ID: 1128208136

View in Genome Browser
Species Human (GRCh38)
Location 15:65870357-65870379
Sequence CGACCTGGGTGGTGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 0, 3: 54, 4: 535}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128208126_1128208136 -8 Left 1128208126 15:65870342-65870364 CCCTTGTCTCCGTTGCGACCTGG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1128208136 15:65870357-65870379 CGACCTGGGTGGTGGGAGGGAGG 0: 1
1: 0
2: 0
3: 54
4: 535
1128208122_1128208136 16 Left 1128208122 15:65870318-65870340 CCTCCCCAAATCGTGTTTAGAGC 0: 1
1: 0
2: 1
3: 3
4: 34
Right 1128208136 15:65870357-65870379 CGACCTGGGTGGTGGGAGGGAGG 0: 1
1: 0
2: 0
3: 54
4: 535
1128208121_1128208136 17 Left 1128208121 15:65870317-65870339 CCCTCCCCAAATCGTGTTTAGAG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1128208136 15:65870357-65870379 CGACCTGGGTGGTGGGAGGGAGG 0: 1
1: 0
2: 0
3: 54
4: 535
1128208125_1128208136 11 Left 1128208125 15:65870323-65870345 CCAAATCGTGTTTAGAGCTCCCT 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1128208136 15:65870357-65870379 CGACCTGGGTGGTGGGAGGGAGG 0: 1
1: 0
2: 0
3: 54
4: 535
1128208124_1128208136 12 Left 1128208124 15:65870322-65870344 CCCAAATCGTGTTTAGAGCTCCC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1128208136 15:65870357-65870379 CGACCTGGGTGGTGGGAGGGAGG 0: 1
1: 0
2: 0
3: 54
4: 535
1128208120_1128208136 21 Left 1128208120 15:65870313-65870335 CCTTCCCTCCCCAAATCGTGTTT 0: 1
1: 0
2: 1
3: 18
4: 226
Right 1128208136 15:65870357-65870379 CGACCTGGGTGGTGGGAGGGAGG 0: 1
1: 0
2: 0
3: 54
4: 535
1128208123_1128208136 13 Left 1128208123 15:65870321-65870343 CCCCAAATCGTGTTTAGAGCTCC 0: 1
1: 0
2: 1
3: 4
4: 45
Right 1128208136 15:65870357-65870379 CGACCTGGGTGGTGGGAGGGAGG 0: 1
1: 0
2: 0
3: 54
4: 535
1128208128_1128208136 -9 Left 1128208128 15:65870343-65870365 CCTTGTCTCCGTTGCGACCTGGG 0: 1
1: 0
2: 0
3: 8
4: 142
Right 1128208136 15:65870357-65870379 CGACCTGGGTGGTGGGAGGGAGG 0: 1
1: 0
2: 0
3: 54
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128208136 Original CRISPR CGACCTGGGTGGTGGGAGGG AGG Intronic
900291686 1:1926410-1926432 CGGCCTGCGGGGTGGGAGCGGGG - Intronic
900461396 1:2803716-2803738 GGACCTGGCTGGGTGGAGGGAGG + Intergenic
900656942 1:3763149-3763171 CGACCTGGGAGGTGGCGAGGAGG + Exonic
900785137 1:4644514-4644536 TGTCCTGTGTGGTGGCAGGGAGG + Intergenic
901296042 1:8161654-8161676 AGAGCAGGGTGGTGGGATGGAGG - Intergenic
901320443 1:8336929-8336951 CTACCTGGGTGGTGCAGGGGAGG - Intronic
901677856 1:10897404-10897426 TGACTTGGGTGAAGGGAGGGAGG - Intergenic
902138904 1:14335107-14335129 CCACTGGGGTGGTGGGGGGGGGG - Intergenic
903603137 1:24556364-24556386 GGTCCGGGGTGGTGGGAGGGAGG + Intronic
903831933 1:26180648-26180670 CAACCTGGGGGGTGTGATGGGGG + Intronic
904097508 1:27992262-27992284 GGACCTGGGTGGGGGGCGAGAGG + Intronic
905294119 1:36943287-36943309 GGACCTGGGATGGGGGAGGGAGG - Intronic
905306627 1:37023641-37023663 AGACCTGGCTGAAGGGAGGGAGG + Intronic
905541574 1:38764408-38764430 TGAGCTGGCTGGTGGGTGGGTGG + Intergenic
906063569 1:42963630-42963652 AGACCAGTGTGGTGGCAGGGAGG - Intergenic
908370328 1:63473553-63473575 CCATCTGGGAGGGGGGAGGGGGG + Intronic
908611763 1:65868918-65868940 CAGACGGGGTGGTGGGAGGGAGG - Intronic
908796950 1:67839715-67839737 CAACCTGGATGGTGGAAGGAGGG + Intergenic
910149577 1:84126071-84126093 CTTCCTGGGGGGTGGGGGGGAGG + Intronic
910518355 1:88088608-88088630 CTCCCTGGGTGGGGGAAGGGCGG - Intergenic
910924981 1:92388788-92388810 CGACCTGGGACGTGGGAGCTTGG + Exonic
911017159 1:93345819-93345841 CGGCGTGGGTGGGGGAAGGGCGG + Intergenic
911281886 1:95940107-95940129 CTTCCTGGGTTGAGGGAGGGGGG - Intergenic
911692043 1:100845494-100845516 CGACCTGGGATGTTGGAGGTTGG - Intergenic
912325105 1:108750566-108750588 AGAACTGGTTGGTGTGAGGGGGG - Intronic
912415067 1:109502488-109502510 GGATGTGGGTGGTGGGTGGGTGG + Intronic
912432572 1:109636799-109636821 GGACCTGGCTGGTGGCAGTGTGG + Intergenic
912570277 1:110616293-110616315 GAACCTGGGTGGTGGGGGTGGGG - Intronic
913195751 1:116454742-116454764 CAGCCTGGGTGAGGGGAGGGTGG + Intergenic
913220157 1:116653636-116653658 TGACCTGGGTGGGTAGAGGGTGG - Intronic
915492553 1:156259241-156259263 CCAGCAGGGAGGTGGGAGGGTGG - Intronic
915912481 1:159923465-159923487 GGACATGGGTGGGGGCAGGGAGG + Exonic
916786656 1:168091540-168091562 AGCCCTGGGTGGTGGGATGCAGG - Intronic
916794157 1:168150197-168150219 ACACCTGGGAGGTGGGAGGATGG + Intergenic
917677188 1:177330917-177330939 CTACCTGGTTGGTGGGAAGCAGG - Intergenic
917859511 1:179132861-179132883 CCATCTCGGTGGTGGGAGAGGGG - Intronic
918180438 1:182082288-182082310 CTGTCTGGGTGGTGGGTGGGAGG - Intergenic
919260638 1:195189996-195190018 TTACCTGGGAGGTTGGAGGGAGG + Intergenic
919854449 1:201695828-201695850 CTGCCGGGGTGGTGGCAGGGTGG - Intronic
919973032 1:202593038-202593060 AGCCCTGGGTGGTGGCAGGCAGG - Exonic
922426121 1:225496335-225496357 AGACTTGGGTGGTGGGAAGAAGG - Exonic
922498985 1:226083282-226083304 CGACCTGGGGGGGAGGGGGGAGG - Intergenic
922573220 1:226645808-226645830 GAACTTGGATGGTGGGAGGGAGG + Intronic
922804754 1:228379487-228379509 AGACCTGGGAGCTGGCAGGGAGG + Intergenic
924084311 1:240434370-240434392 CCACTTGGGTGGTGGGTGGGAGG - Intronic
924406643 1:243754757-243754779 GAACCTGGGTGGTGTGTGGGAGG - Intronic
924505695 1:244681483-244681505 GGACCTGGGGCGGGGGAGGGAGG + Intronic
924626229 1:245698428-245698450 TGGCATGGGTGGTGGGAAGGGGG + Intronic
