ID: 1128199344

View in Genome Browser
Species Human (GRCh38)
Location 15:65791815-65791837
Sequence ACCGCCGCGCCATCCCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128199335_1128199344 18 Left 1128199335 15:65791774-65791796 CCCCACGCGTCCGACGCAGAGGC 0: 1
1: 0
2: 1
3: 1
4: 31
Right 1128199344 15:65791815-65791837 ACCGCCGCGCCATCCCGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 63
1128199340_1128199344 8 Left 1128199340 15:65791784-65791806 CCGACGCAGAGGCGCGGGTGCTA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1128199344 15:65791815-65791837 ACCGCCGCGCCATCCCGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 63
1128199337_1128199344 16 Left 1128199337 15:65791776-65791798 CCACGCGTCCGACGCAGAGGCGC 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1128199344 15:65791815-65791837 ACCGCCGCGCCATCCCGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 63
1128199336_1128199344 17 Left 1128199336 15:65791775-65791797 CCCACGCGTCCGACGCAGAGGCG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1128199344 15:65791815-65791837 ACCGCCGCGCCATCCCGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 63
1128199333_1128199344 19 Left 1128199333 15:65791773-65791795 CCCCCACGCGTCCGACGCAGAGG 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1128199344 15:65791815-65791837 ACCGCCGCGCCATCCCGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 63
1128199332_1128199344 20 Left 1128199332 15:65791772-65791794 CCCCCCACGCGTCCGACGCAGAG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1128199344 15:65791815-65791837 ACCGCCGCGCCATCCCGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128199344 Original CRISPR ACCGCCGCGCCATCCCGGGG CGG Intronic
904587779 1:31589379-31589401 ACCACCGCGCCCTGCCGGAGTGG - Intergenic
905656927 1:39691469-39691491 AGCCCCGCCCCATCCCGGGCAGG + Exonic
1062845207 10:698019-698041 ACAGCCGCGCCTTCCCGTGAAGG - Intergenic
1063591630 10:7400844-7400866 ACCACCGCGCCTGGCCGGGGGGG - Intronic
1071676487 10:87660097-87660119 CCCGACGCCCCCTCCCGGGGAGG - Intronic
1077404801 11:2378075-2378097 CCCGCCCCACCATCCAGGGGCGG - Intronic
1080387471 11:31818380-31818402 AGCGCCTCTCCATCCCGGCGCGG - Intronic
1085266774 11:75242035-75242057 ACCGCCGCGGCATCCAGCGCTGG + Exonic
1085574445 11:77589813-77589835 ACCCCAGCGCCAAGCCGGGGAGG + Exonic
1088811800 11:113397321-113397343 GTCGCTGCGCCAGCCCGGGGAGG + Exonic
1095810650 12:46371407-46371429 ACCGCAGCGCCAGCCCGCCGCGG + Intronic
1102032962 12:109753544-109753566 CCTGCCCCCCCATCCCGGGGGGG + Intronic
1105349463 13:19602311-19602333 CCCGGCGGGCCACCCCGGGGCGG - Intergenic
1106720026 13:32427617-32427639 CCCGCCGCGCTGTCCCGGGGGGG - Intronic
1108662590 13:52600269-52600291 CCCGGCGGGCCATCCCTGGGCGG + Intergenic
1123664779 15:22599583-22599605 CCCGCCTCGGCCTCCCGGGGTGG + Intergenic
1128199344 15:65791815-65791837 ACCGCCGCGCCATCCCGGGGCGG + Intronic
1133272446 16:4616808-4616830 GCCACCGCGCCAGCCCGGGAGGG - Intronic
1136483863 16:30558587-30558609 ACCGCCTCGCCGGGCCGGGGCGG - Intergenic
1141054814 16:80804710-80804732 CCCGCCCCGCCACCCCGGGCCGG + Intergenic
1141538634 16:84700443-84700465 CCCGCCGCGCCGGCCGGGGGAGG + Intronic
