ID: 1128208139

View in Genome Browser
Species Human (GRCh38)
Location 15:65870365-65870387
Sequence GTGGTGGGAGGGAGGGTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1641
Summary {0: 1, 1: 0, 2: 7, 3: 138, 4: 1495}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128208126_1128208139 0 Left 1128208126 15:65870342-65870364 CCCTTGTCTCCGTTGCGACCTGG 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG 0: 1
1: 0
2: 7
3: 138
4: 1495
1128208122_1128208139 24 Left 1128208122 15:65870318-65870340 CCTCCCCAAATCGTGTTTAGAGC 0: 1
1: 0
2: 1
3: 3
4: 34
Right 1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG 0: 1
1: 0
2: 7
3: 138
4: 1495
1128208125_1128208139 19 Left 1128208125 15:65870323-65870345 CCAAATCGTGTTTAGAGCTCCCT 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG 0: 1
1: 0
2: 7
3: 138
4: 1495
1128208124_1128208139 20 Left 1128208124 15:65870322-65870344 CCCAAATCGTGTTTAGAGCTCCC 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG 0: 1
1: 0
2: 7
3: 138
4: 1495
1128208133_1128208139 -9 Left 1128208133 15:65870351-65870373 CCGTTGCGACCTGGGTGGTGGGA 0: 1
1: 0
2: 1
3: 9
4: 93
Right 1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG 0: 1
1: 0
2: 7
3: 138
4: 1495
1128208128_1128208139 -1 Left 1128208128 15:65870343-65870365 CCTTGTCTCCGTTGCGACCTGGG 0: 1
1: 0
2: 0
3: 8
4: 142
Right 1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG 0: 1
1: 0
2: 7
3: 138
4: 1495
1128208123_1128208139 21 Left 1128208123 15:65870321-65870343 CCCCAAATCGTGTTTAGAGCTCC 0: 1
1: 0
2: 1
3: 4
4: 45
Right 1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG 0: 1
1: 0
2: 7
3: 138
4: 1495
1128208120_1128208139 29 Left 1128208120 15:65870313-65870335 CCTTCCCTCCCCAAATCGTGTTT 0: 1
1: 0
2: 1
3: 18
4: 226
Right 1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG 0: 1
1: 0
2: 7
3: 138
4: 1495
1128208121_1128208139 25 Left 1128208121 15:65870317-65870339 CCCTCCCCAAATCGTGTTTAGAG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG 0: 1
1: 0
2: 7
3: 138
4: 1495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128208139 Original CRISPR GTGGTGGGAGGGAGGGTAAG AGG Intronic
900156271 1:1204499-1204521 GTGGGGGGAGGGAGGGAGGGAGG + Intronic
900244827 1:1632073-1632095 GTGGTGGGGGGGAGGGAGACGGG - Exonic
900467263 1:2831874-2831896 GAGGCGGGGGGGAGGGCAAGCGG - Intergenic
900512490 1:3067238-3067260 GTGTGGGGAGGGTGGGTAAAGGG + Intergenic
900680922 1:3915765-3915787 GGGGAGGGAGGGAGGGCCAGGGG - Intergenic
900703591 1:4062595-4062617 GTGGAGGGAGGGATGGGAAGAGG - Intergenic
900996012 1:6124113-6124135 GTGGTGGGAGGGAAGGTGGAAGG + Intronic
901066513 1:6497125-6497147 GCGGGGGGAGGGAGGAGAAGCGG + Intronic
901216751 1:7559379-7559401 AAGGTGGCAGGGAGGGCAAGAGG - Intronic
901221376 1:7585843-7585865 GAGGTGGGAGGCAGGGGAGGTGG - Intronic
901401301 1:9016809-9016831 GTGGAGGGAAAGAGGATAAGAGG - Intronic
901438032 1:9261502-9261524 GGAGTGGGAGGGAGGGAAAGTGG - Intronic
901522667 1:9797299-9797321 GTGGGGAGAGGAAGGGGAAGTGG + Intronic
901668179 1:10838333-10838355 GTGGTGGGAGGGAAGGCCAAGGG + Intergenic
901829021 1:11880872-11880894 GAGGCGGGAGGGAGGGAGAGAGG - Intergenic
902231101 1:15028188-15028210 GAGGTGGGAGGGAGGGTGTGTGG - Intronic
902261072 1:15225205-15225227 GGGAGGGGAGGGAGGGGAAGGGG + Intergenic
902291767 1:15440220-15440242 GGGGTGGGAGGGTGGGCAGGTGG - Intronic
902576080 1:17378511-17378533 GTGGTGGAAGGGATGGGAGGTGG + Intronic
902628378 1:17689857-17689879 GTGGTGGGAGGCAGGATGTGTGG + Intronic
902635865 1:17734921-17734943 TTGGTGGGAGGGAGGGAGAGGGG - Intergenic
902793924 1:18787974-18787996 GAGGAGGGAGGGAGAGAAAGGGG + Intergenic
902825312 1:18969361-18969383 GTGCTGGGTGGGAGGGTAGGGGG + Intergenic
902873636 1:19328465-19328487 GGGGTGGGAGGGAGGGGAGAGGG + Intronic
902880368 1:19368255-19368277 GTGGTGGGATGGAGCGCAGGCGG + Intronic
902988677 1:20171187-20171209 CTGGTGGGAGGGATGGGGAGAGG - Intronic
903293789 1:22330961-22330983 GAGGAGGGAGGGAGGGAGAGAGG + Intergenic
903331738 1:22600139-22600161 GAGGAGGGAGGGAGGGAAGGAGG + Intronic
903364071 1:22795105-22795127 GTGGGGGGAGTGAGGATAACAGG - Intronic
903606464 1:24578468-24578490 GGGGTGGGAGGGAGGGTAGCTGG + Intronic
903649820 1:24915764-24915786 GATGTGGGAGGGAGGGCAGGGGG + Intronic
903714947 1:25358437-25358459 GAGGTGGGTGGGAAGGGAAGGGG - Intronic
903927258 1:26839459-26839481 GGGGTGGCAGGGAAGGTAAGGGG - Intronic
904009692 1:27382722-27382744 GTGTTGGGTGGGAGGGTGGGCGG - Intronic
904428840 1:30448832-30448854 GGTTTGGGAGGGAGGGGAAGGGG + Intergenic
904485661 1:30823212-30823234 GTGGTGGAAGGGAGAGGAAAAGG - Intergenic
904880155 1:33690287-33690309 AAGGTGGGTGGGAGGGTAATGGG - Intronic
904941447 1:34166823-34166845 GTGGGGGGAGGGAGGAAGAGTGG - Intergenic
905241264 1:36583133-36583155 TGGGTGGGTGGGTGGGTAAGTGG - Intergenic
905495955 1:38386354-38386376 GTGCTGGGGGGCAGGGGAAGTGG - Intergenic
905753443 1:40486481-40486503 GTGGTGGGAGGGAGGGAGGGAGG - Intronic
906150473 1:43584533-43584555 GTGGGGGAAGGGAGGGGACGAGG - Intronic
906187343 1:43871745-43871767 GGGGTGGGAGGGAGAGGATGAGG + Intronic
906225276 1:44117032-44117054 GGGTAGGGAGGGAGGGAAAGAGG - Intergenic
907391602 1:54161743-54161765 GTGGTGGGAAGGATGAGAAGGGG - Intronic
907423502 1:54363529-54363551 GTGGTTGGTGTGAGAGTAAGGGG - Intronic
907663469 1:56414545-56414567 GTGGTGGGGGGCAGGGTGGGGGG - Intergenic
907778019 1:57537924-57537946 GTGGTGGGAGAGAAGGCTAGGGG + Intronic
907802074 1:57778949-57778971 GTGGAGTGAAGGAGGGAAAGAGG - Intronic
907954679 1:59216778-59216800 AGGAAGGGAGGGAGGGTAAGGGG + Intergenic
908391391 1:63686823-63686845 ATGGAGGGTGGGTGGGTAAGCGG - Intergenic
908829297 1:68163566-68163588 GCGGAGGGAGGGAGGGGGAGTGG - Intronic
908914449 1:69109654-69109676 GTGGGGGTAGAGAGGGAAAGAGG - Intergenic
909082115 1:71124853-71124875 GTTGTGGGATGGAGGGAGAGGGG + Intergenic
909181989 1:72436027-72436049 GTGGTAGGATGGAGGGGAGGTGG - Intergenic
909203611 1:72725440-72725462 GTGGTGCTGGGGCGGGTAAGTGG - Intergenic
909224922 1:73007071-73007093 GTGGTGGGAGGGAGAGCATCAGG + Intergenic
909268108 1:73588400-73588422 GTGGAGGGAGGGAGGGCATCAGG - Intergenic
909350991 1:74653078-74653100 ATGGTGGGAGGCAGGGTTAGAGG - Intronic
909514270 1:76489774-76489796 GAGGTGGGAGGGAAGAAAAGTGG + Intronic
909945928 1:81663042-81663064 GGGGTGGGAGGGAGGGGTCGGGG - Intronic
910206847 1:84756750-84756772 GGGGTGAGAGAGAGGGTGAGAGG + Intergenic
911031727 1:93496213-93496235 GGGGAGGGGGAGAGGGTAAGAGG - Intronic
911239609 1:95450722-95450744 GTGTAGTGAGTGAGGGTAAGAGG + Intergenic
911556317 1:99349006-99349028 GTGGTGGGGGGGCGGTTCAGGGG + Intergenic
911702255 1:100967285-100967307 GTGGTGGGAGGGATGGTTTTGGG + Intronic
912019007 1:105080887-105080909 GAGAGGGGAGGAAGGGTAAGAGG - Intergenic
913017875 1:114757637-114757659 GTGGGGGGAGGGAGCGAAAATGG - Intronic
913164797 1:116175158-116175180 GAGGTGGAAGTGAGGGTAGGGGG + Intergenic
913254727 1:116943384-116943406 TGAGTGGGAGGGAGAGTAAGGGG + Intronic
913306395 1:117431186-117431208 GTGGGGAGAGGGAGGGGGAGGGG + Intronic
913713345 1:121509683-121509705 AGGGTGGGAGGAAGGGAAAGGGG + Intergenic
914222145 1:145690765-145690787 GTGTTTGGAGAGAGGGGAAGAGG + Intronic
914258802 1:145981731-145981753 GTGGTTTGAGGGAGGCTAAATGG + Intergenic
914362269 1:146945091-146945113 ATGGAGGGAGGGAGGGAAGGAGG - Intronic
914489406 1:148141987-148142009 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
914780408 1:150780865-150780887 GTGGGGAGAGGGAGGGGGAGGGG - Intergenic
914805010 1:150985318-150985340 GTGATGGCAGGGATGGCAAGGGG - Intronic
914902161 1:151716662-151716684 GGGGTGGGAGGGGGGCTGAGGGG - Exonic
915301747 1:154955674-154955696 GTGGAGGGAGGGAGTGGAGGTGG - Intronic
915691563 1:157695929-157695951 GGGGAGGGAGGGAGGGGAGGGGG - Intronic
915713134 1:157920272-157920294 GTGGTGGGAGAGTGGGAAGGGGG - Intergenic
915780682 1:158546829-158546851 GTGGTAGGAGGGAGGAAAGGAGG - Intergenic
915839119 1:159201298-159201320 GAGGGGTGAGGAAGGGTAAGGGG + Exonic
915878812 1:159643442-159643464 GAGGGGGGAGGGAGGGGGAGGGG + Intergenic
915915393 1:159937602-159937624 CTGGTGGGAGAAAGGGGAAGAGG - Intronic
915973539 1:160370640-160370662 GTGGTGGGAGGGGGAGGAAGGGG - Exonic
916078489 1:161217586-161217608 GTAGTGGGAGGGAGAGGTAGTGG - Intronic
916641943 1:166739196-166739218 GTGTGGGGTGGGAGGGCAAGAGG - Intergenic
916737367 1:167619766-167619788 GTGGTGGGAGAGTGGGGAAAGGG + Intergenic
916740671 1:167644655-167644677 GTGGGGGGAGGAAGTGGAAGGGG - Intronic
917014302 1:170512102-170512124 GTGGTGGGGGGGTGGGTGGGGGG - Intergenic
