ID: 1128203383

View in Genome Browser
Species Human (GRCh38)
Location 15:65829246-65829268
Sequence TAATCAATGATTGCTAGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128203376_1128203383 16 Left 1128203376 15:65829207-65829229 CCCTGCTTCTACTCAAATGAGAG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1128203383 15:65829246-65829268 TAATCAATGATTGCTAGGACGGG 0: 1
1: 0
2: 0
3: 6
4: 90
1128203377_1128203383 15 Left 1128203377 15:65829208-65829230 CCTGCTTCTACTCAAATGAGAGG 0: 1
1: 0
2: 2
3: 11
4: 112
Right 1128203383 15:65829246-65829268 TAATCAATGATTGCTAGGACGGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128203383 Original CRISPR TAATCAATGATTGCTAGGAC GGG Intronic
900853323 1:5161374-5161396 TAATCAATGGATGTTAGTACAGG + Intergenic
908177208 1:61567637-61567659 TTAAAAATGATTGCTAGGCCGGG + Intergenic
908188205 1:61672974-61672996 AAATCAGTGATTGCCAGGAGTGG + Intergenic
912500409 1:110118234-110118256 TAATAAATGTTTGGTAGGAAGGG + Intergenic
920035931 1:203065398-203065420 TACTCAGTGATTGATAGGGCTGG + Intronic
922874567 1:228930209-228930231 GTATCAATGATTGCTGGGAAGGG + Intergenic
1063273506 10:4538449-4538471 GAGTCAATAATTGCTAGGAAGGG - Intergenic
1063691212 10:8289242-8289264 TAAGCAAGGATTGCTAGCAATGG - Intergenic
1063895487 10:10676929-10676951 TAATGAATGATTGTAAAGACAGG - Intergenic
1067547372 10:47203522-47203544 TACTCAATGAGTCCTAGGAGAGG + Intergenic
1068460224 10:57320712-57320734 TAAACAATGAATGCTAGTATAGG + Intergenic
1070188843 10:74092952-74092974 TAATCAGTTATGGCAAGGACTGG + Intronic
1070736893 10:78869203-78869225 GATTCAAGGATTGCTAAGACAGG + Intergenic
1071186622 10:83053798-83053820 TAATAAATAATTCCTAGGGCTGG - Intergenic
1073919783 10:108445447-108445469 TAATCATTTATTGATAAGACTGG - Intergenic
1078983422 11:16564399-16564421 TAGTCAAAGATTGATAGAACTGG + Intronic
1079603377 11:22338477-22338499 TAAATAGTGATTGCTAGGAAAGG - Exonic
1080808642 11:35680339-35680361 AAAGCAATTATTGCTGGGACTGG - Intronic
1081465833 11:43316032-43316054 TACTCAATGATTGAGAGAACAGG - Intronic
1083182763 11:60998378-60998400 TAATCAAAGAATGTAAGGACTGG + Intronic
1085968653 11:81559997-81560019 TAAGAATTGATTGCTAAGACTGG + Intergenic
1087331018 11:96780340-96780362 TTATCAATGATTGATAGATCAGG + Intergenic
1089850196 11:121489014-121489036 TAATACATGGTTGCTAGGGCCGG + Intronic
1093483641 12:19629825-19629847 TAATCAATGAGTGGTGGGGCTGG + Intronic
1098988479 12:77038223-77038245 CTATCAATAATTGCTAGAACAGG + Intronic
1100710700 12:97253155-97253177 GAATCAAGGAATGCTAGGGCAGG + Intergenic
1104376985 12:128272202-128272224 TAATCAGTGGTTGCCAGGACTGG - Intronic
1105008766 12:132740278-132740300 TAATAAATTATACCTAGGACGGG + Intronic
1110731669 13:78885604-78885626 TTATCACTGATTCCTACGACAGG - Intergenic
1112062333 13:95753879-95753901 TAATTACTGATTGCCAGGAATGG + Intronic
1114479023 14:23019846-23019868 TAATGAATGATTGCCAGGCGCGG - Intronic
1115760891 14:36579121-36579143 TAATAAATGATTGCTGGGGAGGG - Intergenic
1117373553 14:55100639-55100661 TCATCAATGAATGCTAAAACTGG + Intergenic
1117643002 14:57820188-57820210 TAATGAATTTTTGCTAGGAAAGG + Intronic
1119918253 14:78422788-78422810 TGATCAGTGATTGCAATGACTGG + Intronic
1122079927 14:99259703-99259725 TAATTAATGGTTTCTGGGACCGG - Intronic
1125116488 15:36099499-36099521 GAATTAATAATTGATAGGACTGG + Intergenic
1127199844 15:56633321-56633343 TAATCAATAATTGTTAAAACTGG - Intronic
1128203383 15:65829246-65829268 TAATCAATGATTGCTAGGACGGG + Intronic
1130249460 15:82288305-82288327 TAGTAAATGATTGCTAGGGGTGG + Intergenic
1130407890 15:83618498-83618520 TAACCAATGACTTTTAGGACAGG - Exonic
1132883976 16:2174353-2174375 TGATCAGTGATTCCCAGGACAGG + Intronic
1133481747 16:6177380-6177402 AAATCAATGAAAGCTAGGGCTGG - Intronic