1062822956 10:548433-548455 CCACCGGGATGGAGGGAGGGAGG + Intronic
1063403766 10:5773155-5773177 CCTCCTGGGTGGTGGGGTGGGGG - Intronic
1064140635 10:12787427-12787449 CATCGTGGATGGTGGGAGGGAGG - Intronic
1067944994 10:50683637-50683659 GGGCCTGGGTGGTGGCAGGCGGG - Intergenic
1069747640 10:70725962-70725984 GGAGCTGGGTGGTGGGGGTGGGG + Intronic
1070531274 10:77339530-77339552 CAAGCTGGGTGGTGGGGAGGTGG - Intronic
1070866466 10:79710421-79710443 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1070866497 10:79710508-79710530 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1070880287 10:79848639-79848661 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1071633376 10:87232642-87232664 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1071633407 10:87232729-87232751 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1071646825 10:87364860-87364882 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1071646856 10:87364947-87364969 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1073777083 10:106798433-106798455 TGTCGTGGGTGGGGGGAGGGAGG - Intronic
1074203467 10:111259995-111260017 CAAGCTGGGGGGTGGGAGTGGGG - Intergenic
1075498813 10:122953844-122953866 CGTCCGGGGTGGGCGGAGGGGGG - Intronic
1075795817 10:125118712-125118734 GGCGCTGGGGGGTGGGAGGGGGG + Intronic
1076257446 10:129039384-129039406 GGGCTTGGGTGGTGGGAGAGTGG + Intergenic
1076366759 10:129926362-129926384 CGGCCTGGCTGGTGTGAAGGTGG + Intronic
1076368906 10:129939263-129939285 TGACCTGGGAGAGGGGAGGGTGG - Intronic
1076425271 10:130363115-130363137 CAGCATGGGGGGTGGGAGGGAGG + Intergenic
1076563495 10:131382475-131382497 CCACCAGGATGGTGAGAGGGAGG - Intergenic
1076712806 10:132347887-132347909 CGGCCTGGATGGTGGGGGGTGGG - Intronic
1076828569 10:132982932-132982954 GGAGCTGGATGGTGGGAGGAGGG - Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077191330 11:1257021-1257043 CGTCCATGGTGGTGGGAGGCAGG - Intronic
1077555569 11:3224444-3224466 CGACCTGGGAGGAAGGAGGGAGG - Intergenic
1078190986 11:9092050-9092072 CCACGTGGGAGGTGGGAGGTGGG + Intronic
1079006499 11:16794848-16794870 GGGGCAGGGTGGTGGGAGGGTGG - Intronic
1079456714 11:20642776-20642798 GGGCCTGGGTGCTGGGAGTGAGG + Intronic
1081759749 11:45568942-45568964 CGAGATGGGTGATGGCAGGGTGG + Intergenic
1083302302 11:61745503-61745525 GGACATTGGGGGTGGGAGGGAGG - Exonic
1083729735 11:64646272-64646294 GTACCAGGCTGGTGGGAGGGAGG - Intronic
1083840484 11:65301582-65301604 AGAACTGGGTGCTGGGAGGGTGG + Intronic
1083886157 11:65574431-65574453 CGAACTGGGAGGAGGGAGCGGGG - Intergenic
1084068334 11:66718373-66718395 GGACCTGGGTGTGGGGAGAGTGG - Intronic
1084332119 11:68436551-68436573 CTACCAGGTTGGTGGGGGGGTGG - Intronic
1084402997 11:68955972-68955994 GGACCAGGGTGGGGGTAGGGTGG + Intergenic
1085401729 11:76239676-76239698 CCAGCTGGGTGGTGGGGGGCAGG + Intergenic
1085516039 11:77112570-77112592 TGACCTGGGTAGGGGGAGGGGGG - Exonic
1085523453 11:77151271-77151293 TGATCTGGGAGGTGGGAGGCTGG + Intronic
1086106820 11:83156571-83156593 GGAACTGGGAAGTGGGAGGGAGG - Intergenic
1086244050 11:84729855-84729877 CTACCTAGGAGGTGGCAGGGAGG - Intronic
1087582871 11:100081482-100081504 CCACCTTGCAGGTGGGAGGGAGG - Intronic
1088368831 11:109066782-109066804 CTACCAGGGTGGTGGTATGGAGG + Intergenic
1088697698 11:112382634-112382656 CTCCCTGGGTTGGGGGAGGGCGG + Intergenic
1089554799 11:119310463-119310485 CGTGCTGGGAGGAGGGAGGGAGG + Exonic
1089598092 11:119594870-119594892 CTCCCTGGAGGGTGGGAGGGGGG + Intergenic
1089627573 11:119761431-119761453 AGACAGAGGTGGTGGGAGGGGGG - Intergenic
1090248392 11:125234091-125234113 AGAATTGGCTGGTGGGAGGGAGG - Intronic
1090270123 11:125380143-125380165 CCGCCTGGGTGCCGGGAGGGCGG - Intronic
1091239250 11:134041637-134041659 CCACCTGGGTCGTGTGAGGCAGG - Intergenic
1091368270 11:135039439-135039461 AGACCTGGGCAGTAGGAGGGAGG + Intergenic
1091531507 12:1361067-1361089 CAGCCTGGGTGATGGGAGTGAGG + Intronic
1092719324 12:11425215-11425237 CAAGCTGGGAGGTGGGAGGATGG - Intronic
1094579260 12:31718916-31718938 CGACCTGGGATGTGGGAGCTTGG - Intronic
1095353312 12:41241025-41241047 AGAGCTGGGGGTTGGGAGGGGGG - Intronic
1095766343 12:45899781-45899803 CCCCCTTGGAGGTGGGAGGGGGG - Intronic
1095943708 12:47741621-47741643 CGGACTGGGTGGGGGAAGGGAGG + Intronic
1096117483 12:49063640-49063662 CAATCAGGCTGGTGGGAGGGTGG + Intergenic
1096478049 12:51920740-51920762 GGACCTGGGGGTTGGGAGAGAGG - Exonic
1097049741 12:56215160-56215182 TGACCTGAGAGGTGGGAGGGAGG + Intronic
1097352255 12:58561870-58561892 AGACCTCAGTGGTGAGAGGGAGG + Intronic
1099705639 12:86150034-86150056 TGAACTGGGTGGTGGATGGGTGG + Intronic
1100421832 12:94442356-94442378 GGACCTGGGGGGAAGGAGGGAGG + Intronic
1101127472 12:101651827-101651849 CTACTTGGGAGGTGGGAGGATGG + Intronic
1102561049 12:113762534-113762556 GGACCTGGGGGTGGGGAGGGAGG - Intergenic
1102949684 12:117022624-117022646 CAGCCTGGGTGATGGGAGTGAGG + Intronic
1102965773 12:117124404-117124426 GGACCAGGGTGGTGGCAGTGGGG + Intergenic
1103554363 12:121757128-121757150 CTCCCTGGGCGGTGGGGGGGGGG + Intronic
1103572823 12:121856519-121856541 GGATCTGGGTTCTGGGAGGGTGG - Intronic
1103791996 12:123478576-123478598 CGAGGGGGGTGGTGGGTGGGAGG + Intronic
1103951571 12:124554376-124554398 CCAGCTGGGTGGTGGGAGGCTGG - Intronic
1104012090 12:124939112-124939134 GGACTCGGGTGGTGGGTGGGAGG - Intergenic
1104573360 12:129944828-129944850 GGACCAGGGTGGTGGAACGGTGG - Intergenic
1105535474 13:21260521-21260543 CGAGCTGGGCGGTGGGAAGCTGG + Intergenic