917740489 1:177957786-177957808 AGGGTGGGAGGGAGGGTGGGTGG - Intronic
917766417 1:178223463-178223485 GTGGTGGGAAGGAGAGTGACAGG + Intronic
917946558 1:179978536-179978558 GGGCTGGGAGGGGGGTTAAGGGG - Intronic
918183432 1:182106360-182106382 GGGGTTGGAGAAAGGGTAAGAGG - Intergenic
918293976 1:183137813-183137835 ATGATGGCAGGGATGGTAAGAGG + Exonic
918356686 1:183711417-183711439 GTGGTGGGTGGGAGAGTTGGAGG - Intronic
918446476 1:184622215-184622237 AAGGAGGAAGGGAGGGTAAGTGG + Exonic
918760696 1:188401785-188401807 GTGGGGAAAGGGAGGGTGAGGGG + Intergenic
918801494 1:188978383-188978405 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
918801518 1:188978448-188978470 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
918835733 1:189462888-189462910 GTTGTGGCAGGGCTGGTAAGTGG - Intergenic
919443403 1:197668581-197668603 CTGGTGGGAGAGAAGGGAAGGGG - Intronic
919738596 1:200969287-200969309 GTGGTGGGTGGGTGGGTGAATGG - Intergenic
919742315 1:200988552-200988574 AGGGCGGGAGGGAGGGAAAGGGG + Intronic
919750558 1:201034996-201035018 GAAGTGGGAGGGAGGGGAAGTGG - Intergenic
919822804 1:201483657-201483679 GTGGTGGGAGGAAGGGGAAAGGG - Exonic
919953798 1:202392462-202392484 ATAGGAGGAGGGAGGGTAAGAGG + Intronic
920106213 1:203555574-203555596 GGGGTGAGAGGGAGGGAAGGAGG - Intergenic
920164538 1:204026302-204026324 GTGGTGGGAGTGAGAGGCAGAGG + Intergenic
920376158 1:205509295-205509317 GTGGGGGTAGGGAGGCTCAGAGG - Intronic
920376694 1:205512570-205512592 CTGGTGGGAGGGAGGCCATGCGG + Intronic
920816371 1:209336933-209336955 GTGGGTGGAGGGAGGGAAGGGGG + Intergenic
920852879 1:209640584-209640606 GTGGTGGGAGGTGGGGCAATGGG - Intronic
920877108 1:209846693-209846715 GAGGAGGAAGGCAGGGTAAGGGG + Intronic
921372923 1:214443975-214443997 GTGGTGGGAGTGAGAGTGGGAGG + Intronic
921448800 1:215278448-215278470 GAGGTGGGAGTGAGGGTGAGTGG + Intergenic
921514481 1:216073026-216073048 GGGCTGGCAGGGAGGGAAAGGGG + Intronic
921774434 1:219080767-219080789 GTGGTGGGCAGGGGGGTAGGAGG + Intergenic
921945401 1:220882751-220882773 GAGGAAGGAGGGAGGGTGAGAGG - Intronic
921973180 1:221173346-221173368 GTGGGGGGGGGGAGGGTACATGG + Intergenic
921974833 1:221191267-221191289 GTGGGGGGTGGGGGGGTCAGGGG - Intergenic
922065985 1:222143759-222143781 GTAGTGGGGGAGAGGGGAAGTGG + Intergenic
923193144 1:231640190-231640212 GAGGAGGGAGAGAGGGGAAGGGG - Intronic
923373893 1:233340580-233340602 GGGGTGGGAGTCAGGGGAAGGGG + Intronic
923501043 1:234564636-234564658 TTGGTGGGAGGGAAGGGATGGGG + Intergenic
923859954 1:237883615-237883637 GAGGTGGGAGAGAGGGGGAGGGG + Intronic
924214712 1:241809193-241809215 TTGGGGGGAGGGGGGGTGAGGGG + Intergenic
1062844107 10:690950-690972 GTGGTGGGGGGTAGGGGTAGGGG - Intergenic
1062922848 10:1293044-1293066 GCAGAGGGAGGGAGGGAAAGGGG + Intronic
1063117156 10:3079658-3079680 GGGGTGGGGGGGGGGGGAAGAGG + Intronic
1063156347 10:3382399-3382421 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1064114823 10:12568506-12568528 GGGGAGGGAGGGAGGGAAAGAGG - Intronic
1064142148 10:12799398-12799420 TAGGAGGGAGGGAGGGAAAGAGG + Intronic
1064179019 10:13099431-13099453 GGGATGGGAGGGAGGGAAGGAGG - Intronic
1064229013 10:13513530-13513552 GCTGTGGGAGGGAGGGGAGGAGG - Intronic
1064619468 10:17201152-17201174 GGGGAGGGAGGGAGTGTCAGGGG - Intronic
1064686455 10:17867110-17867132 AGGGAGGAAGGGAGGGTAAGGGG - Intronic
1065297399 10:24289821-24289843 GTGGTAGGAGGGAAGGTAAGTGG + Intronic
1065324452 10:24538523-24538545 ATGGAGGGAGAGAGGGTAGGAGG + Intronic
1065834177 10:29641972-29641994 CTGGTGGGAGGGAGGATAGGAGG - Intronic
1065866492 10:29919413-29919435 GAGGAGGAAGAGAGGGTAAGAGG - Intergenic
1066081948 10:31939661-31939683 GAGGTGGGTGGGAGGATAAAAGG + Intergenic
1066153382 10:32649163-32649185 GTGGTGGGAGGGAGAGTGTCAGG + Intronic
1066388580 10:34961039-34961061 GTGGAGGGAGGCAGCGTGAGAGG + Intergenic
1066499140 10:35973179-35973201 CTGGTGGGTTGCAGGGTAAGGGG - Intergenic
1066616011 10:37295580-37295602 GTGGAGGCAGGGAGGCCAAGTGG + Intronic
1066648690 10:37635676-37635698 GAGGTGGGAGGCAGGTTGAGAGG + Intergenic
1067031574 10:42881366-42881388 GAGGTGGGAGGCAGGTTGAGAGG + Intergenic
1067213196 10:44278969-44278991 GTGGTGGGCGGGTGGGTTAGGGG - Intergenic
1067292597 10:44955085-44955107 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1067391419 10:45866400-45866422 GTGGGGAGAGGGAGAGTGAGAGG + Intergenic
1067575406 10:47405396-47405418 ATAGTGGGAGGGAGGGTGTGGGG - Intergenic
1067665522 10:48274741-48274763 GTGGTGGCAGGAAAGGGAAGGGG - Exonic
1067871871 10:49969751-49969773 GTGGGGAGAGGGAGAGTGAGAGG - Intronic
1067979960 10:51074070-51074092 GAGGTGGGAGGGAGGGGACAGGG - Intronic
1068114724 10:52724364-52724386 GGGGTGGGGGTGGGGGTAAGGGG - Intergenic
1068627412 10:59264189-59264211 GGGGTGGAAGGGAGGGAAGGAGG + Intronic
1068649404 10:59504827-59504849 GTGGGGGGAGGGATGGGAAAAGG - Intergenic
1068734660 10:60399377-60399399 GTGGTGGGAGGGAGGAGGATGGG - Intronic
1069601725 10:69712322-69712344 GGGGTGGGTGAGAGGGTAGGGGG - Intergenic
1069761131 10:70812400-70812422 GTCGAGGGAGGGAGGGTGATTGG - Intergenic
1069833510 10:71294960-71294982 ATGGGAGGAGGGAGGGGAAGGGG - Intronic
1069883582 10:71609301-71609323 GTGGTCGGAGGGAGAGGGAGAGG - Intronic
1070040289 10:72771816-72771838 GTAGTGGGGAGGAGGGCAAGGGG - Intronic
1070128360 10:73639818-73639840 GTGGTGGGAAGGCGGGTGATGGG - Intronic
1070463921 10:76699397-76699419 GTGGTGGGAGGCATGGGAGGAGG - Intergenic
1070746516 10:78937070-78937092 GGGGTGGCAGGGAGGGCAAGTGG - Intergenic
1071490215 10:86131173-86131195 GTGGTGGGATGCAGGGGGAGGGG - Intronic
1071549146 10:86552846-86552868 GTGGAAGGTGGAAGGGTAAGAGG - Intergenic
1071697288 10:87890012-87890034 GTGGTGGGAGGTGGGGGAAGCGG - Intronic
1071880162 10:89888636-89888658 GTGGGGGGTGGGGGGGTAGGGGG - Intergenic
1072079201 10:92012074-92012096 GGGGAGGGAGGGAGGGAAGGAGG - Intronic
1072105534 10:92270034-92270056 GGGGTGGGGGGGAAGGTAAGAGG + Intronic
1072204345 10:93189165-93189187 ATGATGGGTGGGGGGGTAAGTGG - Intergenic
1072554279 10:96502792-96502814 TGGGTGGGAGGCAGGGAAAGAGG + Intronic
1072605552 10:96979085-96979107 GTGGAGGGTGGGAAGGTAGGAGG + Intronic
1072633221 10:97161202-97161224 GTGCTGGGAAGGAGGGGAGGAGG - Intronic
1072733796 10:97865819-97865841 GGGGTGGGAGGGAGGGTGACGGG + Exonic
1073051159 10:100668221-100668243 GGGGCGGGAGGAGGGGTAAGAGG - Intergenic
1073124243 10:101140001-101140023 TGGGGGGGAGGGAGGGTAGGAGG - Intergenic
1073149217 10:101300354-101300376 GTGGTGGGAGAGGGGGTATCAGG + Intergenic
1073332438 10:102679147-102679169 GAGGTGGGAGGGGAGGGAAGGGG + Intronic
1073467095 10:103700602-103700624 GTGGGAGGAGGCAGGGTTAGGGG + Intronic
1073917956 10:108428014-108428036 GGGGAGGGAGGGAGGGAAGGAGG - Intergenic
1073944076 10:108730281-108730303 GTGGAGGGAGGGAGGGAGGGAGG + Intergenic
1074007276 10:109440048-109440070 GTGGTGGGAGGTGGGGCAAGGGG - Intergenic
1074217718 10:111403879-111403901 GTGGGGGGAGAGAGGGGGAGTGG - Intergenic
1074293393 10:112158868-112158890 GTGGTGGGATGGAAGGGATGAGG - Intronic
1074377530 10:112951715-112951737 GGGGAGGGAGGGAGGGGAGGAGG - Intronic
1074828737 10:117233204-117233226 GTGGGGAAAGGGAGGGCAAGAGG + Intergenic
1075427218 10:122351229-122351251 GTGGCCTGAGGGAGGGTCAGTGG + Intergenic
1075474810 10:122725066-122725088 GTGGTGGGTGTGAGTGTGAGTGG - Intergenic
1075914462 10:126155554-126155576 GAGGTGGGAGGAAGGGAGAGAGG - Intronic
1075989763 10:126825722-126825744 GTGGTGGCAAGGAGGGTTGGTGG - Intergenic
1076309251 10:129492412-129492434 GGGGTGGGAGGAAAGGTAGGCGG - Intronic
1076563120 10:131380552-131380574 GTGAAGGGAGCGAGGGCAAGGGG + Intergenic
1076883735 10:133252002-133252024 GTGGAGGGAGGGAGGGTGGCCGG - Intergenic
1076942911 10:133621786-133621808 GTGGGGGGTGGGAGGGGGAGAGG + Intergenic
1077138136 11:1011729-1011751 GTGGAGGCAGGGAGGGTGGGTGG + Exonic
1077272253 11:1686821-1686843 GAGGAGGAAGGGAGGGAAAGAGG - Intergenic
1077304859 11:1864456-1864478 GCGGAGGGAGGAAGGGAAAGAGG + Intronic
1077343888 11:2037635-2037657 GAGGTGGGAGGGAGAGGGAGAGG + Intergenic
1077357434 11:2125067-2125089 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357455 11:2125158-2125180 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357473 11:2125256-2125278 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357492 11:2125354-2125376 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357547 11:2125627-2125649 GTGGATGGATGGAGGGTGAGTGG + Intergenic