1137263723 16:46851929-46851951 TGATCAATGACTGATAGGTCAGG + Intergenic
1148211248 17:45809982-45810004 TAATTAATAATAGCTAGGCCAGG + Intronic
1150172153 17:63009384-63009406 AAATAAATGATTGAGAGGACAGG - Intergenic
1156158347 18:34330393-34330415 AAAACAATAATTGCTAGGACAGG + Intergenic
1159056219 18:63467016-63467038 CAGACAATGATTGTTAGGACAGG - Intergenic
1159682790 18:71375102-71375124 TTATCAATGGATGCTAAGACTGG + Intergenic
1165278578 19:34776579-34776601 TAATAAATGATTGCAAAAACAGG + Intergenic
936058715 2:109280532-109280554 ATTTCAATGACTGCTAGGACTGG - Intronic
945279403 2:208021824-208021846 TTACCAATGATTGCTAGGTGGGG - Intronic
946145966 2:217731261-217731283 TAATCAATGGTTGGCAGGATTGG + Intronic
952534723 3:34297525-34297547 TAATGAATGATGACTAGGAGTGG - Intergenic
953374424 3:42416898-42416920 GACTCAATGATTGCAAGCACAGG - Intergenic
957663977 3:83199380-83199402 TAATCTATGATGTCTGGGACTGG - Intergenic
959362395 3:105409736-105409758 AATTCATTGATTGTTAGGACAGG - Intronic
960150439 3:114243861-114243883 TAATCAAAGACTGATAAGACTGG - Intergenic
966508705 3:180736347-180736369 TAAGAAATCAATGCTAGGACTGG - Intronic
995819033 5:116206322-116206344 TTATCATTGATTTCTAGCACTGG + Intronic
997906917 5:137826730-137826752 AAATCAGTGATTGCTAGGCCAGG + Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
998709028 5:144799895-144799917 TAGTCAAGTATTGCCAGGACTGG + Intergenic
1002865435 6:1117949-1117971 TAATCAATTATTAATAGAACTGG + Intergenic
1004139329 6:13001054-13001076 GAATCATTGATTCCTAGGAAAGG + Intronic
1004721815 6:18274302-18274324 TAATCAATGAGTACCAGGCCAGG - Intergenic
1004808579 6:19232774-19232796 TAATCATTGATAGCTGGGTCAGG - Intergenic
1011572870 6:88758824-88758846 TAATCAATGGATGCTAAGTCTGG - Intronic
1013063956 6:106664889-106664911 TGATCAATGAATGCTAAAACTGG - Intronic
1014483190 6:121964426-121964448 TTATCAGTGTTTGCTGGGACTGG - Intergenic
1015153443 6:130064222-130064244 TTTTAAATGATTGCTAGGAAAGG + Intronic
1017547269 6:155466086-155466108 TGATCCATGAATGCAAGGACAGG - Intergenic
1021001007 7:15330272-15330294 TTATCAATGATTTCAAGGAAGGG - Intronic
1021252624 7:18349979-18350001 TAATGAATGATGGCCAGAACTGG - Intronic
1021826723 7:24560853-24560875 TACACAATGATTGCTAAGGCAGG - Intergenic
1022209839 7:28197531-28197553 TTATCTGTGATTGCTAGGATTGG + Intergenic
1027556165 7:79667215-79667237 TAATTAATGATTGCAAGGCCTGG + Intergenic
1031351421 7:120736313-120736335 TTATCAATGATTGATAGAAATGG - Intronic
1032456167 7:132075050-132075072 TGATCAGTGATGGCCAGGACAGG + Intergenic
1038445756 8:27603040-27603062 TAATCAATGACTGATAAGACTGG + Intronic
1038445758 8:27603084-27603106 TAATCAATGACTGTTAAGATTGG + Intronic
1042113688 8:65408600-65408622 TAATCAAAGATTGATAGAAGAGG - Intergenic
1042296778 8:67227857-67227879 TAATAAATAATTGCTTGGAAGGG + Intronic
1048834548 8:138505824-138505846 TAATGAATGATTGATAGAATTGG + Intergenic
1052386757 9:27831721-27831743 TAATCAATGCTGGGTAGGACGGG + Intergenic
1052859835 9:33430816-33430838 TAATCCAAGAATGCTAGGCCTGG + Intergenic
1059640562 9:116212700-116212722 TAATAAATGTTTGTTAGGAAAGG + Intronic
1059908669 9:119018401-119018423 TCATCTATGATTGCTAAAACAGG - Intergenic
1060044283 9:120327575-120327597 AAATCAATGATTGTTGGGTCTGG - Intergenic
1185963225 X:4569461-4569483 TCATCAATGATTCCACGGACAGG - Intergenic
1197838988 X:130725282-130725304 GACTCAATTATTGCAAGGACTGG - Intronic
1197901077 X:131372903-131372925 TCATCAATGAATGCTAAGGCAGG + Intronic
1198279210 X:135125430-135125452 TAATCAATGACTTGTAAGACTGG - Intergenic
1198291747 X:135247090-135247112 TAATCAATGACTTGTAAGACTGG + Intergenic
1198297782 X:135304026-135304048 TAATCACTGATTTGTAAGACTGG + Intronic
1201915823 Y:19180436-19180458 TGGTCACTGATTGCAAGGACTGG - Intergenic
1201933885 Y:19385390-19385412 TAATCAATGACTGGGAGTACCGG - Intergenic