1106172224 13:27297900-27297922 GGACCTGGGAGGTGGGAGGCAGG - Intergenic
1106299914 13:28454025-28454047 AGAGCTGGGTGGGGGGAGTGGGG + Intronic
1108144647 13:47463834-47463856 CTTCCTGGGTGGGGGAAGGGCGG + Intergenic
1109784362 13:67154958-67154980 CCACCTGAGTGGTGGGTGGGTGG + Intronic
1112506830 13:99980751-99980773 CGAGCTGGAGGGAGGGAGGGAGG + Intergenic
1113569311 13:111342674-111342696 TGTCCTGGTGGGTGGGAGGGAGG + Intronic
1113789242 13:113018843-113018865 CCGCCTGGGCAGTGGGAGGGGGG - Intronic
1115795997 14:36936333-36936355 GGAGAGGGGTGGTGGGAGGGGGG - Intronic
1116330578 14:43592497-43592519 AGATTTGGGTGGGGGGAGGGTGG - Intergenic
1116726467 14:48566683-48566705 CGACCTGGGTGGTGGTGGTTTGG + Intergenic
1118046201 14:61974175-61974197 TGACCCTGGTGGTGGGAGCGGGG + Intergenic
1118454125 14:65929683-65929705 GGGCCAGGGTGGTGGGAAGGAGG + Intergenic
1118715070 14:68553712-68553734 GGAGGTGGGTGGGGGGAGGGTGG + Intronic
1119141215 14:72269132-72269154 CAAGGTGGGTGGTGGGGGGGCGG - Intronic
1119414473 14:74460369-74460391 TGACCAAGCTGGTGGGAGGGTGG - Intergenic
1121101654 14:91253854-91253876 CGACGTGGGTGGGGGGGGCGTGG - Exonic
1121266235 14:92604230-92604252 CCAGCTGGGGAGTGGGAGGGGGG - Intronic
1121299817 14:92861506-92861528 CAACGTGGGTGATGGGAGTGGGG - Intergenic
1122047671 14:99035274-99035296 CCACTTGGGAGGTGGGAGAGCGG + Intergenic
1122185603 14:99991897-99991919 TCAGCTGTGTGGTGGGAGGGTGG + Intronic
1122322871 14:100866164-100866186 CGGCCTGGGTGGGTGGAGGTGGG + Intergenic
1122833973 14:104422017-104422039 CGGCCTGGGTGGTGCCAGGAGGG - Intergenic
1122981586 14:105194593-105194615 AGAGCTGGGTGGTGGGTGGGAGG - Intergenic
1123087443 14:105723394-105723416 CGAGCTGGGTGGACTGAGGGGGG - Intergenic
1202906138 14_GL000194v1_random:73339-73361 CGGCCGGGGTCGGGGGAGGGGGG + Intergenic
1123853358 15:24382647-24382669 TGACCTGGGCGGCGGGGGGGAGG - Intergenic
1123869326 15:24555253-24555275 TGCCCTGGGTGGCGGGGGGGAGG - Intergenic
1124109357 15:26772608-26772630 CGGCCTGGGCGGAGGGAGGCGGG - Intronic
1124399863 15:29338671-29338693 CAAGCTGGGTGGTTGGAGGAGGG - Intronic
1125033250 15:35093759-35093781 TGCTCTGAGTGGTGGGAGGGTGG + Intergenic
1125457615 15:39876722-39876744 CCACTTGGGAGGTGGGAGGATGG + Intronic
1126105318 15:45143317-45143339 TGGCCAGGGTGGTGGTAGGGAGG + Intronic
1128069052 15:64782517-64782539 GGCCCTGGGTGCTGAGAGGGAGG - Intergenic
1128089374 15:64908998-64909020 GGACTTGGGTGGTGGGGGGATGG + Intronic
1128108055 15:65058802-65058824 CTGGCTGGGTGGTGGGAGGGAGG - Intronic
1128208136 15:65870357-65870379 CGACCTGGGTGGTGGGAGGGAGG + Intronic
1128455612 15:67829807-67829829 CGACCTTCGGGGTGGGTGGGGGG - Intronic
1128666725 15:69543697-69543719 GCATCTGGGTGGTGGGAAGGAGG + Intergenic
1128781597 15:70362217-70362239 CGATTTGGGTGGTGGAAGGTGGG + Intergenic
1129450179 15:75647348-75647370 AGATCGGGGTGGGGGGAGGGGGG - Intronic
1130597168 15:85256273-85256295 CCACCTGGGAAGTGGGAGGCTGG - Intergenic
1131174490 15:90201439-90201461 GGACCTGGGGGGCGGGAGGTGGG - Exonic
1131526586 15:93157755-93157777 CGGCTTGGGTCGGGGGAGGGGGG - Intergenic
1132212882 15:100037881-100037903 CTACTTGGGTGGTGGGGGGCAGG - Intronic
1132385423 15:101396958-101396980 AGACCTGAGTGGTTGGGGGGTGG + Intronic
1132501445 16:286266-286288 GGGCCTGGGGGGTGGGGGGGAGG - Intronic
1132572741 16:651130-651152 AGGCCTCGGTGGTGGGAGGGTGG + Intronic
1132583820 16:697226-697248 CAGGCTGGGTGGTGGGAGGGTGG + Exonic
1132945888 16:2531256-2531278 AGCCCTGGGTGGTGGGAGAGGGG + Exonic
1133233043 16:4375257-4375279 CCTCCTGGGTGGAGGGAGGAGGG + Intronic
1133975075 16:10594841-10594863 GCACCTGGGAGGTGGGAGGATGG - Intergenic
1135861366 16:26058944-26058966 CAACCTGGGGGCTGGGAGGAAGG + Intronic
1136231587 16:28888768-28888790 AGACCTGTGGGGAGGGAGGGAGG - Exonic
1136283898 16:29230293-29230315 CCACCTGGGAGTTGGGATGGGGG + Intergenic
1136913105 16:34159932-34159954 CGACCCGGCTTGTGGGAGGGAGG - Intergenic
1137446936 16:48537633-48537655 AGACCTGGCTGGTGGGGGTGTGG + Intergenic
1138767322 16:59619920-59619942 TGTCCTGGGTGGGGGGAGGGGGG - Intergenic
1139169721 16:64615743-64615765 CTCCCTGGGTGGGGGAAGGGTGG - Intergenic
1139544752 16:67645025-67645047 GGAGCGGGGTTGTGGGAGGGGGG - Exonic
1139666333 16:68459464-68459486 AGAGCTGGTCGGTGGGAGGGTGG + Intergenic
1139847303 16:69930062-69930084 GGACCTTGGTGGTTGGAGGCTGG - Intronic
1140200246 16:72889049-72889071 AGTCATGGGTGGAGGGAGGGAGG + Intronic
1141348817 16:83274118-83274140 GGACCTTGGTGTTGGGATGGAGG - Intronic
1141706021 16:85665145-85665167 GGTCCTGGGTGGTGGCAGGTGGG - Intronic
1142176448 16:88647630-88647652 TGGGCAGGGTGGTGGGAGGGAGG - Intronic
1142216785 16:88834010-88834032 GGTGCTGGGTGGGGGGAGGGTGG - Intronic
1142409110 16:89907469-89907491 GGAGCTGGGAGGTGGGAGGTGGG - Intronic
1142409216 16:89907777-89907799 GGAGCTGGGAGGTGGGAGGTGGG - Intronic
1142409258 16:89907894-89907916 GGAGCTGGGAGGTGGGAGGCGGG - Intronic
1142409491 16:89908629-89908651 GGAGCTGGGAGGTGGGAGGTGGG - Intronic
1203147656 16_KI270728v1_random:1811554-1811576 CGACCAGAGTGGTAGGACGGGGG - Intergenic
1142623086 17:1177367-1177389 TGGCCTGGATGGTGGGTGGGAGG - Intronic
1142889854 17:2936252-2936274 AAAACTGGGTGGGGGGAGGGGGG - Intronic
1142911549 17:3097775-3097797 CTCCCTGGGTGGGGGAAGGGCGG + Intergenic
1143324299 17:6088350-6088372 TGACCTGGGTGCTGGGAGCTTGG + Intronic
1143374045 17:6457070-6457092 TGAGCTGGGAGGTGGGGGGGCGG - Intronic
1143413336 17:6726160-6726182 TGGCTTGGGTGGTGGGAGGCTGG + Intergenic