1077357565 11:2125722-2125744 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357586 11:2125813-2125835 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357604 11:2125911-2125933 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077357624 11:2126006-2126028 GTGGGTGGATGGAGGGTGAGTGG + Intergenic
1077479926 11:2808985-2809007 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
1077751456 11:4974963-4974985 GTGGGGGGAGGGAGAGTATTAGG + Intronic
1077886097 11:6389452-6389474 GTTGTGGGAGTGAGGGGAAGAGG + Intergenic
1077889240 11:6406779-6406801 GTGGTGGGGGAGAGGGCAATGGG - Intronic
1078069311 11:8097855-8097877 GGAGTGGGAGGGAGGGGCAGGGG + Intronic
1078101309 11:8331949-8331971 GTGGTGGGAAGGACTGTAGGAGG - Intergenic
1078312670 11:10260896-10260918 GGGGAGGGAGGGAGGGAGAGAGG + Intronic
1078364493 11:10694805-10694827 GTGCTGGGATGGAGGCTCAGTGG - Intergenic
1078431660 11:11292932-11292954 GTGGTGGAGGAGAGGGGAAGGGG - Intronic
1078459587 11:11503899-11503921 GTGGTGGAAGGGAGAACAAGGGG - Intronic
1078536895 11:12182538-12182560 GAGTTGGGAGGAAGGGAAAGAGG - Intronic
1078655913 11:13239008-13239030 GTGGAGGGAAGGAAGGGAAGAGG - Intergenic
1078753520 11:14187371-14187393 GTGGTGGGAGTTAGGCTATGGGG - Intronic
1078774656 11:14383122-14383144 ATGGTGGGAGGTAGGGGGAGTGG - Intergenic
1078968308 11:16373802-16373824 GGGGAGGGAGGGAGGGAGAGAGG + Intronic
1079085671 11:17443125-17443147 GTCGAGGGAAGGAGGGGAAGAGG + Intronic
1079189375 11:18265072-18265094 GGGAAGGGAGGGAGGGAAAGAGG + Intergenic
1079308136 11:19342642-19342664 GGGGAGGGAGGGAGGGAAGGAGG + Intergenic
1080121613 11:28684450-28684472 GTGGAGGGTGGGAGGGGCAGGGG + Intergenic
1080368611 11:31608586-31608608 GTGCTGGGTGGGGGGGTCAGGGG + Intronic
1080478379 11:32619884-32619906 GGGAAGGGAGGGAGGGGAAGGGG + Intronic
1080724992 11:34888561-34888583 GTAGTAGGCAGGAGGGTAAGTGG + Intronic
1080789577 11:35510193-35510215 ATTGTGGGAGGGAGGGTATGTGG - Intronic
1081382855 11:42436970-42436992 GAGGTGGGAGGGAGGGAGAAGGG + Intergenic
1081831717 11:46120733-46120755 GTGGGGGGAGGTAGGGGGAGGGG - Intronic
1081833941 11:46137957-46137979 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1081992784 11:47346659-47346681 GGGGTGGGAGAAAGGGTAGGTGG + Intronic
1082059394 11:47847647-47847669 GTGGGGGGGGGGAGGGGGAGAGG + Intronic
1082073850 11:47961425-47961447 GTGGTGGGAGGGAGCACAGGAGG - Intergenic
1082565813 11:54676804-54676826 GTGGGGGAAGGGAGGGGAAAGGG - Intergenic
1082914742 11:58420507-58420529 GTGGTGGGAGTGGGGGAAATAGG + Intergenic
1083042100 11:59699030-59699052 GTGGGGAGAGGGAGGGGGAGGGG - Intergenic
1083142537 11:60733812-60733834 GTGGTGGGAGGGAGTGTTGCTGG - Intronic
1083186205 11:61019386-61019408 GAGCTGGGAGGGTGGGAAAGGGG - Exonic
1083343198 11:61972139-61972161 GTGGAGGGAGGGAGGGAGGGAGG + Intergenic
1083397473 11:62401626-62401648 GGGGAGGGAGAGAGGGCAAGGGG - Intergenic
1083544404 11:63538043-63538065 GGGGTTTGAGGGAGGGGAAGAGG + Intronic
1083595622 11:63917251-63917273 GGGGTGGGAGGGAGGGCCCGGGG + Intergenic
1083633151 11:64105972-64105994 GGGGTGGGCGGGAGGGGAAAAGG + Intronic
1083728709 11:64642055-64642077 GAGGTGGGAGAGAGGTGAAGGGG + Intronic
1083930035 11:65836895-65836917 GTGGGGGGCTGGGGGGTAAGGGG + Intronic
1084006430 11:66325913-66325935 GTGGGGGGAGGCAGGGACAGGGG - Intergenic
1084178872 11:67436958-67436980 GAGATGGGAGGGAGGGAAGGAGG + Intronic
1084205464 11:67589177-67589199 ATGGTGGCAGGGGAGGTAAGGGG + Intergenic
1084438627 11:69158063-69158085 GTGGTGGGAGGGAGGGGAGCAGG + Intergenic
1084596944 11:70122616-70122638 GAAGGGGGAGGGAGGGAAAGAGG - Intronic
1084616814 11:70241918-70241940 GTGATGGCTGGGTGGGTAAGTGG - Intergenic
1084661964 11:70551312-70551334 GCGGTGGGAGGGAGGGGGAGGGG - Intronic
1084713054 11:70856095-70856117 GTGGTGGGAGGATGGGTGAATGG + Intronic
1084724366 11:70931207-70931229 CTGCAGGGAGGGAGGTTAAGGGG + Intronic
1084763259 11:71287887-71287909 GGGGTGGGAAGGAGAGAAAGGGG - Intergenic
1084772644 11:71353836-71353858 ATGGAGGGAGGGAGGGAAAGAGG + Intergenic
1084906775 11:72354597-72354619 GTGGTGGGAGGGAGGGAGGAAGG - Intronic
1084927570 11:72525673-72525695 GGTGTGGGAGGGAGGCAAAGAGG + Intergenic
1084933321 11:72574055-72574077 GAGGTGGGAGGAAGGGAGAGAGG - Intergenic
1085054100 11:73394135-73394157 GTGGTGGTATGGAGGGTAGGTGG + Intronic
1085112234 11:73898189-73898211 GTGGGGAGAGGGAGGGGGAGGGG + Intronic
1085196657 11:74676761-74676783 GTGGGAAGAGGGAGGGCAAGGGG - Intergenic
1085301782 11:75462934-75462956 CTGGTGGGAGGCAGCCTAAGGGG - Intronic
1086144087 11:83531985-83532007 GGGGTGGGAGGGTGGGGAAATGG + Intronic
1086324347 11:85682859-85682881 GTTGTGGGAGGGAGGAGGAGCGG + Intronic
1086829790 11:91546271-91546293 GGGGAGGGAGGGAGGGAATGTGG + Intergenic
1087093975 11:94303009-94303031 GTGGAGGGAGGGAGGGAGGGAGG - Intergenic
1087117099 11:94537248-94537270 GGGGAGGGAGGGAGGGGGAGAGG - Intergenic
1087212542 11:95458472-95458494 GTGGCGGGGGGGGGGGGAAGAGG + Intergenic
1087985732 11:104677212-104677234 TTGCAGGGAGGGAGGGAAAGAGG - Intergenic
1088031957 11:105262087-105262109 CTGGAGGGAGGGAGGGAGAGAGG + Intergenic
1088077095 11:105863605-105863627 GGAGTGGGAGGGAGGGAAATGGG - Intronic
1088391869 11:109323751-109323773 GAGGTGGGAGGGAGGGAGGGAGG - Intergenic
1088395043 11:109358116-109358138 AGGGTGGGAGGGTGGGAAAGTGG - Intergenic
1088707228 11:112474755-112474777 GGGGTGGAAGGGAGGATTAGGGG - Intergenic
1088827480 11:113508000-113508022 TTGGTGGGTGGGAGGGTTAGGGG - Intergenic
1089011904 11:115138333-115138355 GTGGAGGCAGGGAGGGTGGGAGG - Intergenic
1089262652 11:117232916-117232938 GTGGGGGGACCGAGGGGAAGGGG + Intronic
1089524728 11:119089483-119089505 GCTGGGGGAGGGAGGGTAGGAGG + Intronic
1089564878 11:119365388-119365410 GTGGTGGGAGGAGGGGGCAGGGG + Intronic
1089580036 11:119476005-119476027 GTGAAGGGAGGGAGGGAGAGAGG + Intergenic
1089786384 11:120910363-120910385 GTGGTTGGAGTGAAGGCAAGTGG + Intronic
1090090708 11:123695147-123695169 GAGGAGGGAGGGAGAGTAGGTGG - Intergenic
1090556525 11:127882674-127882696 GTAGTGAGAGGGAGGGAATGGGG - Intergenic
1090689948 11:129170325-129170347 GTTGTGGGGTGGAGGGTGAGGGG - Intronic
1090754638 11:129779128-129779150 CTGGTGGGAGCCAGGGTAATGGG + Intergenic
1090791348 11:130092698-130092720 GTGGGGGGAGGGAGGGGGAGGGG + Intronic
1090854213 11:130598079-130598101 GAGGTGGGAGGGAGTGTGTGTGG + Intergenic
1091038111 11:132252082-132252104 GAGGTAGGAGGGAGGCTGAGGGG - Intronic
1091113802 11:132995442-132995464 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1091124349 11:133082383-133082405 GGGGTGCGGGGGAGGGGAAGAGG - Intronic
1091318390 11:134632347-134632369 GTGGTGGGAGGGAAGCAAGGGGG - Intergenic
1202826874 11_KI270721v1_random:92824-92846 GAGGTGGGAGGGAGAGGGAGAGG + Intergenic
1091393436 12:139392-139414 GTCCTGGGAGGGAGGGAAGGAGG + Intronic
1091400340 12:177354-177376 GAGGTGGGAGGGAGGGCCTGGGG - Exonic
1091436107 12:474332-474354 GTGTTGTGAGGGAGGGGACGGGG - Intronic
1091670123 12:2446615-2446637 GTGGTGAGTGGGTGGGTAGGTGG + Intronic
1091728078 12:2859166-2859188 GAGCTGGGAGGCAGGGTCAGAGG + Exonic
1091856703 12:3746391-3746413 GTGGAGGAAGGGTGGGGAAGAGG - Intronic
1092062208 12:5560660-5560682 GTGGGCTGAGGGTGGGTAAGAGG - Intronic
1092119526 12:6034277-6034299 GTGCTGGAAGGGAGGCTGAGCGG + Intronic
1092164793 12:6336228-6336250 CTGGAGGGAGGGAGGGAGAGAGG + Intronic
1092280664 12:7095631-7095653 GTGGGGGCTGGGAGGGAAAGCGG + Exonic
1092282603 12:7109024-7109046 GTGGGGGGAGGGAGGGTTTGCGG + Intronic
1092917499 12:13201993-13202015 AGGGAGGGAGGGAGGGCAAGTGG + Intronic
1092964617 12:13629618-13629640 GAGGAGGGAAGGAGGGAAAGAGG - Intronic
1093038333 12:14354034-14354056 GGGGAGGGAGGGAGGGGGAGAGG - Intergenic
1093224342 12:16463440-16463462 GTGGGGGGAGGGAGGGCATCAGG + Intronic
1093253706 12:16839706-16839728 GTGGGAGGAGGGAGGGTATCAGG + Intergenic
1093531744 12:20174306-20174328 GGGGTGGGGGGGAGGGAATGAGG - Intergenic
1094108050 12:26833535-26833557 ATGGGGGCAGGGAGGGTGAGAGG + Intergenic
1094230223 12:28094111-28094133 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1095126433 12:38483689-38483711 GTGGTGGGAGGGAGTGTTGGGGG + Intergenic
1095703273 12:45212814-45212836 GTGGGGGGAGGGAGGGCATCAGG - Intergenic
1096002561 12:48141706-48141728 GTGATGGCGGGGAGGGGAAGGGG - Intronic
1096124598 12:49110225-49110247 GGGGTGGGAGGGAGGGGCAGGGG + Intronic
1096385935 12:51195583-51195605 GTGGAGGGATGGAGGGGTAGAGG + Intronic
1097009050 12:55939541-55939563 GAGCTGGGAGGTAGGGGAAGAGG + Intronic
1097020505 12:56017391-56017413 GTGGTGTGAGGGAGGGTGACAGG - Intronic
1097196066 12:57243071-57243093 GGGGGTGGAGGGTGGGTAAGGGG - Intergenic
