATATATTAATGAAAAATGG + Intergenic
994458188 5:100041303-100041325 ATACATATATTAATGAAAAAGGG + Intergenic
995423450 5:111992651-111992673 TTGCTGGTAGGAATGAAAAATGG - Intronic
995648164 5:114337105-114337127 TTGCAGTCATCAAAGAAAAAGGG + Intergenic
995832050 5:116364109-116364131 TTAAAGTTATTAATGAATGAAGG + Intronic
996326347 5:122278835-122278857 TTGCTGTTGGGAATGAAAAATGG + Intergenic
996485010 5:124023233-124023255 TTGTACTTCTTAATGAGAAATGG + Intergenic
996669830 5:126104388-126104410 ATGCAGCTATTAATCAAGAAGGG + Intergenic
997164008 5:131639235-131639257 TTGCAGTTATTCTGGAAAGATGG - Intronic
998664029 5:144275300-144275322 TTGCACTTAATTATGCAAAATGG + Intronic
998731307 5:145080646-145080668 TTTCAGCTACTAATGGAAAATGG + Intergenic
999013522 5:148070338-148070360 TTTCAGGCATTTATGAAAAATGG + Exonic
1000393844 5:160752065-160752087 TTCCAATTCTTAAAGAAAAAAGG + Intronic
1000452851 5:161411923-161411945 TTGGAGTTTTTACTAAAAAATGG - Intronic
1000760158 5:165213717-165213739 TTGGATTTATGAATGAATAAAGG + Intergenic
1001609801 5:172991123-172991145 TTGAAATTGTTCATGAAAAAAGG - Intronic
1001732170 5:173968683-173968705 TTGCAGTTTATAAGGACAAAGGG - Intergenic
1003095073 6:3136078-3136100 TTGCAGTGGTTAATGGAAACCGG - Intronic
1003702673 6:8486904-8486926 TTGCTGTTGCTAATGTAAAATGG + Intergenic
1003854855 6:10263061-10263083 TTGAAATTATTATTAAAAAAAGG - Intergenic
1004485846 6:16065680-16065702 TTGCTGGTAGGAATGAAAAATGG + Intergenic
1006369570 6:33635651-33635673 TTGCAATTTTTAATAAAAATGGG + Intronic
1006773618 6:36574826-36574848 TTGCTGGTATAAATGTAAAATGG - Intergenic
1008845157 6:55953910-55953932 TTGTTGTTTTTAATGATAAAAGG - Intergenic
1009503324 6:64444207-64444229 CTTCAGTTAATAATGTAAAAAGG + Intronic
1009842255 6:69092643-69092665 TTACAGTTAGTGATGAAAACAGG + Intronic
1010047804 6:71467573-71467595 TTGCATGTATTTATGAAGAAGGG - Intergenic
1010119037 6:72352258-72352280 TTGTAGATATTAATGAAGACTGG + Intronic
1010250033 6:73697598-73697620 TTCCAGTTATTACTGCAGAAGGG - Intronic
1010337127 6:74699549-74699571 TGGCAGTCTTTACTGAAAAAAGG - Intergenic
1010583041 6:77623033-77623055 TTCCTTTAATTAATGAAAAAGGG + Intergenic
1011331718 6:86215346-86215368 ATGGAGTTGTTAATGGAAAATGG + Intergenic
1011428606 6:87258780-87258802 TTTCAGTTTTTAATGTTAAAGGG - Exonic
1012021076 6:93920061-93920083 TTTCAGTTCTTATTCAAAAATGG - Intergenic
1012541058 6:100362332-100362354 TCACAGATATGAATGAAAAAAGG + Intergenic
1012635877 6:101540989-101541011 TTGCAAAATTTAATGAAAAATGG + Intronic
1013540945 6:111108401-111108423 CTTCAGTTAATAATGTAAAAAGG + Intronic
1013653478 6:112220832-112220854 TTGCAGTTATTAAATAAAGTGGG + Intronic