1144438030 17:15258788-15258810 CGACCTGGGAGCTGTGAAGGTGG - Intronic
1144624964 17:16839909-16839931 GGACAGGGGTGGTGTGAGGGAGG - Intergenic
1144881466 17:18432812-18432834 GGACAGGGGTGGTGTGAGGGAGG + Intergenic
1145150767 17:20511574-20511596 GGACAGGGGTGGTGTGAGGGAGG - Intergenic
1145209719 17:21004176-21004198 CGTCCTGTGGGGTGGGAGGAAGG - Intronic
1146742844 17:35301450-35301472 TGAGCTTGGTGGGGGGAGGGGGG + Intergenic
1146941587 17:36847342-36847364 CGATTTGGGTGTGGGGAGGGAGG + Intergenic
1146947421 17:36883469-36883491 CAGCCTCTGTGGTGGGAGGGTGG + Intergenic
1147134703 17:38428332-38428354 CGGGGTGGGTGGTGGGAAGGGGG + Intergenic
1147994266 17:44352642-44352664 CGCCCTGGATGGTCAGAGGGGGG - Exonic
1148442733 17:47720149-47720171 CAACCTGGGAGGCAGGAGGGTGG + Intergenic
1148785633 17:50144890-50144912 TGACCGGGGTGGTGGGGGTGTGG + Intronic
1148806633 17:50267176-50267198 CTGCCTGGAGGGTGGGAGGGGGG - Intergenic
1148864302 17:50620580-50620602 TCACCTAGGTGGAGGGAGGGTGG - Intronic
1148864470 17:50621324-50621346 CTCCCTGGGTGGTGGTAGTGTGG + Intronic
1149332754 17:55603737-55603759 CGGGGTGGGTGGTGGGAGGGAGG + Intergenic
1150626377 17:66843798-66843820 GGTCCTGGGTGGGGGGAGGCAGG + Intronic
1150802188 17:68291298-68291320 CGGCCGGGGTGGGGGGCGGGGGG - Intronic
1151265656 17:72953135-72953157 GGCCCTGGGTGGTGGGTGGGTGG - Intronic
1151433667 17:74081349-74081371 CGGGCTGGGAGCTGGGAGGGAGG - Intergenic
1151625174 17:75271614-75271636 CTACCTGGGTTGGGGGAGCGGGG - Intergenic
1151747543 17:76019397-76019419 TGGCCTGGGTGCTGGCAGGGGGG - Intronic
1151912915 17:77095923-77095945 CTTTCTGGGTGATGGGAGGGAGG + Intronic
1152226047 17:79093273-79093295 AAAACTGGGTGGTGGGAGGGTGG - Intronic
1152817715 17:82418299-82418321 CGACCCGGGTGGGGGGGTGGGGG - Exonic
1152932007 17:83114766-83114788 TGAGTTGGGTGGTGGGTGGGAGG + Intergenic
1153536859 18:6110973-6110995 GGACCTGGGGGGTGGGAGGAAGG - Intronic
1154485004 18:14866336-14866358 TGGCCTGAGTGGTAGGAGGGTGG + Intergenic
1154485012 18:14866356-14866378 TGGCCTGAGTGGTAGGAGGGGGG + Intergenic
1154492429 18:14932193-14932215 AGACCTGGGAGGTGGGGTGGGGG + Intergenic
1155799412 18:30081899-30081921 CGACCCTGCTGCTGGGAGGGAGG + Intergenic
1155847778 18:30731175-30731197 CTTCCTAGGTGGTGGAAGGGAGG + Intergenic
1157248029 18:46071215-46071237 CTACCTGGGTGGGTGGTGGGGGG + Intronic
1157482273 18:48063072-48063094 TGGCTTGGGTGGTGGGAAGGAGG - Intronic
1157493357 18:48138915-48138937 CGGCCTGGGTGGAGGTGGGGTGG + Intronic
1158111446 18:53944509-53944531 AGACCTGGGTGGTGGTAGATGGG - Intergenic
1158212224 18:55064668-55064690 AGGCCTGGGTGGTGGGAGGAAGG + Intergenic
1158853386 18:61517920-61517942 GGAGCTTGGTGGAGGGAGGGGGG + Intronic
1160441914 18:78899509-78899531 CCACCTGGGTGGGGGGAGCTGGG + Intergenic
1160806591 19:994799-994821 GGACCGGGGTGGTGGGATTGAGG + Intronic
1161104479 19:2436677-2436699 CGGCCGTGGTGGCGGGAGGGTGG - Intronic
1161447978 19:4328632-4328654 AGCCCTGGGTGGGAGGAGGGTGG - Intronic
1161512558 19:4679662-4679684 GGCCCTGGGAGCTGGGAGGGCGG + Intronic
1161960306 19:7519620-7519642 AGACCTGGGGGGTGGCAGTGAGG - Exonic
1162136032 19:8555793-8555815 TGCCCTGGGGGGTGAGAGGGGGG + Exonic
1162761583 19:12891737-12891759 CGACATGGGTGTTGGGGGGTAGG + Intronic
1163385298 19:16996398-16996420 AGACTTGAGTGGTGGGTGGGAGG + Intronic
1163651525 19:18521026-18521048 CCACCTGGCTGGTGGTGGGGAGG - Intronic
1163669348 19:18618283-18618305 GGACCTTGGGGGTGGGAGGGGGG + Intronic
1164214758 19:23134584-23134606 CGTCCTGGAGGGTGGGGGGGGGG + Intronic
1165261247 19:34620512-34620534 ACACCAGGGTGGGGGGAGGGGGG + Intronic
1165317541 19:35065849-35065871 CGCCCTGGGAGGGGAGAGGGAGG - Exonic
1165431768 19:35776927-35776949 GGACCTGAGGGGTGGGAGTGAGG + Intronic
1165729543 19:38135927-38135949 CGGCCTGGCTGGTGGCAGCGAGG - Intronic
1165756677 19:38297327-38297349 AGACCAGGGTGGTGGGGGGTAGG + Intronic
1165902968 19:39177412-39177434 CTACCTGGGCTGAGGGAGGGAGG + Intronic
1166747178 19:45146892-45146914 CGTCCTGGGTGGTGGTGGGATGG + Exonic
1167043531 19:47036951-47036973 CTACTTGGGAGGTGGGAGGATGG + Intronic
1167075002 19:47243247-47243269 CGGGCTGGGGGCTGGGAGGGCGG + Intergenic
1167263591 19:48472474-48472496 GGGTCTGGGGGGTGGGAGGGAGG - Intronic
1167289195 19:48615171-48615193 CCACCTGGCTGTTGGGAAGGAGG + Intergenic
1167955256 19:53058734-53058756 CGAATTCGGTGGGGGGAGGGGGG + Intergenic
1168069922 19:53943476-53943498 CCCCCGGGGTGGGGGGAGGGGGG + Exonic
1168251950 19:55146633-55146655 GGAGCTGGGGGGTGGGGGGGCGG - Intronic
1168516717 19:57015330-57015352 CAACCTGAGTGAAGGGAGGGCGG - Intergenic
925140159 2:1544520-1544542 CAACCTGGCTGGCTGGAGGGAGG + Intergenic
925361846 2:3285329-3285351 GGACCTGGGGGGTGGGGGTGGGG - Intronic
926007908 2:9387062-9387084 CGGGCTTGGTGGTGGGTGGGGGG + Intronic
926145280 2:10393527-10393549 AATGCTGGGTGGTGGGAGGGTGG - Intronic
926634665 2:15166652-15166674 TGTCATGGGTGGAGGGAGGGTGG - Intergenic
926685927 2:15697522-15697544 AGACTTGGGTGGGGGGAGTGGGG - Intronic
926923180 2:17959564-17959586 GGAGCTGGGTCGTGGGAGGGAGG + Intronic
927515650 2:23670278-23670300 CAACCTGGGGGTTGGGAGGACGG + Intronic
927683490 2:25155261-25155283 TGACCTGGGTTGTAGGAGAGTGG + Exonic
927963784 2:27257032-27257054 AGTCCTGGGAGGTGGGAGGGAGG + Intronic
928445134 2:31327431-31327453 CCACCTGGATGGTGGGGAGGAGG - Intergenic
929776663 2:44934747-44934769 AGACCTGGGTGGGGGAGGGGAGG - Intergenic
929819532 2:45262088-45262110 GGAAGTGGGTGGTGAGAGGGAGG + Intergenic