1097721044 12:63021757-63021779 GAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1097991058 12:65834503-65834525 AGGGAGGGAGGGAGGGCAAGAGG - Intronic
1098243256 12:68489064-68489086 CTGGTGGGAGGGAGTGAAGGGGG - Intergenic
1098820864 12:75227223-75227245 ATGGAGGGAGGGAGGGACAGAGG + Intergenic
1098836515 12:75429796-75429818 GTGGCAGGAGGGAGAGTGAGGGG - Intronic
1099228390 12:79995353-79995375 GTTGGGGGAGGGTGGGGAAGGGG - Intergenic
1099316392 12:81087748-81087770 GAGTTGGGAGGGAGAGTTAGAGG - Intronic
1099438161 12:82668317-82668339 GTGGGGGGAAGGAGGGGAGGAGG - Intergenic
1099666888 12:85642436-85642458 GGCGTGGGAAGTAGGGTAAGAGG + Intergenic
1099832929 12:87868364-87868386 GTGGGGGCAGGGAGTGTATGGGG + Intergenic
1100004016 12:89872505-89872527 ATGGTTGGAGGGTGGGCAAGAGG + Intergenic
1100065131 12:90634545-90634567 GTGGTGGGGTGGGGGGCAAGGGG + Intergenic
1100283756 12:93143984-93144006 TTTGTGGGAGGGAGGGAAATTGG + Intergenic
1100447934 12:94678511-94678533 GGGGCAGGAGGGAGGGCAAGAGG - Intergenic
1100553758 12:95672215-95672237 GCGGGGGGAGGGAGGGGAGGCGG + Intronic
1100602100 12:96120785-96120807 GGGGAGGGAGGGAGGGAGAGAGG + Intergenic
1100606733 12:96158113-96158135 GTGGGGAGAGGGAGGGGGAGGGG - Intergenic
1100788324 12:98102428-98102450 ATGGTGGGAAGGGGGGTGAGGGG + Intergenic
1101059822 12:100959204-100959226 GTGGTGGGAGGGAAGGTTGAGGG - Intronic
1101823514 12:108202470-108202492 CTGGTGGGAGGGTGAGGAAGGGG + Intronic
1101916951 12:108903248-108903270 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1102004539 12:109580893-109580915 GTGGAGGGAGGGAGGGCAGGCGG + Intronic
1102004943 12:109583243-109583265 GTGGTGGGATGGGGGGAGAGGGG - Intronic
1102024170 12:109704013-109704035 GTGCTGGGATGGAGGGGGAGGGG + Intergenic
1102037987 12:109783046-109783068 GGGGTGGGAGGGATGGTAACAGG - Intergenic
1102275741 12:111580690-111580712 GGGGAGGGAGGGAGGGAGAGAGG + Intronic
1102370848 12:112381751-112381773 GAGGAGGGAGGGAGGGAGAGCGG + Intronic
1102520868 12:113476895-113476917 GGGGAGGGAGGGAGGGAAGGAGG - Intergenic
1102599893 12:114021705-114021727 GGGGAGGGAGGGAGGGTTATGGG + Intergenic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102886413 12:116525417-116525439 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1103040348 12:117690036-117690058 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
1103158129 12:118705207-118705229 GGGGAGGGAGGGAGGGAGAGAGG - Intergenic
1103197332 12:119056109-119056131 CTTGTGGGAGGGAGGCTGAGAGG - Intronic
1103334242 12:120177341-120177363 GTGGTAGGGGGGAGGGAAGGGGG - Intronic
1103636391 12:122310111-122310133 GTGGTGGGAGGGTGGGCATAGGG - Intronic
1103949967 12:124545252-124545274 GAGGTGGGAGGCAGGGAAGGTGG - Intronic
1103956768 12:124581862-124581884 GAGGTAGGAGGGAGGGAAAGAGG + Intergenic
1104475405 12:129066846-129066868 GTGGTGGGCGTGAGGGTGGGTGG + Intergenic
1104475953 12:129070448-129070470 GTGGTGAGAGGGAGCATAAATGG + Intergenic
1104713047 12:130998186-130998208 GTGGGGAGAGGGAGGGGGAGGGG + Intronic
1105303683 13:19155228-19155250 ATGGTGGGGGGCAGGGTTAGGGG - Intergenic
1105316043 13:19264816-19264838 AGGGAGGGAGGGAGGGAAAGGGG - Intergenic
1105457132 13:20551413-20551435 GTGGTAGGAGGATGAGTAAGAGG + Intergenic
1105514203 13:21076045-21076067 GCGGGGGGAGGAAGGGTGAGAGG - Intergenic
1105676708 13:22679689-22679711 GTGGTGGGAGTGGTGGTGAGGGG - Intergenic
1105694406 13:22873584-22873606 ATGGAGGGAGGGAGGGAAAGAGG - Intergenic
1106269269 13:28138452-28138474 GTAGAAGGAGGGAGGGTAGGGGG - Intergenic
1106637714 13:31547183-31547205 GAGGAGGGAGGGATGATAAGTGG - Intergenic
1106856238 13:33856339-33856361 GTGGAGGGTGGGAGGAGAAGAGG + Intronic
1107529002 13:41263799-41263821 ATGGTGGGAGGGAGGGAGGGAGG + Intergenic
1107621203 13:42232297-42232319 CTGGTGGGAGGGCAGGGAAGGGG + Intronic
1107835821 13:44411863-44411885 GAGGGGGGAGGGAAGGGAAGGGG + Intergenic
1107943236 13:45393133-45393155 TTGGGGGGGGGGAGGGTAGGGGG + Intergenic
1108080848 13:46733384-46733406 TTGGTGGGAAGGAGGTTAATTGG + Intronic
1108229828 13:48325117-48325139 GTGGAGGGTGGGAGAGGAAGCGG - Intronic
1108418767 13:50227813-50227835 CTGGTGGGTGGGTGGGTAGGTGG + Intronic
1108731189 13:53237618-53237640 GGGGTGGGAGGCAGTGGAAGTGG + Intergenic
1109153913 13:58880399-58880421 AGGGTGGGAGGGAGGGTGTGAGG - Intergenic
1109178748 13:59187770-59187792 GTAGTGGGAGGAATGGCAAGTGG - Intergenic
1109246734 13:59963630-59963652 GTAATGGGGGGGAGGGGAAGGGG + Intronic
1109382678 13:61585009-61585031 GGAGGGGGAGGGAGGGTAACAGG + Intergenic
1109506062 13:63305452-63305474 GAGGTGGGAGGGAGGAGAAATGG - Intergenic
1109552216 13:63917995-63918017 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
1109927444 13:69163001-69163023 GAAGTGGGTGGGTGGGTAAGAGG - Intergenic
1110193611 13:72759981-72760003 GTAGTGGTAGGGAGGGGAAAGGG + Intronic
1110195068 13:72779763-72779785 GTGGTGGTGGGGGGGGTAAGGGG + Intronic
1110500764 13:76225056-76225078 GGGATGGGAGGCAGGGTTAGAGG - Intergenic
1110741600 13:79003966-79003988 GTGGTAGGTGGGACGTTAAGTGG - Intergenic
1111415653 13:87940191-87940213 GTGTTGGGAGGGCGGGTTGGGGG + Intergenic
1111850179 13:93563281-93563303 ATGGTGGGAGGGATGGGGAGTGG + Intronic
1111856184 13:93640720-93640742 GAGGAGGGAGGGAAGGAAAGTGG - Intronic
1111856193 13:93640744-93640766 GAGGAGGGAGGGAAGGAAAGTGG - Intronic
1112110011 13:96285987-96286009 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1112535342 13:100248335-100248357 GTGGAGGGAGGAATGGGAAGGGG - Intronic
1112536538 13:100262677-100262699 GGGGGGAGAGGGAGGGGAAGGGG - Intronic
1112538800 13:100285956-100285978 GTGGGGAGAGGGAGGGTGAGAGG - Intronic
1112559035 13:100495143-100495165 GTGTTGGGTGGGACGGTTAGCGG - Intronic
1113026525 13:105946725-105946747 GTGGTGGGAGGAAGGGGAGCAGG + Intergenic
1113150481 13:107257777-107257799 GTGGTGGGAGGTAGGGGATGGGG + Intronic
1113188994 13:107722100-107722122 GAGGAGGGAGGGAGAGAAAGGGG + Intronic
1113233958 13:108248407-108248429 GTGGAGGGAGGGAGGGAGGGAGG + Intergenic
1113403827 13:110019937-110019959 GTGGTTGTAGGGAGGGTGAGTGG - Intergenic
1113412819 13:110105292-110105314 GTGGTGGGAGGGACAGTGTGAGG + Intergenic
1113581799 13:111435177-111435199 GTGGTGGGTGGGTGGGTGAGTGG + Intergenic
1113600212 13:111563250-111563272 GTGAGGGGAGGGAAGGAAAGAGG - Intergenic
1113600236 13:111563325-111563347 GTGAGGGGAGGGAAGGAAAGAGG - Intergenic
1113600250 13:111563375-111563397 GTGAGGGGAGGGAGGGAAAGAGG - Intergenic
1113600276 13:111563450-111563472 GTGAGGGGAGGGAGGGAAACAGG - Intergenic
1113719651 13:112545184-112545206 TTGGTGGAAGGTAGGGTGAGGGG - Intronic
1113898086 13:113778227-113778249 GAGATGTGAGGGAGGGAAAGGGG + Intronic
1114261397 14:21039167-21039189 GTGCTGGGAGGGAGTGAAGGGGG - Intronic
1114516994 14:23306830-23306852 GAGCTGGGAGGGAGGGAGAGAGG - Exonic
1114692273 14:24595167-24595189 GTGGGGGAAGGGAGGTGAAGTGG + Intergenic
1114891410 14:26928653-26928675 GGGGTGGGTGGGAGGGGAAGTGG + Intergenic
1115421484 14:33199729-33199751 GGGGAGGAAGGGAGGGAAAGAGG - Intronic
1115671546 14:35617636-35617658 GTGGGGGGGGGGGGGGGAAGGGG + Intronic
1115829194 14:37315976-37315998 GTGGTGTCAGGGAAGGCAAGAGG + Intronic
1115915620 14:38309953-38309975 GGGGTGGGAGAGAGTGTAGGGGG - Intergenic
1116289986 14:43022383-43022405 GAGGAGGGAGGGAGGAGAAGAGG - Intergenic
1116427331 14:44807007-44807029 AGGGAGGGAGGGAGGGGAAGGGG + Intergenic
1117246279 14:53889748-53889770 ATGGTGGGAGGTAGAGGAAGTGG + Intergenic
1117531133 14:56661545-56661567 AGGGAGGGAGGGAGGGAAAGAGG + Intronic
1117578221 14:57123266-57123288 AGGGTGGGAGGGAGGGAGAGAGG + Intergenic
1117625698 14:57635367-57635389 GGGGTCGGAGGGAGACTAAGCGG + Intronic
1117764355 14:59064863-59064885 GGGGAGGGAGGGAGGGAAGGAGG + Intergenic
1118220791 14:63853192-63853214 AGAGTGGGAGGGAGGGGAAGGGG + Intronic
1118233496 14:63977001-63977023 GGGGTGGGAGGGTGGAGAAGGGG + Intronic
1118454128 14:65929691-65929713 GTGGTGGGAAGGAGGCAAAAGGG + Intergenic
1118684642 14:68279183-68279205 GTGGTGCTAGGGAGGGCAGGAGG + Intronic
1118820522 14:69342440-69342462 GGGGAGGGAGGGAGGGAAGGTGG + Intronic
1119505968 14:75173350-75173372 CTGGAGGGAGGGAGGGAGAGAGG + Intronic
1119643207 14:76329967-76329989 GGGGAGGGAGGGAGGGGAAGAGG + Intronic
1119773577 14:77235858-77235880 GTGGTGGGTGGGGGGGTATGGGG + Intronic
1120036409 14:79703635-79703657 CTGGTGGGAGGGGGGATCAGGGG - Intronic
1120036946 14:79708618-79708640 GTGGTGGGAGGGGTGGGATGTGG + Intronic
1120137085 14:80882906-80882928 GTAGTGGGAGGATGGGTAAGAGG + Intronic
1120339226 14:83197570-83197592 GTGGGTGGAGGGAGAGCAAGCGG + Intergenic
1120538075 14:85721830-85721852 GTGGTGGGAGGGGGCGGAGGGGG - Intergenic