1142848334 17:2692573-2692595 CCAGCAGCGCCATCTCGGGGTGG + Exonic
1148337394 17:46851239-46851261 GCCTCCGCCCCATCCCGGAGAGG + Intronic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1152734744 17:81991909-81991931 ACAGCCGCGCCTTGCCGGAGCGG + Intronic
1153040789 18:811943-811965 CCCGCCGGGCGATCCGGGGGAGG + Intronic
1155526611 18:26722072-26722094 ACGGCCGCTGCAGCCCGGGGCGG + Intergenic
1161102826 19:2429689-2429711 AGCCCCACGCCACCCCGGGGAGG + Exonic
1161851757 19:6740857-6740879 CCCCCCGCGCCACGCCGGGGCGG + Intronic
1162131129 19:8526752-8526774 ACCCCAGCACCATCTCGGGGTGG - Intronic
1163607107 19:18281496-18281518 CCCGCCGCGCCGGCCCGGGGGGG + Exonic
927448994 2:23190270-23190292 ACCACCGTGCGATCACGGGGCGG - Intergenic
949020022 2:241735559-241735581 TCCGCTGCGCCTTCCCGTGGAGG + Intronic
1169381776 20:5113388-5113410 ACCGCCGTGGCTTCCCAGGGAGG + Intergenic
1171198828 20:23224915-23224937 ACAGCCCCGCCATCCTGGAGAGG + Intergenic
1178673958 21:34615116-34615138 GCCGCCGCGCGATTCCGAGGGGG - Exonic
1181961593 22:26625632-26625654 ACCACTGCTGCATCCCGGGGAGG + Intronic
1184164818 22:42720895-42720917 ACCGCCCCTCCGGCCCGGGGCGG + Intronic
1184836148 22:47022311-47022333 GCAGCCGGGCCATCCCTGGGAGG + Intronic
1185333311 22:50261129-50261151 GCCGCGGCGCCTTCCCGGAGCGG + Intronic
950253699 3:11487704-11487726 CCAGCCGCCCCATCCCGGGAGGG - Intronic
951558691 3:23945487-23945509 AGCGCCGCGCCGCCCCGGGCTGG - Exonic
953526035 3:43690912-43690934 AGTGCCGCGCCAGCCCGGGGCGG + Exonic
953886623 3:46717812-46717834 ACCAGCGACCCATCCCGGGGTGG + Exonic
953920357 3:46947357-46947379 ACTGCAGCCCCATGCCGGGGTGG + Intronic
954610694 3:51943224-51943246 ACCGAAGGGCCAACCCGGGGTGG + Intronic
973593495 4:52465085-52465107 CCAGCCGTGCCATCCGGGGGGGG + Intergenic
985713779 5:1444931-1444953 ACCGCCGCTCCATCTCGCGGGGG - Intronic
985929281 5:3043532-3043554 AAAGCCGCAGCATCCCGGGGTGG - Intergenic
992470036 5:77043593-77043615 CCAGCCGTGCCATCCGGGGGGGG - Intronic
997926259 5:138033260-138033282 AGCCAGGCGCCATCCCGGGGCGG + Intronic
999251231 5:150183585-150183607 CCAGCCGGGCCATCCCTGGGGGG + Exonic
1001826689 5:174751197-174751219 CCCGCCGCGAGCTCCCGGGGCGG + Intergenic
1002013785 5:176305339-176305361 CCAGCCGTGCCATCCGGGGGGGG + Intronic
1007295202 6:40815964-40815986 GCCGCCGCCCCATCTGGGGGTGG + Intergenic
1007630179 6:43269146-43269168 ACCCCCGCCCCATCACAGGGAGG - Intronic
1008760475 6:54846929-54846951 TCCGCCGCGCCGGCCAGGGGCGG - Intronic
1012438749 6:99242277-99242299 AACGCTGCACCATCCAGGGGTGG + Intergenic
1013033670 6:106360556-106360578 GCCGCCGCGCGCCCCCGGGGTGG + Intergenic
1018727716 6:166626836-166626858 CCCGCCTCGCCACCCCTGGGTGG - Intronic
1021450368 7:20778382-20778404 ACCCCGGGGCCCTCCCGGGGAGG - Intergenic
1029730067 7:102433327-102433349 TCCCTCGCGCGATCCCGGGGTGG + Intronic
1060970475 9:127734862-127734884 ACGGCCAGGCCATTCCGGGGAGG + Intronic
1186888549 X:13938438-13938460 AAGGGCGCGCCCTCCCGGGGCGG + Intronic
1198518538 X:137430446-137430468 AGCGGCGCGTCCTCCCGGGGCGG + Intergenic
1199699009 X:150363058-150363080 CCCGCTGCCCCATCCCGGAGTGG + Intronic
1200003295 X:153072779-153072801 CCCGCCCCGCCCCCCCGGGGGGG - Intronic
1200004428 X:153077230-153077252 CCCGCCCCGCCCCCCCGGGGGGG + Intergenic