930010370 2:46933235-46933257 GGACTGGGATGGTGGGAGGGAGG + Intronic
930411551 2:51031850-51031872 AAAGATGGGTGGTGGGAGGGTGG - Intronic
931430995 2:62208943-62208965 CAACCTGGGTGGGGGCAGTGGGG + Intronic
932000101 2:67877362-67877384 CCACCTGGTTTGAGGGAGGGAGG - Intergenic
932768855 2:74489366-74489388 GGAGCCTGGTGGTGGGAGGGAGG + Intronic
932826712 2:74947956-74947978 CTTCCTGGGTGGGGGAAGGGTGG + Intergenic
934500487 2:94857242-94857264 CGGCCGGGGTCGGGGGAGGGGGG - Intergenic
934665314 2:96165232-96165254 GGACCTAGGTGGTGGTGGGGTGG - Intergenic
934710283 2:96509751-96509773 GGGCCTTGGGGGTGGGAGGGAGG + Intergenic
934735629 2:96688453-96688475 CAACCTGGGGAGTGGGCGGGCGG + Intergenic
934942299 2:98511490-98511512 AGAGCTGGGAGGTGGGAGGTGGG + Intronic
935517599 2:104061501-104061523 TGTCATGGGTGGGGGGAGGGGGG - Intergenic
936863500 2:117050913-117050935 AGAACAGGGTGGTGGGCGGGGGG + Intergenic
937098512 2:119250986-119251008 CGGGGTGGGTGGTCGGAGGGAGG + Intronic
937271369 2:120654983-120655005 CAACCGGGGTGTTGGCAGGGGGG + Intergenic
937859911 2:126699409-126699431 CGTCCTGGGTGCTGGAAGTGTGG - Intergenic
938136846 2:128765996-128766018 CTCCCTGGGTGGGGGAAGGGTGG - Intergenic
938912600 2:135898982-135899004 CGCCGTGGGAGGTGGGTGGGAGG - Intergenic
940945769 2:159615947-159615969 CGTCCTGGGTGGGAGGTGGGGGG - Intronic
942080417 2:172394893-172394915 GGCTCTGGGTGGGGGGAGGGGGG + Intergenic
942095619 2:172534388-172534410 AGGCCTGGGTGGGGGGGGGGGGG + Intergenic
942363733 2:175199754-175199776 GGAGCTGGGCGGTGGGGGGGGGG + Intergenic
942924053 2:181411332-181411354 CTCCCTGGGTGGGGGAAGGGTGG + Intergenic
945445555 2:209933555-209933577 ATGCCTGGGTGGGGGGAGGGGGG + Intronic
945978496 2:216289231-216289253 CAACTTGGGTGGGGGGCGGGTGG - Intronic
946170056 2:217889835-217889857 AGACCTGGATGGTGGGACGCAGG - Intronic
946209101 2:218133160-218133182 GGACATGGTTGGTGGTAGGGTGG + Intronic
946246965 2:218393313-218393335 CCATCTGGGGGGTGGGAGGGGGG - Intronic
946613204 2:221481332-221481354 TGACGTGGGGGCTGGGAGGGTGG - Intronic
947934130 2:233988715-233988737 CCACCTAGCTGGTGGCAGGGAGG + Intronic
948082133 2:235214978-235215000 AGACCAGGGAGGTTGGAGGGGGG + Intergenic
948101038 2:235373542-235373564 GGAGCTGGGGGGTGGGGGGGGGG - Intergenic
948365432 2:237451741-237451763 GGGCCTGCGTGGTGAGAGGGTGG - Intergenic
948815264 2:240507329-240507351 GGCCCTGGGTGAGGGGAGGGAGG - Intronic
948824876 2:240569222-240569244 TCACCGGGGTGGGGGGAGGGGGG - Intronic
949058659 2:241943766-241943788 AGACCTGGAAGGTGGGAGAGAGG - Intergenic
1168790307 20:571889-571911 CGGCCAGGGTGGGGCGAGGGCGG - Intergenic
1168838726 20:895080-895102 TGGCCTGGGTGGTGGGAGCTAGG + Intronic
1169193193 20:3670447-3670469 TGACCTGGGTGGTGGCGGAGTGG - Intronic
1169214184 20:3784197-3784219 CGGCCTGGGGGGTGGGGGTGGGG + Exonic
1169410937 20:5369853-5369875 TTACGAGGGTGGTGGGAGGGTGG - Intergenic
1169557921 20:6768898-6768920 CGGGGTGGGTGGTGGGTGGGAGG + Intronic
1169682712 20:8233712-8233734 GGAGCAGGGTGGTGGGAGGAGGG - Intronic
1170103411 20:12727201-12727223 AGAGCTGGGTGGAGGGAGGCAGG - Intergenic
1170320053 20:15086008-15086030 AGATCTGGTTGGTGGGTGGGTGG - Intronic
1171123287 20:22583217-22583239 AGGCCTGGGCGGTGGGTGGGAGG - Intronic
1171170546 20:23011692-23011714 GGAGCTGGGTTGTGGGAGGGAGG + Intergenic
1171367174 20:24633323-24633345 CGGGCTGGGTGGTGTCAGGGAGG - Intronic
1171400796 20:24872011-24872033 GGAGCTGGGAGGTGGGATGGGGG + Intergenic
1171866010 20:30488077-30488099 AGCTCGGGGTGGTGGGAGGGGGG + Intergenic
1171959934 20:31486013-31486035 GGCCCTGGGAGGTGAGAGGGCGG + Intergenic
1171974979 20:31588488-31588510 AGTCCTGGGTGGTGGGAATGTGG - Intergenic
1172137535 20:32697398-32697420 AGAGCGGGGTGGGGGGAGGGGGG - Intergenic
1172155351 20:32820149-32820171 CGAGCCGGGTGGGGGAAGGGCGG + Intronic
1172701616 20:36856634-36856656 GGTCCTGGGTGGTGGGTGGATGG - Intronic
1172762159 20:37330523-37330545 GGACGTGGGTGGAGGCAGGGAGG - Intergenic
1172790994 20:37505380-37505402 GGACCTGGGTGGTAAGAGGCAGG - Intronic
1173576242 20:44114702-44114724 GCACCAGGGTGGTGGGAGGAGGG - Intronic
1173620856 20:44434845-44434867 CTACCTGGGTGGTGGAAGCATGG - Intergenic
1173717049 20:45217541-45217563 TGACCTTGGTGGGGGCAGGGGGG + Intergenic
1173858770 20:46268535-46268557 AGCCCGGGGTGGTGGGAGGGAGG - Intronic
1174407024 20:50309178-50309200 AGGCCAGGGTGGTGGGAGAGGGG + Intergenic
1175173097 20:57093331-57093353 CCACGAGGCTGGTGGGAGGGTGG + Intergenic
1175526481 20:59638119-59638141 CCACCTGGTTGGTGGAAGGAGGG - Intronic
1175593086 20:60209026-60209048 AGACCTGGCAGGCGGGAGGGTGG + Intergenic
1175985921 20:62764146-62764168 AGTGCTGGGTGCTGGGAGGGAGG - Intergenic
1176625495 21:9088095-9088117 CGGCCGGGGTCGGGGGAGGGGGG + Intergenic
1176723786 21:10413784-10413806 CAGCCTGAGTGGTAGGAGGGTGG + Intergenic
1176796316 21:13373119-13373141 CGGCCTGAGCGGTAGGAGGGGGG - Intergenic
1178538830 21:33432416-33432438 GGTCATGGGTGGTGGGAGTGGGG + Intronic
1178926653 21:36780931-36780953 CAGCCTGGGGGGTGGGGGGGTGG - Intronic
1179537420 21:42061531-42061553 AGACTTGGGTGGTGGGAGGAGGG - Intergenic
1179626942 21:42654064-42654086 CGCCCTGGGGGGTGGGGGGTGGG + Intronic
1179887451 21:44320263-44320285 CGAGCTGTGAGCTGGGAGGGTGG + Intronic
1179958963 21:44757719-44757741 AGAGCTGGGGGGTGGGGGGGGGG + Intergenic
1180312718 22:11252951-11252973 AGCTCCGGGTGGTGGGAGGGGGG + Intergenic
1180342533 22:11629448-11629470 CGACCTGGCGTGTGGGAGGGAGG - Intergenic
1181003724 22:19999696-19999718 AGGCCTGGGTGGCTGGAGGGAGG + Intronic