1121159774 14:91726702-91726724 GTAATGTGAGGGAGGGGAAGGGG + Intronic
1121517953 14:94566021-94566043 GTGGTGGCAGGTAGGGTGAATGG - Intronic
1121630464 14:95418071-95418093 GTGGTGGGGGGCAGGTTCAGGGG + Intronic
1122384555 14:101334981-101335003 CTGGGGGGTGGGAGGGTCAGGGG + Intergenic
1122416215 14:101550753-101550775 CTGGTGGGTGGGTGGGTAAGTGG + Intergenic
1122422309 14:101585243-101585265 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1122447928 14:101782290-101782312 GGGGAGAGAGGGAGGGGAAGGGG - Intronic
1122447946 14:101782328-101782350 GGGGAGAGAGGGAGGGGAAGGGG - Intronic
1122447986 14:101782449-101782471 GGGGAGAGAGGGAGGGGAAGGGG - Intronic
1122448044 14:101782607-101782629 GGGGAGAGAGGGAGGGGAAGGGG - Intronic
1122448062 14:101782645-101782667 GGGGAGAGAGGGAGGGGAAGGGG - Intronic
1122448113 14:101782824-101782846 GAGGAGAGAGGGAGGGGAAGGGG - Intronic
1122653991 14:103244708-103244730 ATGGGGGGGGGGGGGGTAAGAGG + Intergenic
1122748643 14:103916791-103916813 GTGGAGGGAGGGAGGGGTGGAGG - Intronic
1122872891 14:104649309-104649331 ATGGCGGGAGGGAGGGTGGGAGG - Intergenic
1122956848 14:105075166-105075188 GGGGTGGGAGGGAGGGTCTGGGG - Intergenic
1122956868 14:105075210-105075232 GGGGTGGGAGGGAGGGTCTGGGG - Intergenic
1122956888 14:105075254-105075276 GGGGTGGGAGGGAGGGTCTGGGG - Intergenic
1122956926 14:105075340-105075362 GGGGTGGGAGGGAGGGTCTGGGG - Intergenic
1122970323 14:105149809-105149831 GTGGGGGGAGGCAGGGAAAAAGG + Intronic
1122970373 14:105149917-105149939 GTGGGGGGAGGCAGGGTTGGGGG + Intronic
1122970399 14:105149969-105149991 GTGGGGGGAGGCAGGGTTGGGGG + Intronic
1122970421 14:105150020-105150042 GTGGGGGGAGGCAGGGTTGGGGG + Intronic
1123022628 14:105408795-105408817 CTGGTGGGAGGATGGGGAAGGGG - Intronic
1123802703 15:23838160-23838182 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124055116 15:26235126-26235148 GTGGTGGGAGGGAGGCGGGGTGG - Intergenic
1124900338 15:33816829-33816851 GGGGTGAGAGGGAGGTCAAGAGG - Intronic
1124953745 15:34346323-34346345 GTGGTGGGAGAGAGGATCAGGGG + Intronic
1124956971 15:34366453-34366475 GTGGGGGCAGGGAGGCTGAGAGG - Intronic
1125183468 15:36904300-36904322 GGGGTGGGAGGAAGGGGAGGGGG - Intronic
1125720293 15:41842082-41842104 GTTATGGGAGGGACGGGAAGGGG - Intronic
1125929302 15:43589135-43589157 GGGGTAGAAGGGAGGGTAAACGG + Intronic
1125942469 15:43688967-43688989 GGGGTAGAAGGGAGGGTAAACGG + Intergenic
1126023868 15:44427521-44427543 GAGGTGGGAGGGAAGGAATGCGG - Exonic
1126551218 15:49931923-49931945 GTAGTTGGAGTGGGGGTAAGAGG + Intronic
1126672201 15:51126587-51126609 GTGGTGGGAGGGAGGGAGTGTGG + Intergenic
1126941056 15:53765979-53766001 GTGATGGGAGGAAAGGTAGGAGG - Intergenic
1127313821 15:57776460-57776482 GTGCTGGGAGGGTGGGGAGGAGG + Intronic
1127547281 15:60003306-60003328 GGGGTGGGAGGGCTGGGAAGGGG + Intergenic
1127579855 15:60328222-60328244 GAGGGGGGAGGGAGGGATAGGGG + Intergenic
1127670182 15:61187506-61187528 GTGGCGGTAGGGATGGGAAGTGG + Intronic
1127882869 15:63173683-63173705 GTGGTTGGAGTGTGGGTAATGGG - Intergenic
1128035158 15:64518295-64518317 GTGATGGGAGAGAGGGCAAAAGG + Intronic
1128114087 15:65094594-65094616 AGAGAGGGAGGGAGGGTAAGAGG + Intronic
1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG + Intronic
1128240685 15:66099173-66099195 GGGGTGGGAGGGATGGGGAGTGG - Intronic
1128252372 15:66172271-66172293 CTGGAGGGAGGCAGGGTGAGAGG - Intronic
1128756122 15:70185212-70185234 GTGGTGGGAAGGAGAGGAGGAGG + Intergenic
1129020499 15:72513696-72513718 GGGGAGGGAGGGAGGGAGAGGGG - Intronic
1129020528 15:72513754-72513776 GGGGAGGGAGGGAGGGAGAGGGG - Intronic
1129149892 15:73681962-73681984 GTGGGGGGTGGGAGGGATAGAGG + Intergenic
1129227170 15:74176728-74176750 GCTGAGGGAGGAAGGGTAAGAGG - Exonic
1129669039 15:77596984-77597006 GAGGTGGGAGGGAGGAACAGAGG - Intergenic
1129675480 15:77630888-77630910 GAGGTGGGAGGGAGGGTATAGGG - Intronic
1129835763 15:78704434-78704456 GAGGTGGTGGGGAGGGTAACAGG + Intronic
1130553856 15:84909323-84909345 AGGCTGGGAGGGAGGGAAAGTGG - Intronic
1130736030 15:86549883-86549905 GTGGAGGGAGGGAGGGAGGGAGG + Intronic
1130770086 15:86915630-86915652 GCGGTGGGGGGGAGGTGAAGAGG - Intronic
1131044052 15:89297763-89297785 GTGGGGAGAGGGAGGGGGAGGGG + Intronic
1131455562 15:92580121-92580143 GAGGTGGGAGGGACGGGGAGGGG - Intergenic
1131615450 15:94012766-94012788 ATGCTGGCAGGGAGGGGAAGAGG + Intergenic
1131726412 15:95230474-95230496 GAAGAGGGAGGGAGGGAAAGAGG + Intergenic
1132279874 15:100603078-100603100 GTGCTGGCTGGGAGGGTAGGAGG + Intronic
1132392691 15:101450489-101450511 GTGGAGGGAGGGAGGACAAAGGG - Intronic
1132396450 15:101478505-101478527 GAAGAGGGAGGGAGGGAAAGTGG - Intronic
1132435926 15:101802758-101802780 GGGGAGGGAGGGAGGGAGAGAGG - Intergenic
1132693913 16:1193780-1193802 TTGGTGGGAGGGAGGGTTCCAGG + Intronic
1132726117 16:1339060-1339082 GAGGTGGGAGCGAGGGCAGGAGG - Intronic
1133092299 16:3413912-3413934 GTGCTGGGAGGGAGGGAACGCGG + Intronic
1133377393 16:5298645-5298667 GAGGGGGGAGGGAGGGGCAGTGG - Intergenic
1133418017 16:5621522-5621544 ATGGAGGGAGGGAGGGCAGGAGG + Intergenic
1133454444 16:5930511-5930533 TAGGTGGGAGGGTGGGTATGTGG + Intergenic
1133454487 16:5930647-5930669 TAGGTGGGAGGGTGGGTAGGTGG + Intergenic
1133813798 16:9181198-9181220 GTGGTGGTGGGGAGTGTGAGAGG + Intergenic
1133945296 16:10342939-10342961 GTGATGGGAGGGAGGATAGGAGG - Intronic
1133964249 16:10519430-10519452 GGGAGGGGAGGGAGGGGAAGGGG - Intergenic
1134054416 16:11160517-11160539 GTGGTGGGCTGAAGGGAAAGAGG - Intronic
1134241111 16:12507767-12507789 GGGGAGGGAGGGAAGGTAAAGGG - Intronic
1134321977 16:13172064-13172086 GAGGAGGGAAGGAGGGAAAGGGG - Intronic
1134325435 16:13203326-13203348 GTGATGGGAGGGAAGGTAGATGG + Intronic
1134442858 16:14309664-14309686 GTAGGGGGAGGTAGGGAAAGCGG + Intergenic
1134594527 16:15485167-15485189 ATGGTGGGGGAGAGGGGAAGAGG + Intronic
1134777385 16:16864986-16865008 GTTGTGGGTGGCAGGGGAAGGGG - Intergenic
1135105372 16:19645152-19645174 GTGGGGGGCGGGAGGGTGATGGG + Intronic
1135186115 16:20317093-20317115 AGGGTGGGAGGGAGGGGAAAGGG - Intronic
1135348274 16:21707748-21707770 GGGGAGGGAGGGAGGGAAGGAGG - Intronic
1135595294 16:23737646-23737668 ATGGAGGGAGGGAGGGAGAGAGG - Intergenic
1135628986 16:24021354-24021376 GGGGAGGGAGGGAGGGAAGGAGG - Intronic
1135645964 16:24162385-24162407 TTGGTGGGGGGCAGGGGAAGGGG - Intronic
1135872796 16:26166304-26166326 GAGGAGGGAGGGAGGGAAAGAGG + Intergenic
1135927693 16:26709840-26709862 GGGGAGGGAGGGAGGGGGAGGGG + Intergenic
1135976034 16:27109501-27109523 GTGGTGGGTGGGTGGGTGAAAGG + Intergenic
1136020398 16:27436420-27436442 GTGGAGTGAGGCAGGGTGAGGGG + Intronic
1136076355 16:27820000-27820022 GTGGTGAGCGGGAGGGTCATGGG + Intronic
1136091704 16:27925386-27925408 GTGGTGGGAGGGAGGAGGGGTGG + Intronic
1136231584 16:28888760-28888782 GGGGAGGGAGGGAGGGTGTGAGG - Intronic
1136279579 16:29200185-29200207 ATGGATGGAGGGAGGGAAAGAGG - Intergenic
1136368714 16:29822242-29822264 GTGGGAGGAGGGAGGACAAGTGG + Intronic
1136532856 16:30881670-30881692 GCGGAGGGAGGGAGGGGCAGGGG - Intronic
1136549936 16:30977622-30977644 GTGGTGGGGAGGAAGGTGAGAGG + Intronic
1137589795 16:49686614-49686636 GTGGTGGGAGAGGGGGTGATTGG - Intronic
1137603313 16:49770934-49770956 CTGGTGCGAGGGAGGGAAGGTGG - Intronic
1137745690 16:50818545-50818567 GTGGTGGGCGGGAGGGATCGTGG + Intergenic
1138000977 16:53279356-53279378 GTCGTGGGGTGGGGGGTAAGGGG + Intronic
1138130211 16:54472893-54472915 CTAGTGGGAGGCAGGGGAAGTGG + Intergenic
1138174378 16:54883405-54883427 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1138186814 16:54983441-54983463 CTTGTGGGAGGGAGGGAAGGGGG - Intergenic
1138446235 16:57066013-57066035 GTGGTGGAAGGGTGGGGTAGGGG - Intronic
1138477527 16:57280939-57280961 ATGGTGGGAGGAAGGGGAGGTGG - Intronic
1138554620 16:57764256-57764278 GTGGTGGGAGGGAGGCTGGTGGG + Intronic
1138749243 16:59398817-59398839 GTGGTGGAAGAGAGGGCAGGTGG - Intergenic
1138752514 16:59440793-59440815 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
1138874140 16:60928630-60928652 GTTGTTGGAGGGAGGGAAGGAGG + Intergenic
1139231357 16:65285498-65285520 GTGGGGGGATAGAGGGTGAGGGG - Intergenic
1139308789 16:66010880-66010902 GTGGTGGGATGCTGGGTATGTGG - Intergenic
1139358327 16:66380726-66380748 GTGGTGGTAGTGATGGTAAAGGG + Intronic
1139495494 16:67314157-67314179 GAGGAGGGAGGGAGGGAGAGAGG - Intronic
1139701387 16:68710110-68710132 GGGGCGGGAAGGAGGGGAAGTGG + Intronic
1139864014 16:70050322-70050344 GTGGAGAGAGGGAGGGGGAGGGG - Intergenic