1014259591 6:119201009-119201031 TTACAGCTATTAATCAGAAAGGG - Intronic
1014498237 6:122154673-122154695 TTTCATTGATTACTGAAAAATGG - Intergenic
1014789905 6:125660340-125660362 TTTCAGATATAAATTAAAAATGG + Intergenic
1015702308 6:136049890-136049912 TTGAATTTTTTAATGAAAATGGG + Intronic
1016080709 6:139851772-139851794 TTTAAGAGATTAATGAAAAAGGG - Intergenic
1016257875 6:142130756-142130778 TTTCTTTTTTTAATGAAAAAGGG + Intergenic
1016677068 6:146783170-146783192 GTGCAGTTATTAATCCAAAGTGG + Intronic
1016792285 6:148078695-148078717 ATGCAGTTAAAAATGACAAATGG + Intergenic
1016848912 6:148596663-148596685 TTGCATTTATCAATGAATCATGG + Intergenic
1018205359 6:161432099-161432121 TTACAGTTATTTATGAAGCAAGG - Intronic
1020776450 7:12460204-12460226 TTGCAGTGAACAATGCAAAAAGG + Intergenic
1022130965 7:27404016-27404038 TTGCAGTGATCAGGGAAAAAGGG + Intergenic
1022705351 7:32796865-32796887 ATGCAGTTAATTTTGAAAAACGG - Intergenic
1022962932 7:35447339-35447361 TTGCTGATATGAATGTAAAATGG - Intergenic
1024089513 7:45923596-45923618 TTGCAGTTATCAAATAAAACTGG - Intergenic
1025572681 7:62596255-62596277 TTGCAGTTACTACAGAAAGATGG + Intergenic
1027535969 7:79402326-79402348 CTTCAGTTTTCAATGAAAAATGG - Intronic
1027864684 7:83630258-83630280 TTTCATTTCTTAAAGAAAAATGG + Intronic
1027997466 7:85443376-85443398 TTGCATTTTATAATTAAAAATGG - Intergenic
1028458783 7:91068406-91068428 TTGGAGTTATCAATCAAACAGGG - Intronic
1028591421 7:92499948-92499970 TTGCTGTTACTAAAGAAAGATGG - Intronic
1028752823 7:94400753-94400775 AAGAAGATATTAATGAAAAAGGG - Intronic
1028912038 7:96219084-96219106 TAGCTGTGATTAATGTAAAAAGG - Intronic
1029412766 7:100426551-100426573 ATACTGTTATTAATGCAAAAAGG - Intronic
1029952209 7:104598837-104598859 CTTCAGTTAATAATGTAAAAAGG + Intronic
1030585894 7:111419209-111419231 TTTGAATTATTAATTAAAAATGG + Intronic
1030961800 7:115932202-115932224 TTGGAGTTATTACTTTAAAAAGG - Intergenic
1031826585 7:126573375-126573397 TAGCATTTTTTAATGAAACAGGG + Intronic
1031841715 7:126749881-126749903 TTGCTGTTAGTGATGCAAAATGG + Intronic
1034738162 7:153448027-153448049 TTGCTATTTTTAATGAAAAACGG - Intergenic
1034794882 7:154003935-154003957 TTGCAGTTACTTCTGCAAAAGGG - Intronic
1035129118 7:156635810-156635832 TTGTCTTTAATAATGAAAAAGGG - Intergenic
1035456440 7:159012240-159012262 TTGCTGATAGTAATGAACAATGG - Intergenic
1035644562 8:1208843-1208865 TTGCAGCTATTATTGTAAAGGGG - Intergenic
1036134877 8:6151701-6151723 TTGCAGCAAATAAAGAAAAAAGG + Intergenic
1036522246 8:9502431-9502453 TTGCTGATAGAAATGAAAAATGG - Intergenic
1037411508 8:18603508-18603530 TTGGAATTTTTAATGAAATAAGG - Intronic