1181318191 22:21984826-21984848 GGATCAGGGTGGTGGCAGGGAGG - Intergenic
1181539795 22:23566940-23566962 CGGACTGGCTGGTGGGAGGAAGG + Intergenic
1181646373 22:24233456-24233478 TGGCCTGGGGGGTGGGAGTGGGG + Intronic
1181786633 22:25231789-25231811 AGACCTGGGTCCTGGGAAGGAGG - Exonic
1181818797 22:25459601-25459623 AGACCTGGGTCCTGGGAAGGAGG - Intergenic
1183586880 22:38757940-38757962 AGAGATGGGTGGTGGGGGGGGGG - Intronic
1184492888 22:44820425-44820447 CGTCCTGTGTGATGGGCGGGAGG - Intronic
1184594316 22:45504522-45504544 GGCCCTGGGTGATGGGTGGGTGG + Intronic
1185186575 22:49404474-49404496 GGGCTTGGGTGGAGGGAGGGTGG + Intergenic
1185270254 22:49926638-49926660 GACCCAGGGTGGTGGGAGGGAGG - Intronic
1185288742 22:50013848-50013870 AGTGCGGGGTGGTGGGAGGGAGG - Intergenic
1185343813 22:50302799-50302821 CCCCCTCGCTGGTGGGAGGGAGG + Intronic
949485657 3:4535130-4535152 TGATCTGGGCGGGGGGAGGGAGG + Intronic
950431326 3:12952781-12952803 AGACCTGGATGGAGTGAGGGAGG - Intronic
950548749 3:13654157-13654179 AGACCTGAGTGACGGGAGGGAGG - Intergenic
950550134 3:13661311-13661333 GGGCCGGGGTGGTGGGAGGGGGG + Intergenic
950710806 3:14811464-14811486 CGACCAGGGCGCTGCGAGGGAGG - Intergenic
950773130 3:15328142-15328164 CGAACTGGAGGGTGTGAGGGGGG - Intronic
952280729 3:31920697-31920719 GTGCCTGGGTCGTGGGAGGGAGG + Intronic
952503810 3:33989352-33989374 CTCCCTGGGTGGGGGAAGGGCGG - Intergenic
952849721 3:37717920-37717942 CGACCTGTGGGGTGGGAATGGGG + Intronic
953573300 3:44090639-44090661 GGACCTGGCTGGTGGGGGGGTGG + Intergenic
953747346 3:45585324-45585346 AGACCTGGGGGTTGTGAGGGAGG + Intronic
953873248 3:46646116-46646138 CAATCTGGGGGGAGGGAGGGAGG - Intergenic
954127349 3:48539328-48539350 GCGCCGGGGTGGTGGGAGGGAGG + Intronic
954143709 3:48623568-48623590 CGTCTTGGGTGGGGGGAGGTGGG + Intergenic
954582797 3:51712157-51712179 AGGCCTGGGTGGAGGGAGGTTGG - Intronic
955060473 3:55488319-55488341 AGGGCTGGGGGGTGGGAGGGGGG - Intronic
955407770 3:58636229-58636251 GGAGCTGGGTGGTGGTAGGAAGG - Intronic
956343124 3:68248713-68248735 CGGGGTGGGTGGTGGGCGGGGGG + Intronic
956454754 3:69409587-69409609 GCACCTGGGTTGTGTGAGGGAGG - Intronic
956707445 3:72011520-72011542 CTCCCTGGGTGGTGGTAAGGTGG + Intergenic
956852841 3:73246634-73246656 CCATCTGAGGGGTGGGAGGGAGG + Intergenic
957546499 3:81644803-81644825 GGACATGGGTGGTGGCAGTGGGG + Intronic
959580348 3:107976882-107976904 CAAACTGGGTGGTGGCAGGAAGG + Intergenic
959717825 3:109452729-109452751 CCAGTTGGGTGGGGGGAGGGGGG + Intergenic
960257550 3:115527200-115527222 CAACCGGGGTGGGGGGAGAGGGG - Intergenic
960338360 3:116445598-116445620 CCAGCAGGGTGGGGGGAGGGTGG - Intronic
960495926 3:118374846-118374868 GGAAGTGGTTGGTGGGAGGGTGG + Intergenic
961450474 3:127000144-127000166 TGTGCTGGGAGGTGGGAGGGTGG + Intronic
961553658 3:127682863-127682885 CCACCTGGTGGGTGGGAGGTGGG + Intergenic
962368003 3:134798324-134798346 CTGCCTGGGTGGAAGGAGGGAGG + Intronic
962640128 3:137377144-137377166 CCAGCTTGGTGGGGGGAGGGAGG - Intergenic
962666056 3:137654512-137654534 CGAGCTTGGTTGGGGGAGGGGGG + Intergenic
964533689 3:157696246-157696268 GGACCTGGGTGGTAGCAGTGTGG - Intergenic
964620738 3:158717854-158717876 TCACATGGCTGGTGGGAGGGTGG - Intronic
964718880 3:159752037-159752059 GGGCCTGGGTTGTGGGTGGGTGG - Intronic
965952131 3:174322361-174322383 AGTCCAGGGTGGGGGGAGGGGGG + Intergenic
966098635 3:176239066-176239088 CCATCAGGGTGGGGGGAGGGGGG - Intergenic
966868522 3:184275954-184275976 CGCCCGGGGTGGGGGGAGGGTGG - Intronic
966875588 3:184320025-184320047 AGACCTGGGTGCTGGGGGGTTGG + Intronic
968924689 4:3541036-3541058 ATACCTGGGAGGGGGGAGGGAGG - Intergenic
969255172 4:5996448-5996470 AGACGTGGGTGGTGGTAGCGGGG - Intergenic
969519291 4:7666454-7666476 GGACCAGGGTGGGAGGAGGGAGG - Intronic
970152717 4:13106898-13106920 CAACCTGGGGAGTGGGAGTGGGG + Intergenic
972249760 4:37287393-37287415 CAACCTGGGTTGGGGAAGGGTGG + Intronic
973845826 4:54912272-54912294 GGACCTGGGAGGTGGGAAGTTGG - Intergenic
975689416 4:76949630-76949652 CGGCCGCGGTGGTGGGCGGGAGG - Intergenic
976801762 4:89000508-89000530 GGATGTGGGTGGTGGGAGGAGGG + Intronic
977955031 4:103017024-103017046 CAGCCAGGGCGGTGGGAGGGGGG - Intronic
978358851 4:107906932-107906954 AGACCTTGGGGGTGGGAGGCGGG + Intronic
979082094 4:116358345-116358367 AAACCTGGGTGGTGGTAGGTGGG + Intergenic
979254884 4:118599227-118599249 CGGCCTGAGTGAGGGGAGGGAGG - Intergenic
980072801 4:128261283-128261305 CAACCACTGTGGTGGGAGGGGGG - Intergenic
980137352 4:128871578-128871600 AGACCTGTGTGGTAGAAGGGAGG + Exonic
980157626 4:129126362-129126384 CAAGCTTGGTGGAGGGAGGGGGG - Intergenic
980990584 4:139735462-139735484 CGACCTCCGGGGGGGGAGGGTGG + Intronic
981629700 4:146804535-146804557 CGAAGTTGGTGGGGGGAGGGGGG + Intronic
981749866 4:148082870-148082892 CGAGCTTGGTGGGGGAAGGGGGG + Intronic
981936947 4:150249048-150249070 GCACCTGGATGGTGGGTGGGTGG - Intronic
982500536 4:156149880-156149902 CGATAGGGGTGGGGGGAGGGGGG + Intergenic
984675720 4:182545375-182545397 AGACCTGGGTGGTTGTAGTGGGG - Intronic
984916198 4:184726962-184726984 GGTCCTGGGGGGTGGGGGGGGGG + Intronic
985059016 4:186057949-186057971 GGAGGTGGGTGGTGGGAGGTGGG - Intergenic
985134426 4:186771437-186771459 TGTCCTTGGTGGTGGGGGGGGGG - Intergenic
985897318 5:2756448-2756470 CGACCTGGGGGGAGGGGGCGGGG - Intergenic
985966752 5:3343615-3343637 AGAGGTGGGTGGTGGGATGGAGG - Intergenic
986195764 5:5535386-5535408 AGACTGGGGTGGTGGGAGGCAGG + Intergenic