1139949202 16:70660990-70661012 ATGGAGGGAGGGAGGGAGAGAGG - Intergenic
1139949532 16:70662397-70662419 GTGGTGGCAGCGGGGGCAAGGGG - Exonic
1140063971 16:71594311-71594333 GTGGAGGGAGTGGGGGTGAGGGG - Intergenic
1140067744 16:71625562-71625584 GTGGTGGATGGGTGGGTGAGTGG + Intergenic
1140125893 16:72118755-72118777 GTGGTGGGCGGGGGGGCAGGTGG + Intronic
1140732726 16:77871229-77871251 GTGGTGGGGTGGAGGGTGGGAGG - Intronic
1140914684 16:79483129-79483151 GGGGAGGGAGGGAGGGAAGGAGG - Intergenic
1141028749 16:80570585-80570607 GTGGTGGGAGTGGGGTTGAGTGG - Intergenic
1141028762 16:80570619-80570641 GTGGTGGGGGTGAGGTTGAGCGG - Intergenic
1141218996 16:82051565-82051587 GGGGTGGGGGTGAGGGTGAGGGG + Intronic
1141266148 16:82499156-82499178 GGGGTGGGGGGGAGGGGGAGGGG - Intergenic
1141271420 16:82544481-82544503 GGGGTGAGACAGAGGGTAAGAGG - Intergenic
1141520726 16:84577125-84577147 GTTGTGGGAGGGAGGTGTAGGGG - Intronic
1141603439 16:85139668-85139690 GTGAGGGGAGGGAGAGTGAGCGG + Intergenic
1141804904 16:86336080-86336102 GTGCTGGGAGGGATGGCAAGTGG - Intergenic
1141854927 16:86674266-86674288 ATGGTGGGAGGGATGGAGAGGGG - Intergenic
1141952016 16:87345341-87345363 TGGGAGGGAGGGAGGGGAAGAGG + Intronic
1142065637 16:88060859-88060881 ATGGTGAGAGGGAGGGTGGGCGG - Intronic
1142183999 16:88685928-88685950 GTGGTGGGTGGGAGGGAAGGAGG - Intronic
1142239538 16:88938945-88938967 GGGGTGGCAGGGAGGGTGTGAGG - Intronic
1142703103 17:1676452-1676474 GTGGTGGGGGAGTGGGCAAGAGG - Intronic
1142810740 17:2394540-2394562 CTGGTGGGACGGAGGGTGACAGG - Intronic
1142912129 17:3103131-3103153 CTGATGGGAGGGAGGGTAGAGGG + Intergenic
1143125967 17:4641098-4641120 GTGGTGAGAGGGAAGGGATGGGG - Intronic
1143371123 17:6440122-6440144 GTGGCTGGAGGGAGGGAAGGAGG - Intergenic
1143402515 17:6655725-6655747 GTGGTGAGAGGGAAGGGATGGGG + Intergenic
1143478790 17:7217323-7217345 AGCGTGGGAGGGAGGGGAAGGGG + Intronic
1143502785 17:7348659-7348681 GCGTGGGCAGGGAGGGTAAGGGG + Intronic
1143566949 17:7727930-7727952 GAGCTGGGATGAAGGGTAAGTGG + Intronic
1143583197 17:7838296-7838318 GGGGAGGGAGGGAGGGGAGGAGG + Intergenic
1143622842 17:8090938-8090960 GTGGTGTAGGGGAGGGAAAGGGG + Intergenic
1143769146 17:9156953-9156975 GTGGAGGGAGGGAGGGAGGGAGG - Intronic
1143783184 17:9240075-9240097 GTGGGGGGAGGGAGGGGGCGGGG + Exonic
1143790620 17:9292362-9292384 GTGGTGGAAGGGAGAGTGACAGG + Intronic
1144035932 17:11366083-11366105 GTGGTGTGAGGGAGGGAAGCTGG + Intronic
1144670540 17:17130376-17130398 GAGGAGGGAGGGAGGGGAGGAGG - Intronic
1144709884 17:17394570-17394592 GTGGTGGGGGGTAGGCTTAGGGG - Intergenic
1144713727 17:17420211-17420233 GTGGAGGGAGAGAGGGACAGTGG + Intergenic
1144866204 17:18337559-18337581 GTGGGGAGAGGGAGGGGGAGGGG - Intronic
1144955510 17:19017059-19017081 GAGGTGGGAAGGAGGGTCAAGGG - Intronic
1145193509 17:20867705-20867727 GTGGTGGCAGGGGTGGTGAGGGG - Intronic
1145213409 17:21033451-21033473 GGGGTGGGAGGTAGTGTGAGTGG - Intronic
1145351735 17:22089977-22089999 GTGGTGGCAGGGTGGGTGGGGGG - Intergenic
1145794650 17:27648740-27648762 GAGGAGGGAGGGAGGGTGGGAGG + Intronic
1145794654 17:27648752-27648774 AGGGTGGGAGGGAGGGAGAGAGG + Intronic
1145879581 17:28343538-28343560 GGGGTGGGAGGGAGGGCGACAGG + Intronic
1146049045 17:29533828-29533850 GTGGGGAGAGGGAGGGGGAGGGG + Intronic
1146263618 17:31437237-31437259 GTGTTGGCAGGGAGAGGAAGGGG + Intronic
1146283790 17:31560940-31560962 CTGGGAGGAGGGAGGGTGAGAGG + Intergenic
1146456719 17:33014648-33014670 GTGGTGGGTGGGAGGCTGGGAGG + Intronic
1146488867 17:33265513-33265535 GTGGTGGGAGGGAGAGCATCAGG + Intronic
1146734946 17:35230761-35230783 TTGGAGGGTGGGAGGGTAGGAGG - Intergenic
1146783801 17:35700576-35700598 GTGGTGAGAGGTCGGGTAAGAGG + Intronic
1146945692 17:36871953-36871975 GGGGTGGGAGGTAGGGGATGGGG - Intergenic
1147119094 17:38325092-38325114 GAGGTGGGAGAGGGGGGAAGGGG - Intergenic
1147172434 17:38630214-38630236 GTGGGGAGAGGGAGGGGGAGGGG - Intergenic
1147402867 17:40191554-40191576 GGGGTGGGAGGCGGGGTCAGGGG - Intronic
1147443305 17:40460486-40460508 GTGGGGTCAGGGAGTGTAAGTGG + Intergenic
1147969504 17:44212019-44212041 GTGGGGGGACGGAGGGCAATGGG + Intronic
1147975934 17:44248119-44248141 GTGGGAGGAGGGACTGTAAGGGG - Intergenic
1148111774 17:45148557-45148579 GAGGAGGGAGGGAGGAAAAGAGG + Exonic
1148192284 17:45687993-45688015 GAGGTGGGAGGCTGGGTGAGAGG + Intergenic
1148255212 17:46125067-46125089 GAGGAGGGAGGGAGGGAGAGAGG + Intronic
1148324037 17:46773026-46773048 GCCCTGGGAGGGAGGCTAAGTGG - Intronic
1148478651 17:47945801-47945823 GTGCTGGTAGGGAGGGCAGGTGG + Intronic
1148582185 17:48751914-48751936 GTGGTGGGGTAGAGGGTGAGAGG + Intergenic
1148782740 17:50130575-50130597 GTTGGGGGTGGGAGGGCAAGAGG + Intergenic
1149330442 17:55575996-55576018 GTAGGGGGAGTGAGGGAAAGAGG - Intergenic
1149659912 17:58328843-58328865 TTGGTGGGTGGGAGGGGAGGAGG - Intergenic
1149749348 17:59129967-59129989 AGGGAGGAAGGGAGGGTAAGGGG + Intronic
1150021647 17:61621203-61621225 ATGGTGGCAGGGAGGGAAATGGG - Intergenic
1150295353 17:64004506-64004528 GGGGTGGGAGGTGGGGTGAGTGG - Intronic
1150327479 17:64268521-64268543 GTGGTGGCAGGAAAGGTGAGAGG + Intergenic
1150416786 17:64994789-64994811 GTGGAGGGAGAGAGGGATAGAGG + Intergenic
1150423240 17:65056781-65056803 GGGGAGGGAGGGAGGGAAGGAGG + Exonic
1150455473 17:65303697-65303719 GGGGTGGGAGGGAGGGAGGGAGG + Intergenic
1150481790 17:65516699-65516721 GTGGAGGAAGGGAGGGTAAAAGG + Intergenic
1150533759 17:66013952-66013974 GTGGTGGGAGGCAGGGCCACTGG + Intronic
1150645742 17:66976503-66976525 GAGGATGGAGGGAGGGAAAGAGG - Intronic
1150794866 17:68229092-68229114 GTGGAGGGAGAGAGGGATAGAGG - Intergenic
1151006148 17:70438268-70438290 GTGTTGGGAAGGTGGGTAAGAGG + Intergenic
1151222485 17:72623262-72623284 GTGGGGAGAGGGTGGGTGAGAGG + Intergenic
1151336767 17:73444473-73444495 GGGGTGGGAGGAAGTGTACGGGG + Intronic
1151453999 17:74215316-74215338 GTGGGGGTAGGGATGGTAAGGGG + Intronic
1151606778 17:75142588-75142610 AGGGAGGGAGGGAGGGGAAGGGG + Intronic
1151820361 17:76493667-76493689 GTGCTGAGAGGGAGGGAGAGTGG - Intronic
1151825422 17:76521299-76521321 GTGATGGAAGGAAGGGAAAGTGG + Intergenic
1151880844 17:76893594-76893616 GTGGTGGGAGTGAGGCCCAGGGG + Intronic
1152125702 17:78445252-78445274 GTTGAGGGAGGGATGGTAAGAGG + Intronic
1152314561 17:79572556-79572578 GTGGGGGGAGGGAGGGGGAAGGG + Intergenic
1152336272 17:79701456-79701478 GTGGAGGAAGGGAGGGTGACAGG + Intergenic
1152336295 17:79701516-79701538 GTGGCGGAAGGGAGGGTCACAGG + Intergenic
1152336328 17:79701606-79701628 GTGGCGGAAGGGAGGGTCACAGG + Intergenic
1152408074 17:80108618-80108640 GTGGTGGCAGGGGAGGCAAGGGG + Intergenic
1152421085 17:80193578-80193600 CGGGAGGGAGGGAGGGTGAGAGG + Intronic
1152423249 17:80205239-80205261 GAGGAGGGAGGGAGGGAAGGTGG - Intronic
1152496635 17:80677511-80677533 CTGGTGGGAGGGAAGGTGGGAGG - Intronic
1152635223 17:81428148-81428170 GGGGTGGGAGGAAGGGGCAGGGG - Intronic
1152717585 17:81907367-81907389 ATGCTGGGAGGGAGGGCAGGCGG - Intronic
1152740960 17:82018142-82018164 GAGGTGGGCTGGAGGGGAAGTGG + Intergenic
1152844829 17:82593362-82593384 AGGGAGGGAGGGAGGGAAAGAGG + Intronic
1152977092 18:231711-231733 GTAGAGGGAGGGAGGGAAATAGG - Intronic
1153189804 18:2525166-2525188 GTTGTGGGAGGGAAGGCAGGGGG + Intergenic
1153193552 18:2569478-2569500 GGGGTGGGAGGAAGGGAGAGCGG - Intronic
1153199590 18:2634738-2634760 GTGGAGGAGGGGAGGGTAATGGG + Intergenic
1153476768 18:5505934-5505956 GGTATGGTAGGGAGGGTAAGAGG - Intronic
1153605134 18:6825597-6825619 GAGGGGGGAGGTAGGGAAAGAGG - Intronic
1153647213 18:7205955-7205977 GGGGAGGGAGGGAGGGAAGGTGG - Intergenic
1153901280 18:9619047-9619069 GGGGAGGGAGGGAGGGAAGGAGG + Intergenic
1153989830 18:10386340-10386362 GTGGCGGGCGGGAGGGGAATAGG + Intergenic
1154023293 18:10684041-10684063 AGGGAGGGAGGGAGGGTAGGAGG - Intronic
1154160777 18:11979945-11979967 GTGGTGGGAGGCAGGGCAATTGG + Intergenic
1154440375 18:14383524-14383546 GTGGGGAGAGGGAGAGGAAGAGG + Intergenic
1155079161 18:22390389-22390411 GTGGAGGGAGGGAGGGCATTAGG + Intergenic
1155226216 18:23731767-23731789 GAGGAGGGAGGGAGGGGAAAGGG + Intronic
1155507350 18:26547031-26547053 GTGGTGGGAGGGATGGGTGGGGG + Intronic
1155570139 18:27184562-27184584 GAGGTGGGAGGGAAGTTAGGGGG - Intronic
1155867270 18:30981341-30981363 GTGGTGGCGGGGTGGGCAAGGGG + Intergenic
1156053669 18:32971168-32971190 GTAGTGGGGTGGGGGGTAAGGGG - Intronic
1156149225 18:34223387-34223409 GTGGGGGAAGGGATGGGAAGAGG + Exonic
1156368538 18:36451736-36451758 GAGGTGGGAGGGAGGGAAGCAGG + Intronic
1156392679 18:36665582-36665604 GGGGGGGCAGGGAGGTTAAGAGG + Intronic