1037541607 8:19877386-19877408 ATGCAGTCAATATTGAAAAAAGG - Intergenic
1037606557 8:20442651-20442673 TTGCAGTTATTATGGCCAAATGG + Intergenic
1039690055 8:39853229-39853251 TTGCTGTTAGGAGTGAAAAATGG - Intergenic
1040274754 8:46003744-46003766 TTGAAGTTTATGATGAAAAACGG + Intergenic
1040673748 8:49724190-49724212 TTGCTGTTGTGAATGCAAAATGG + Intergenic
1040807757 8:51412577-51412599 TTGCAGTTAGTGGTCAAAAAGGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041589697 8:59563222-59563244 CTCCAGTTAATAATGTAAAAAGG + Intergenic
1041592085 8:59599936-59599958 TTGCAATTTTTAAAGAAATATGG - Intergenic
1042055359 8:64758626-64758648 TTGCATTTTAAAATGAAAAAGGG - Intronic
1042235555 8:66609623-66609645 TTGCTGTTAATAATGATCAAAGG - Intronic
1042626128 8:70759135-70759157 TTCCAGTTTTTCATCAAAAATGG + Intronic
1043736468 8:83752652-83752674 TGGAAGATATTAATGGAAAAGGG - Intergenic
1043737124 8:83762433-83762455 TTACAGTACTTAATGTAAAAAGG + Intergenic
1043971883 8:86538879-86538901 TAGCACTTATTAATTAAAAAGGG - Intronic
1046348735 8:112975466-112975488 ATGCACTTATTAATCAAAACTGG + Intronic
1046479033 8:114790020-114790042 TTTAAGTTATTAATAAATAATGG - Intergenic
1046528070 8:115407149-115407171 TTTCAGTTTTTAATAAAAACTGG - Intergenic
1047467612 8:125133131-125133153 CTGCAGTTTTTAATTTAAAATGG - Intronic
1047627515 8:126671448-126671470 TTGCTGTTAAGAATGTAAAATGG + Intergenic
1047839902 8:128740123-128740145 TTTCACATATTAATGAATAAAGG - Intergenic
1047904210 8:129455417-129455439 TTCCAGTTATTCTTGAAAACTGG + Intergenic
1047979986 8:130171139-130171161 TTGGAGTTTTTAAGGGAAAATGG - Intronic
1048433534 8:134393449-134393471 CTGTAGTTATTACTAAAAAATGG - Intergenic
1048759368 8:137775607-137775629 TTACTGTTACTAATGGAAAAAGG + Intergenic
1049951788 9:652141-652163 TTGCAATAATTAATTATAAATGG - Intronic
1050474419 9:6025113-6025135 CTGCTGTTAGGAATGAAAAATGG - Intergenic
1050666538 9:7944104-7944126 TCACAGATATTAATGAAACAAGG + Intergenic
1050745262 9:8868714-8868736 TTGTAGTTACTACTTAAAAATGG - Intronic
1051323047 9:15931163-15931185 GTACAGCTATTAATGGAAAACGG - Intronic
1051558871 9:18417266-18417288 TTTCTGTTAGTAAAGAAAAAAGG + Intergenic
1051935954 9:22442233-22442255 TTGTAATAATTATTGAAAAAAGG + Intergenic
1052765669 9:32637945-32637967 TTGCTGTTAGGAATGAAAAATGG - Intergenic
1052775034 9:32724552-32724574 TTCCACTTCTTAATGAAGAATGG + Intergenic
1053314397 9:37039220-37039242 CTGAAGTTATTACAGAAAAATGG - Intergenic
1055257968 9:74395185-74395207 TAGCAGTTAGTTCTGAAAAATGG - Intergenic
1055662968 9:78524667-78524689 TTGCTGTTAAGAATGTAAAATGG + Intergenic