986633761 5:9800413-9800435 CAGCCTTTGTGGTGGGAGGGAGG + Intergenic
987019270 5:13852670-13852692 CCAGCTTGGTGGGGGGAGGGGGG + Intronic
987399858 5:17463898-17463920 CTCCCTGGGTGGGGGAAGGGTGG - Intergenic
987453848 5:18119451-18119473 CTCCCTGGGTGGGGGAAGGGTGG + Intergenic
987924078 5:24317808-24317830 TGAGCTTGGTGGGGGGAGGGGGG - Intergenic
990380427 5:55217564-55217586 CTATCTAGGTGCTGGGAGGGTGG - Intergenic
991332012 5:65502117-65502139 GGACAGGGGTGGTGGTAGGGTGG + Intergenic
991733784 5:69613456-69613478 AGACCTGGGTGGGGTGAGGCAGG - Intergenic
991810218 5:70468598-70468620 AGACCTGGGTGGGGTGAGGCAGG - Intergenic
991860483 5:71008690-71008712 AGACCTGGGTGGGGTGAGGCAGG + Intronic
991975317 5:72179142-72179164 CGACCTGGGTGGCGGGGCGGGGG - Intronic
992359844 5:76025954-76025976 CAACCAGGATGGTGGGAGGTGGG + Intergenic
992855858 5:80861340-80861362 CCACCTGAGGGGTGGGAGGGAGG - Intronic
993807891 5:92436056-92436078 CTACTTGGGTGGGGGAAGGGTGG + Intergenic
994160335 5:96549810-96549832 CGACCTGGGACGTGGGAGCTTGG + Intronic
996777326 5:127146650-127146672 GGTCATGGGTGGGGGGAGGGGGG + Intergenic
997702273 5:135911100-135911122 CGACCTGGGCAGTGGGAAGGAGG + Intergenic
997800961 5:136861634-136861656 CTCCCTGGGTGGTGGGAGTGAGG + Intergenic
999972922 5:156883028-156883050 AGAGGTGGATGGTGGGAGGGTGG + Intergenic
1000189919 5:158900277-158900299 AGACCTGGGCGGTGGGAGAGGGG + Intronic
1000328278 5:160188411-160188433 GGAACTGGGCGGTGGGAGGTGGG + Intronic
1001382294 5:171312479-171312501 CCACCTGGGGGGTGGGAGGCAGG + Intergenic
1001584847 5:172826878-172826900 TAACATGGGTGGTGGGAGAGAGG - Intergenic
1001656233 5:173352575-173352597 CTCCCTCGGTGCTGGGAGGGAGG + Intergenic
1002139550 5:177130686-177130708 GGAGCTGGGAGGTGGGAGAGAGG + Intergenic
1002723727 5:181281641-181281663 CGGCCTGAGCGGTAGGAGGGGGG + Intergenic
1002723789 5:181281837-181281859 CGGCCTGAGCGGTAGGAGGGGGG + Intergenic
1002893786 6:1362103-1362125 TGTCGTGGGTGGGGGGAGGGGGG + Intergenic
1003123385 6:3336251-3336273 CCACTTGGGTGGCGGGAAGGAGG + Intronic
1003252842 6:4446889-4446911 TAGCCCGGGTGGTGGGAGGGGGG - Intergenic
1003577060 6:7306910-7306932 CTGTCTGGGTGGTGGGGGGGTGG + Intronic
1004669726 6:17784311-17784333 CTACTTGGGAGGTGGGAGGATGG + Intronic
1006163378 6:32050520-32050542 TGGCCTGGGTGTTGGGAGGTGGG - Intronic
1006163998 6:32053910-32053932 TGGCCTGGGTGTTGGGAGGTGGG - Intronic
1006164626 6:32057108-32057130 TGGCCTGGGTGTTGGGAGGTGGG - Intronic
1006317302 6:33298429-33298451 AGACGCGGGTGGTGGGAGGTAGG - Intronic
1006461456 6:34161643-34161665 AGACCTGGGTGAGGGCAGGGAGG + Intergenic
1006524337 6:34590878-34590900 TGACCTGGGTGGAGGAAGGTTGG - Intronic
1006642463 6:35496412-35496434 CGGCCTGGGCGCTGGGAGGCCGG + Intronic
1006901224 6:37503141-37503163 TGACCTGCGTGGTGTCAGGGAGG + Intergenic
1007739726 6:44003161-44003183 CGAGGTGGGTGGGTGGAGGGTGG - Exonic
1007807799 6:44463553-44463575 TGACCTGGGTGCAGTGAGGGTGG + Intergenic
1010037019 6:71337624-71337646 GTGCCTGTGTGGTGGGAGGGGGG + Intergenic
1019101153 6:169631409-169631431 TGAACTGGGTGGTGGGGTGGGGG + Intronic
1019145857 6:169975259-169975281 GGACCTGGGGTGGGGGAGGGAGG + Intergenic
1019346519 7:533423-533445 AGACGTGGGTGGAGGGAAGGAGG + Intergenic
1019597747 7:1866127-1866149 AGGGCTGGTTGGTGGGAGGGGGG + Intronic
1021368686 7:19813735-19813757 AGACGTGGTTGGGGGGAGGGGGG + Intergenic
1022114321 7:27249116-27249138 CCATTTGGGTGGTGGCAGGGAGG + Intergenic
1023739488 7:43265983-43266005 ACACCTGGGTGCTGGGAGGGTGG - Intronic
1024711006 7:52014642-52014664 TGAGCTGGGTGGTGGCGGGGAGG - Intergenic
1026466816 7:70661435-70661457 TGACCAGGGTGGGAGGAGGGTGG + Intronic
1026800374 7:73396480-73396502 CGCCTTGGGAGGTGGGAGGCAGG - Intergenic
1027196703 7:76035589-76035611 TGACTTGGGGGGTGGGAGTGAGG - Intronic
1029116163 7:98238320-98238342 CCACCGGGGGGGTGGGAGGAGGG + Intronic
1029351435 7:100015741-100015763 CGGCCTCTGGGGTGGGAGGGCGG + Intronic
1029476174 7:100786152-100786174 CGACCGGGGAGGTTGGAGAGGGG + Intronic
1030854986 7:114544307-114544329 CTAACTGGGTGGGGGCAGGGTGG - Intronic
1032076589 7:128838912-128838934 CCACCTTGGGGGTGGGATGGAGG - Intronic
1032883968 7:136117668-136117690 ACACCTGGGTGGTGGGTGGAAGG - Intergenic
1033105430 7:138516990-138517012 CAACCTGGGAGGTGAGATGGTGG + Intronic
1033290080 7:140076164-140076186 CCACCTGGGTGGTGGGATGATGG - Intergenic
1033616199 7:143016889-143016911 TGAGCTGGGAGGTGGGAGGAAGG - Intergenic
1033635323 7:143206761-143206783 TGACATGGTGGGTGGGAGGGAGG - Intergenic
1033824092 7:145168631-145168653 CGAGGCGGGTGGTGGGAGGGAGG - Intergenic
1034184326 7:149162881-149162903 ACCCCTGGGTGGGGGGAGGGGGG + Intronic
1034373644 7:150624743-150624765 TGGCCTGGAGGGTGGGAGGGTGG - Intergenic
1034674262 7:152881192-152881214 CACACTGGGTGGGGGGAGGGGGG + Intergenic
1034960451 7:155361354-155361376 GTACCTGGGTGGTGTCAGGGAGG + Intronic
1034974821 7:155441934-155441956 AGCCCTGGGAGGGGGGAGGGAGG - Intergenic
1035483595 7:159205518-159205540 CAATCTGGGTGATGGGATGGAGG - Intergenic
1035752726 8:2007772-2007794 TTACCTGGGGGGTGGGCGGGAGG - Intergenic
1037084121 8:14826083-14826105 GGACATAGGTGGGGGGAGGGGGG - Intronic
1037579154 8:20234568-20234590 GGCCCTGGGTGGGGGGAGGGCGG - Intergenic
1037943717 8:22973663-22973685 AGAAATGGGTGATGGGAGGGAGG + Intronic
1038683425 8:29692579-29692601 CCAGCTGGGTGGGGGGAGGGGGG + Intergenic
1040356560 8:46624236-46624258 CAACCTGGGTGGTTGTTGGGTGG - Intergenic
1040981669 8:53251384-53251406 CGTGCTGGGAGGTGGGAAGGGGG - Intronic