1156487820 18:37477781-37477803 GTTGTGGGAGGGAGGGTGTCTGG - Intronic
1156495138 18:37520556-37520578 ATTGTGGGAGGGTGGGTAGGGGG + Intronic
1156973411 18:43185837-43185859 GTTCTGGGTAGGAGGGTAAGGGG - Intergenic
1157010456 18:43642245-43642267 GAGGAGAGAGGGAGTGTAAGAGG - Intergenic
1157403604 18:47405778-47405800 GGTGAGGCAGGGAGGGTAAGTGG + Intergenic
1157409870 18:47454595-47454617 GTGGTGGGAGGGATGGTTTTGGG + Intergenic
1157501406 18:48193495-48193517 CTGTTGGGAGGTTGGGTAAGGGG - Intronic
1157529366 18:48408918-48408940 GAGGAGGGAGGGAGGGAAGGAGG - Intronic
1157540907 18:48505814-48505836 GTGGTGGGAGGGTGGGGAAGGGG - Intergenic
1157599563 18:48885715-48885737 GTGGTGGCAGGTAAGGAAAGTGG - Intergenic
1157605613 18:48924211-48924233 GAGGCGGGAGGGAGGGTGGGTGG + Intronic
1157824259 18:50798154-50798176 CTGGTTAGAGGGAGGGTGAGAGG + Intronic
1158064805 18:53393914-53393936 GGGGAGGGAGGGAGGGAGAGAGG - Intronic
1158103848 18:53861546-53861568 GAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1158565654 18:58552202-58552224 GGGGTGGGAGGTAGGGCAGGAGG - Intronic
1158571921 18:58603536-58603558 GAGGTGGAAGGAAGGGGAAGGGG - Intronic
1158880986 18:61779622-61779644 GCGGCGGGGGGGTGGGTAAGGGG - Intergenic
1159035930 18:63277032-63277054 GCAGTGGGAGGGAGGGAAAGTGG - Intronic
1159060900 18:63512783-63512805 GTGGTGGTGGGGATGGGAAGGGG + Intergenic
1159442048 18:68493827-68493849 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1159623518 18:70667343-70667365 GAGGGGGAAGGGAGGGGAAGGGG - Intergenic
1160323464 18:77918000-77918022 GTGGTGGGTGAGAGGGTGAGGGG - Intergenic
1160330530 18:77987402-77987424 GGGGTGGGAGGCAAGGGAAGGGG + Intergenic
1160395837 18:78571993-78572015 GTGGTGGCAGGGCCCGTAAGTGG + Intergenic
1160687005 19:441577-441599 CTTGCTGGAGGGAGGGTAAGGGG + Intronic
1160710428 19:548814-548836 GTGGGGGGAGGGTGGGCAATGGG - Intronic
1160767332 19:814306-814328 GAGGTGGGAGGCAGGCTCAGGGG - Intronic
1160872226 19:1282608-1282630 GAGGAGGGAGGGAGGGGAGGAGG + Intergenic
1160872254 19:1282678-1282700 GAGGAGGGAGGGAGGGGAGGAGG + Intergenic
1160893730 19:1393181-1393203 GTGGAGGGAGGGTGGGCAGGCGG + Intronic
1160970698 19:1766562-1766584 GGAGAGGGAGGGAGGGTGAGTGG + Intronic
1161251932 19:3285308-3285330 GCTGCAGGAGGGAGGGTAAGGGG - Intronic
1161415725 19:4145431-4145453 GAGGTGGGGAGGAGGGGAAGAGG + Intergenic
1161550197 19:4908659-4908681 GTGGTGGGAGGCGGGGAGAGAGG - Intronic
1161612557 19:5251262-5251284 GAGGCGGGAGGGAGGGAAGGAGG - Intronic
1161756590 19:6138494-6138516 GGGGAGGGAGGGAGGGAAAGAGG + Intronic
1161849589 19:6731561-6731583 AGGGTGGGAGGGAGGGGAGGGGG + Intronic
1161857808 19:6775696-6775718 GACGTGTGAGGGAAGGTAAGAGG + Intronic
1161878050 19:6927184-6927206 GAGGAGGGAGGGAGGGAGAGTGG - Intronic
1161905181 19:7151233-7151255 ATGGAGGGAGGGAGGGAAAGAGG - Intronic
1162254940 19:9482646-9482668 GTGGGGAGAGGGAGGGGGAGGGG - Intronic
1162310075 19:9900996-9901018 GAGGGGGGAGGGAGGGAAGGAGG + Intronic
1162332263 19:10037645-10037667 ATGGTGGGTGGGAGGGTGACAGG - Intergenic
1162784239 19:13024194-13024216 GTTGTGGGAGGCTGGGGAAGGGG + Intronic
1162947837 19:14054512-14054534 GAGGTGGCAGGGAGGGAGAGAGG - Exonic
1163076316 19:14895017-14895039 GTGGTGGGAGGGAGAGCATTAGG + Intergenic
1163096083 19:15058117-15058139 GGGGTGGGAGGTAGTGGAAGAGG - Exonic
1163169040 19:15517975-15517997 GTGGTGGGAGACAGGGCTAGAGG + Intronic
1163402314 19:17101604-17101626 ATGGTGGGAGGAAGTTTAAGGGG - Intronic
1163630770 19:18417066-18417088 GCGGAGGGAGGGAGGGAAGGAGG - Intergenic
1163765791 19:19162630-19162652 GAGGTGGGAAGGAGGGTCTGAGG - Intronic
1163980093 19:20891196-20891218 GTGGTGAAAGAGAGGGTGAGGGG - Intergenic
1164400140 19:27896475-27896497 GTGGAGGGTGGAAGGGTAGGAGG + Intergenic
1164522245 19:28988449-28988471 GGGGAGGGAGGGAGGGAAGGAGG + Intergenic
1164839477 19:31381489-31381511 GTGCAGAGAGGGAGGGCAAGAGG - Intergenic
1164846567 19:31437831-31437853 GGGGTGGCAGGGAGGGACAGTGG - Intergenic
1165149624 19:33753351-33753373 ATGGTGGGTGGGAGGATAATAGG - Intronic
1165349659 19:35269028-35269050 GGGGAGGGAGGGAGGGGAGGGGG - Intronic
1165434332 19:35788122-35788144 GGGGTGGGCAGGAGGGGAAGAGG - Exonic
1165745571 19:38228379-38228401 GTGGGGGGAGAGAGGGAGAGAGG - Intronic
1165809783 19:38605527-38605549 GTGGAGGGCGGGAGGGTTGGGGG - Intronic
1166037620 19:40180540-40180562 GGGGTGGAAGGGAGGGGAGGTGG + Intergenic
1166090999 19:40508851-40508873 GTGGTGGGAGGAAGAGAAGGAGG + Intronic
1166561122 19:43733010-43733032 GTTGGGGCAGGGAGGGTAAGAGG + Intronic
1166697644 19:44862684-44862706 AAGGTGGGAGGGAGGGAAACAGG + Intronic
1166948052 19:46409175-46409197 GTGGAGGGAGAGAGGGAGAGGGG + Intergenic
1166948063 19:46409204-46409226 GTGGAGGGAGAGAGGGAGAGGGG + Intergenic
1167195180 19:48023409-48023431 GAGGAGGGAGGGAGGGAAGGAGG + Intronic
1167240819 19:48342153-48342175 AGGGAGGGAGGGAGGGGAAGGGG + Intronic
1167361750 19:49033898-49033920 GGGGTGGGAGGGGGGGGAGGAGG - Intronic
1167393284 19:49210913-49210935 GTCCTGGGAGGGAGGGAGAGAGG + Intronic
1167463324 19:49637761-49637783 GGGGTGGGGGGCAGGGAAAGGGG - Intronic
1168099537 19:54133917-54133939 GTGGAGAGAGGGAGGGGAGGTGG - Intergenic
1168099605 19:54134102-54134124 GTGGAGAGAGGGAGGGGAGGTGG - Intergenic
1168099656 19:54134243-54134265 GTGGAGAGAGGGAGGGAGAGGGG - Intergenic
1168099679 19:54134305-54134327 GTGGAGAGAGGGAGGGAGAGAGG - Intergenic
1168143973 19:54408728-54408750 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1168153616 19:54461631-54461653 GGAGAGGGAGGGAGGGAAAGGGG - Exonic
1168433914 19:56302707-56302729 GAGGTGGGAGGGAGGGAAGAAGG - Intronic
1168454649 19:56496814-56496836 GGGGTGGGAGGGGGCGGAAGGGG + Intergenic
1168705851 19:58469930-58469952 CGGGTGGGAGGGAGGGGAGGAGG - Intronic
1202715063 1_KI270714v1_random:37865-37887 GCGGTGGGAGGGAGGGAGGGAGG - Intergenic
925191668 2:1889715-1889737 ATGGAGGGAGGGAGGGAGAGAGG - Intronic
925418469 2:3690420-3690442 GGGGAGGGGGGGAGGGGAAGGGG - Intronic
925719524 2:6813671-6813693 GAGGAGAGAGGGAGGGAAAGAGG + Intergenic
926043232 2:9691490-9691512 ATGGTGGGAGGGAGGGAGATGGG - Intergenic
926047222 2:9718501-9718523 GAGGTCAGAGGGAGGGGAAGAGG + Intergenic
926059242 2:9794891-9794913 GTGGAGGGAGGGAGGGAGGGCGG - Intergenic
926201165 2:10799012-10799034 GTGGGGGGAGGCAGGGAAAGCGG + Intronic
926515058 2:13832985-13833007 GTGGGGGGAGGGAGAGAATGAGG + Intergenic
926705869 2:15837054-15837076 CTGGAGGGAGGGAGGGAATGGGG + Intergenic
927149109 2:20185675-20185697 GGGGTGGGGTGGCGGGTAAGAGG + Intergenic
927200842 2:20577253-20577275 GTGGGGAGAGGGTGGGAAAGGGG + Intronic
927203661 2:20593667-20593689 GTTGTGGGAGGAAGGGTCAAGGG - Intronic
927315847 2:21681040-21681062 GAGGTGGGAGGGAGGGAAGGAGG + Intergenic
927490046 2:23515282-23515304 GTTGTGGGAGTGGGGGTCAGAGG - Intronic
927877909 2:26670911-26670933 GGGGAGGGAGGGAGGGAGAGAGG + Intergenic
928070307 2:28208604-28208626 AGGGAGGGAGGGAGGGAAAGGGG - Intronic
928787353 2:34904882-34904904 GTGTTGGGCGGGAGGGTGGGTGG + Intergenic
928869045 2:35952917-35952939 TTGGTGGGGTGGAGGGCAAGGGG - Intergenic
928903984 2:36352295-36352317 GTGGTGGGGGGGTGGGGGAGGGG - Intergenic
929431738 2:41893196-41893218 GGGGAGGGAGGAAGGGGAAGGGG - Intergenic
929503879 2:42513252-42513274 GTGGTTGGAGGGAGTGTGAGGGG + Intronic
929511337 2:42568413-42568435 GGAGTGGGAGGGAGGGTGGGGGG - Intronic
929594773 2:43169291-43169313 GTGGTGGGAGGGAGGTTTCGGGG + Intergenic
929625195 2:43399523-43399545 GTTGGGGGAGGCAGGGGAAGAGG + Intronic
929773899 2:44915817-44915839 GTGGGGAGAGGGAGGGAGAGAGG + Intergenic
929817587 2:45247310-45247332 GTGCTGGGGGGGAGGGGAGGGGG - Intergenic
930133736 2:47879773-47879795 GTGGTGGTAGCTAGGGGAAGGGG - Intronic
930270564 2:49251552-49251574 AGGGAGGGAGGGAGGGGAAGAGG - Intergenic
930687672 2:54326442-54326464 GTGGTGAGAGTGAGAGCAAGAGG - Intergenic
931014775 2:57964091-57964113 GTGTTGGGGGAGAGGGGAAGGGG - Intronic
931463254 2:62466272-62466294 GGGGTGGGAGGCAGTGAAAGCGG + Intergenic
931561164 2:63562379-63562401 GTGGTGGGAGGGAGTGTACCAGG + Intronic
931901017 2:66788252-66788274 GTCGGGGGTGGTAGGGTAAGGGG - Intergenic
932216504 2:69969632-69969654 GTGGGGAGAGGATGGGTAAGCGG - Intergenic
932383991 2:71313705-71313727 GTGAGGGGAGGGAAGGGAAGGGG - Intronic
932565374 2:72903248-72903270 ATGGTGAGAGGGGGAGTAAGGGG - Intergenic
932605581 2:73163308-73163330 GTGGTGGGGGTGAGGGGAGGTGG - Intergenic
932635623 2:73385809-73385831 AGGGGGGGAGGGAGGGGAAGGGG - Exonic
932698796 2:73978979-73979001 GTGGTGGTGGGGAGGGAGAGAGG - Intergenic