1056444119 9:86648260-86648282 TTGCAAGTTTTAATGAGAAAAGG - Intergenic
1056624384 9:88242550-88242572 TTGCTACTGTTAATGAAAAATGG + Intergenic
1057327673 9:94080570-94080592 TTGCATTTATTAGTAAAGAACGG - Intronic
1057373951 9:94501210-94501232 AAGCATTTATTCATGAAAAATGG - Intergenic
1057419711 9:94901222-94901244 TTTCAGCTTTTAATGAAGAATGG + Intronic
1057775892 9:98009143-98009165 TTTCCCTTATGAATGAAAAACGG - Intronic
1058335549 9:103823846-103823868 ATGCAGTTATTTGGGAAAAATGG + Intergenic
1058407795 9:104696646-104696668 ATTTAGTTATTAATGAGAAAGGG - Intergenic
1058609580 9:106761032-106761054 TTGAAGTTATTGTGGAAAAATGG - Intergenic
1059115321 9:111596076-111596098 TTTCAGTTATCAATGAAAGCAGG + Intronic
1059533386 9:115058723-115058745 TTGCAATAATTATTTAAAAAGGG + Intronic
1059810927 9:117854645-117854667 TTGCAGTTAACAAAGAAGAAAGG - Intergenic
1061527761 9:131181427-131181449 TTGCTGTTGGGAATGAAAAATGG - Intronic
1185951309 X:4437498-4437520 CTGATGTTAATAATGAAAAAGGG + Intergenic
1186237868 X:7532919-7532941 TTGCAATTCTTAAAGAAAAAAGG - Intergenic
1187018801 X:15358177-15358199 CTGCAGTTATAGATGAAGAATGG - Exonic
1187180260 X:16937228-16937250 TTTCTGCTATTAGTGAAAAAAGG - Intergenic
1187858750 X:23661921-23661943 TTGCTGGTGTGAATGAAAAATGG + Intergenic
1187956983 X:24528876-24528898 TTGCTGTGTTTAATGACAAAGGG - Intronic
1189611788 X:42744514-42744536 TTCCAGTTATTAATCCCAAAAGG - Intergenic
1190364844 X:49682384-49682406 TTGCTGATAGGAATGAAAAATGG - Intergenic
1193018939 X:76769240-76769262 TTCCAGTTAAAAATGCAAAATGG + Intergenic
1193300944 X:79887566-79887588 TTGCAGTGCTTAATGCAACAAGG + Intergenic
1193686653 X:84584782-84584804 TTACTGTGATTAATGAAAACAGG + Intergenic
1193908568 X:87273625-87273647 TTACGTTTATTATTGAAAAAGGG + Intergenic
1194240423 X:91438726-91438748 TTGCAGTCAGTAATTAATAACGG - Intergenic
1194380377 X:93182625-93182647 TTTCAAATATTAATGAAAAAGGG + Intergenic
1195005091 X:100678067-100678089 ATGCTGTTAATAATGAAAGAAGG - Intronic
1195717890 X:107835447-107835469 TTGCAGGTAGAAATAAAAAATGG - Intronic
1195774143 X:108384504-108384526 GTGCAGTTACTAATGTAAACTGG + Intronic
1195785339 X:108513927-108513949 TTGCACTTAGTAATGAAGTAGGG + Intronic
1196736298 X:118983545-118983567 TGGTAGTTATAAAAGAAAAATGG + Intronic
1197189968 X:123635875-123635897 GTACATTTATTCATGAAAAAAGG + Intronic
1197464603 X:126787091-126787113 TTGCAGTTATCTATGAATAAAGG + Intergenic
1197861258 X:130973208-130973230 GTGCATTTATTCAAGAAAAATGG - Intergenic
1199053044 X:143259983-143260005 TTGATTTTATTCATGAAAAATGG - Intergenic
1200739659 Y:6839808-6839830 TTGTTGTTGTTATTGAAAAATGG + Intergenic