1041655960 8:60350926-60350948 TGAGCTGGGTGCTGGGAGGAGGG - Intergenic
1041714818 8:60923337-60923359 CAAACTGGGCGGTGGGGGGGGGG + Intergenic
1042629939 8:70805507-70805529 CTCCCTGGGTGGGGGAAGGGCGG + Intergenic
1043202070 8:77382850-77382872 TGTCGTGGGTGGGGGGAGGGGGG - Intergenic
1043591893 8:81842317-81842339 CGAACTGGGCGGGGGGGGGGGGG + Intronic
1045112878 8:98949989-98950011 GCACCTGGGTGGAGGGTGGGGGG - Intronic
1045324625 8:101109129-101109151 GGACCTGGGCGGAGGGGGGGGGG - Intergenic
1045547314 8:103140630-103140652 CGGCCAGGGCGCTGGGAGGGAGG + Intronic
1046998954 8:120554486-120554508 TGACCTGCGTGGTGGGCGGGGGG + Intronic
1047753031 8:127896930-127896952 CCACCTGGGGGCTGGGCGGGCGG + Intergenic
1049045347 8:140146460-140146482 CGTGCTGGGTGTGGGGAGGGTGG + Intronic
1049457531 8:142701040-142701062 GGACCTGGGAGGTGGGCGGGAGG + Intronic
1049580177 8:143407518-143407540 CGACCTGGAGGGTGGGGCGGGGG - Intergenic
1049610743 8:143553638-143553660 CAGCCTGGGAGGAGGGAGGGAGG - Exonic
1049689603 8:143952872-143952894 GCCCCTGGCTGGTGGGAGGGAGG - Intronic
1049741871 8:144244824-144244846 CTACCAGGGTGGTGCTAGGGTGG + Intronic
1049766178 8:144356271-144356293 AGTCCTGGGTGGTGGCCGGGCGG - Intronic
1051174811 9:14350500-14350522 AGACCTGGGTGGGGTGGGGGGGG + Intronic
1053799761 9:41757003-41757025 ATACCTGGGAGGGGGGAGGGAGG - Intergenic
1054145450 9:61557931-61557953 ATACCTGGGAGGGGGGAGGGAGG + Intergenic
1054357130 9:64071817-64071839 CGGCCGGGGTCGCGGGAGGGGGG + Intergenic
1054650345 9:67619518-67619540 ATACCTGGGAGGGGGGAGGGAGG + Intergenic
1055987253 9:82063886-82063908 GGATCTGGAAGGTGGGAGGGTGG - Intergenic
1056951610 9:91044612-91044634 CGACCTTTGTGGTGTGAGTGGGG + Intergenic
1057353952 9:94320442-94320464 GGGCCTGGGTGGTGGCAGGTGGG + Exonic
1057353967 9:94320487-94320509 GGGCCTGGGTGGTGGCAGGTGGG + Exonic
1057353982 9:94320532-94320554 GGGCCTGGGTGGTGGCAGGCAGG + Exonic
1057546295 9:96021989-96022011 CGACCTGCGGGGTGGGCGTGAGG - Intergenic
1057653783 9:96937103-96937125 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1057653798 9:96937148-96937170 GGGCCTGGGTGGTGGCAGGTGGG - Exonic
1057677822 9:97149633-97149655 GGAGGTGGGTGTTGGGAGGGCGG - Intergenic
1058142867 9:101376568-101376590 GTACCTGGTTGGTGGGAGGCAGG - Intronic
1059112303 9:111568865-111568887 GGACCAGGGTGGTAGCAGGGAGG + Intronic
1059874761 9:118621793-118621815 AGATCTGGGTGCTGGGAGCGTGG + Intergenic
1059937145 9:119322609-119322631 GCACCTGGGCGGAGGGAGGGAGG - Intronic
1060096305 9:120793486-120793508 GGAGGTGGGTGGTGGGAGGCTGG + Intergenic
1061188956 9:129070765-129070787 TGACAAGGGTGCTGGGAGGGTGG + Exonic
1061657929 9:132107007-132107029 CTACCTGGTTGGGGGGCGGGGGG + Intergenic
1061896650 9:133651901-133651923 CCACATGGGTGGGGGGCGGGTGG - Intronic
1061962126 9:133993512-133993534 CACCCTGGGTGGTGGGGGCGCGG + Intergenic
1062200612 9:135300805-135300827 CGCCCTGGGTGAGGGGAGGCTGG + Intergenic
1062330910 9:136044565-136044587 CTCCCTGGGTGGTGGTGGGGGGG + Intronic
1062518523 9:136947734-136947756 CGGCCTGGGTGGGGGCAGGGAGG + Intronic
1062539131 9:137034021-137034043 GGACAGGGGTGGTGGGAGGCAGG - Intronic
1203748660 Un_GL000218v1:58556-58578 CGGCCGGGGTCGGGGGAGGGGGG + Intergenic
1185573458 X:1152285-1152307 GGAGCTGGGAGGAGGGAGGGAGG + Intergenic
1185579295 X:1198169-1198191 CTTCCTGGGAGGTGGGAGGGAGG - Intronic
1185579316 X:1198229-1198251 CTTCCTGGGAGGTGGGAGGGAGG - Intronic
1185579328 X:1198261-1198283 CTTCCTGGGAGGTGGGAGGGAGG - Intronic
1185579340 X:1198293-1198315 CTTCCTGGGAGGTGGGAGGGAGG - Intronic
1185579361 X:1198353-1198375 CTTCCCGGGAGGTGGGAGGGAGG - Intronic
1185579381 X:1198413-1198435 CTTCCTGGGAGGTGGGAGGGAGG - Intronic
1185579403 X:1198473-1198495 CTTCCCGGGAGGTGGGAGGGAGG - Intronic
1185761436 X:2691895-2691917 AGACCCGGGTGGTGGGGGGAAGG + Intronic
1186666283 X:11720657-11720679 CCACCTGGGTGGGGGTAGGGTGG - Intergenic
1186799401 X:13078309-13078331 TGACCAGGCTGGTGGGAGTGGGG + Intergenic
1187483133 X:19676346-19676368 CTACCTGGGTGGGGGCTGGGTGG + Intronic
1187833950 X:23411865-23411887 AGAGATGGGTAGTGGGAGGGTGG + Intergenic
1187908026 X:24085660-24085682 AGACCTGTGTCGTGGGGGGGGGG - Intergenic
1189281093 X:39820697-39820719 CCACCTGGGTGGTGGATGCGGGG - Intergenic
1189383968 X:40521601-40521623 GGAGTTGGGAGGTGGGAGGGGGG + Intergenic
1190075365 X:47313123-47313145 AGACCTGGGCGGTGGGGGGGGGG + Intergenic
1190581029 X:51893426-51893448 CGACCTGGTTGGTGGTGGGGTGG + Intronic
1192054418 X:67758780-67758802 TGACCTGGGGTGTGGGTGGGGGG + Intergenic
1193091074 X:77494406-77494428 CTCCCTGGGTGGGGGAAGGGAGG + Intergenic
1193250698 X:79288301-79288323 CGTGCTGGTTGGTGGGAGGAGGG - Intergenic
1193270031 X:79517922-79517944 TCACCTGGGTGGTGGCAGTGGGG - Intergenic
1195344948 X:103940498-103940520 CGATCTTGGTGGGGGGAGAGGGG - Intronic
1196609263 X:117692574-117692596 GGACCTGGGAGGAAGGAGGGAGG - Intergenic
1197427358 X:126313743-126313765 CGATGTGAGGGGTGGGAGGGAGG + Intergenic
1197633193 X:128885719-128885741 GTACCAGGGTGGTGGGAGAGGGG + Intergenic
1197700656 X:129597147-129597169 AGGCCTGGGTGATGGGAGAGAGG - Intergenic
1197712329 X:129680234-129680256 AGGCCAGGGTGGTGGCAGGGAGG + Intergenic
1198531830 X:137555545-137555567 CTACTTGGGTGGTAGGAGGCAGG + Intergenic
1199900301 X:152166361-152166383 GGATATGGGGGGTGGGAGGGCGG - Exonic
1201162016 Y:11173526-11173548 CGGCCGGGGTTGGGGGAGGGGGG + Intergenic
1202085585 Y:21133351-21133373 TGAAGTGGGTGGTGGGATGGTGG - Intergenic