932862718 2:75311390-75311412 GTGGTGGGGGGGTGGGTCAGAGG + Intergenic
933024261 2:77234884-77234906 GGATGGGGAGGGAGGGTAAGAGG - Intronic
933109491 2:78379203-78379225 GGGGAGGGAGGGAGGGAGAGGGG + Intergenic
933120911 2:78536859-78536881 AGGGTGGGAGGGAGGGAAAGAGG + Intergenic
933234480 2:79850156-79850178 ATGGAGGAAGGGAGGGTAGGAGG - Intronic
933577880 2:84090433-84090455 GTGGGGGGAGAGAGGGAGAGTGG - Intergenic
933658438 2:84907304-84907326 GTGGTGGGAGGGAGGAAGGGTGG + Intergenic
933901400 2:86852930-86852952 GGGGAGGGAGGGAGGGCAAGGGG + Intronic
933940654 2:87242110-87242132 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
934035863 2:88088117-88088139 GTGGGAGGAGGGAAGGAAAGAGG - Intronic
934618755 2:95791484-95791506 GTGGTGGGAAGGAGGGGCTGAGG + Intergenic
934642138 2:96033073-96033095 GTGGTGGGAAGGAGGGGCTGAGG - Intronic
934781286 2:96971276-96971298 GAGGTGGGAGAGAGGGAAGGAGG - Intronic
935225168 2:101046680-101046702 GTGGGGGGAGGGGAGGAAAGGGG + Intronic
935256121 2:101310995-101311017 GTGGGGGGAGGGAGAGAAAGGGG + Intergenic
935422773 2:102887028-102887050 GAGGGGGGAGGGAGGGGAGGGGG - Intergenic
935609839 2:105010822-105010844 GTGGTGGCAGGGAGGGTATCTGG - Intergenic
935692499 2:105744556-105744578 GCGGTGGGGGGCAGGGTAGGTGG - Intergenic
935759015 2:106301177-106301199 GTCGGGGGTTGGAGGGTAAGGGG + Intergenic
935779150 2:106496307-106496329 GGGGAGGGAGGGAGGGCAAGGGG - Intergenic
935845026 2:107156145-107156167 GTCGGGGGGTGGAGGGTAAGGGG + Intergenic
936006596 2:108894408-108894430 GTGGTGGGTCGGGGGGTGAGTGG - Intergenic
936007682 2:108905534-108905556 GGGGTGGGAGGAGGGGTAATGGG + Intronic
936140460 2:109935616-109935638 GTGGAGTGAGTGAGGGGAAGGGG + Intergenic
936177151 2:110233561-110233583 GTGGAGTGAGTGAGGGGAAGGGG + Intergenic
936204234 2:110435870-110435892 GTGGAGTGAGTGAGGGGAAGGGG - Intronic
936466306 2:112754366-112754388 GTGGTTGGAGTGAAGGTGAGGGG - Intronic
936807709 2:116357184-116357206 GTGGTGGGAGGGAGAGCATTAGG - Intergenic
936827901 2:116604034-116604056 GTTGTGGGATGGAGGGCTAGGGG + Intergenic
936958226 2:118044751-118044773 GTTGTGGAAGGGATGGAAAGGGG + Intergenic
936985648 2:118309510-118309532 GGCGAGGGAGGGAGGGAAAGGGG + Intergenic
936998613 2:118440819-118440841 GGGGCTGGAGAGAGGGTAAGTGG + Intergenic
937211753 2:120278168-120278190 GTTGTGGGGTAGAGGGTAAGAGG + Intronic
937250512 2:120520783-120520805 GTGGTGGGTGGAAGGGGGAGTGG + Intergenic
937340647 2:121088577-121088599 GTGGTGGAAGGGATGGGCAGGGG + Intergenic
937372450 2:121309374-121309396 AGGGAGGGAGGGGGGGTAAGAGG + Intergenic
937688471 2:124724767-124724789 TTAGTGGGAGGGAGGGTCATGGG + Intronic
937855125 2:126666690-126666712 GTGTAGGGAGGGAGGGGAGGGGG - Intronic
937949891 2:127376307-127376329 GGGGTGGGAGGGTGGGAAGGGGG + Intronic
937953713 2:127407888-127407910 AAGGAGGGAGGGAGGGCAAGCGG - Intergenic
938126829 2:128680329-128680351 GGGGAGGGAGGGAGGGAGAGAGG - Intergenic
938169577 2:129063014-129063036 GGGGTGGGTGGAAGGGTAAATGG - Intergenic
938188791 2:129255892-129255914 TTGGTGGGTGGGTGGGTGAGTGG - Intergenic
938407964 2:131043303-131043325 ATGGTGGGAGGGGGAGGAAGAGG - Intronic
938671192 2:133588398-133588420 AGGGTGGGAGGGAGGGAGAGAGG - Intergenic
938983875 2:136554051-136554073 GTGGGGGTGGGGAGAGTAAGAGG + Intergenic
939110358 2:137999395-137999417 GTGGAGGGAAGGAGGGAGAGTGG - Intronic
939185227 2:138852805-138852827 GTCATGGGAAGGAGGGCAAGAGG + Intergenic
939477111 2:142701901-142701923 GTGGGGAGAGGGAGGGGGAGAGG - Intergenic
939586775 2:144015440-144015462 GTGAGGGGAGGGTGGGTATGGGG - Intronic
939671804 2:145022174-145022196 GTGGGGGGAAGGAGAGGAAGAGG - Intergenic
939875046 2:147568287-147568309 ATGGAGGGAAGGAGGGAAAGAGG + Intergenic
940160586 2:150708346-150708368 GGGGAGGGGAGGAGGGTAAGTGG + Intergenic
941218828 2:162748870-162748892 AGGGAGGGAGGGAGGGGAAGGGG - Intronic
941569223 2:167148502-167148524 AGGGAGGGAGGGAGGGAAAGAGG + Intronic
941748986 2:169116061-169116083 GAGGGGAGAGGGAGGGGAAGTGG - Intergenic
942129182 2:172861407-172861429 GTGGTTAGAGGGAGGGAAAAGGG + Intronic
942163518 2:173217324-173217346 GCGGCGGGAGGCAGGGGAAGAGG - Intronic
942192405 2:173483183-173483205 GTGTTGGGAGGGTGGGTAGCGGG + Intergenic
942213080 2:173691275-173691297 GGGGAGGGAGGGAGGGTTAGAGG + Intergenic
942395632 2:175545498-175545520 GTAGTGGGAGGGTTGGGAAGAGG + Intergenic
942502431 2:176605718-176605740 GGGGTGGGGGGGAGGGTGGGCGG - Intergenic
942638772 2:178038271-178038293 GGGGTGGGAGGGATGGAAGGTGG - Intronic
942787559 2:179717398-179717420 GTGGAGAGAGGGAGGGAGAGAGG + Intronic
942862519 2:180632689-180632711 GTGATGGGAGGGAGGTGAATAGG + Intergenic
943278278 2:185896900-185896922 GAGGAGGGAGGGAGGGGGAGAGG + Intergenic
943434884 2:187852768-187852790 GTGTTGGGAGAGAGGGTATATGG - Intergenic
943728774 2:191280029-191280051 GTTGGGGGAGGGAGGAGAAGAGG - Intronic
944505927 2:200410640-200410662 GAGATGGGTGGGAGGGGAAGGGG - Intronic
944690172 2:202151569-202151591 GTGCTAGGAGGGAGGGTAATGGG - Intronic
944697736 2:202218002-202218024 GGGAGGGGAGGGAGGGGAAGAGG + Intronic
944890060 2:204108460-204108482 GGGGTGGGAGGGAAGATGAGTGG - Intergenic
945226025 2:207531253-207531275 GGAGTGGGACGGAGGGTGAGGGG - Intronic
945254436 2:207791892-207791914 GTGGGGGGCGGGGGGGCAAGAGG + Intergenic
945254491 2:207792274-207792296 GTGGGGGGAGGGGGGGAAGGGGG - Intergenic
946016317 2:216606839-216606861 GTGGGCGGAAGGCGGGTAAGGGG - Intergenic
946072803 2:217048798-217048820 GAGATGGGAGGGAGGGAGAGAGG + Intergenic
946165052 2:217858701-217858723 GTGGAGGGAGGGAGGGAGTGGGG - Intronic
946263864 2:218521485-218521507 GTTGGGGGATGGAGGGCAAGGGG - Intronic
946502593 2:220265524-220265546 GAGGGAGGTGGGAGGGTAAGAGG + Intergenic
946895363 2:224318595-224318617 GTGTGGGGAGGGAGGTTGAGAGG - Intergenic
947377729 2:229513876-229513898 GGAGAGGGAGGGAGGGTGAGGGG - Intronic
947614937 2:231549775-231549797 GGGGTGGGAGGGTGGGGAATGGG + Intergenic
947692840 2:232155325-232155347 GTGGTGGGAGGGTGAGGAGGAGG - Intronic
948221186 2:236270964-236270986 GGGGTGGGAGGGAAGAGAAGAGG + Intergenic
948275235 2:236703396-236703418 GGGCAGGGAGGGAGGGTGAGTGG - Intergenic
948790074 2:240372454-240372476 GATGTGGGAGGGATGGGAAGAGG + Intergenic
948889559 2:240900333-240900355 GCGGTGTGAGAGAGGGGAAGGGG + Intergenic
949033825 2:241807601-241807623 GAGGGGGGAGGGAGGGAAGGTGG - Intergenic
949033941 2:241807882-241807904 GAGGGGGGAGGGAGGGAAGGTGG - Intergenic
949060347 2:241953232-241953254 GGGGGGAGAGGGAGGGGAAGGGG + Intergenic
1168736342 20:141441-141463 GTAGAGGGAGGGAAGGGAAGAGG + Intergenic
1168849222 20:965251-965273 GGGGTGGGATGGCGGGGAAGGGG + Intronic
1168878337 20:1185805-1185827 GGGGTGGGGGGAAGGGGAAGTGG - Intronic
1168953789 20:1820144-1820166 GTGATGGGAGGGTGGGTACAAGG - Intergenic
1169159165 20:3361485-3361507 GTGGGAGGTGGGAGGGTAAGGGG + Intronic
1169505761 20:6209392-6209414 GAAGAGGGAGGGAGGGAAAGAGG - Intergenic
1169510176 20:6255490-6255512 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1169714691 20:8601940-8601962 GTGCTGCAAGGGAGGGAAAGAGG - Intronic
1169851227 20:10053707-10053729 CAGGTGGGAGGAAGGGGAAGTGG - Intronic
1170158870 20:13292838-13292860 GCAGAGGGAGGGAGGGAAAGAGG + Intronic
1170236569 20:14112221-14112243 GTGGGGGGTTGGAGGGTAAGTGG + Intronic
1170255201 20:14334657-14334679 GTGGGGGGTGGGAGGGAAGGGGG + Intronic
1170360217 20:15537774-15537796 GTTGTGAGAAGAAGGGTAAGTGG - Intronic
1170521153 20:17186756-17186778 GTGGTGGGGTGGGGGGAAAGGGG + Intergenic
1170564464 20:17589197-17589219 GTAGGGGGAGGGAGGGTTAGGGG - Intronic
1170649741 20:18228496-18228518 GGGGTGGGGGGGTGGGGAAGAGG - Intergenic
1170792706 20:19521131-19521153 GGGGAGGGAGGGAGGCAAAGAGG - Intronic
1171060336 20:21951215-21951237 GTGGTGGGAGGTTGGTTAATGGG - Intergenic
1171177949 20:23068268-23068290 GGGGTCAGAGGGAGGGTGAGTGG - Intergenic
1171333327 20:24360528-24360550 GAGGTGGGAGGGAGAGAAGGAGG + Intergenic
1171726259 20:28623899-28623921 GTGGAAGGTGGGAGGGCAAGAGG + Intergenic
1172699843 20:36846317-36846339 GTGGTGGGGCTGAGGGTCAGGGG - Intronic
1172775027 20:37402325-37402347 GTGTGGGGAGGGTGGGGAAGGGG + Intronic
1172904100 20:38356089-38356111 GTGCTGGGAGGGAGTGTGTGTGG - Intronic
1172913887 20:38429652-38429674 GTGGTGGGAGGGAGGAGGTGTGG + Intergenic
1173484008 20:43427132-43427154 ATGATGGGAGGGATGGAAAGAGG - Intergenic
1173550226 20:43927772-43927794 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1173560293 20:44000263-44000285 GTGGAGGCAGGGAGGCCAAGAGG + Intronic
1173596504 20:44262035-44262057 TAGGTGAGAGGGAGGGCAAGTGG + Intronic
1173653608 20:44683626-44683648 GAGGCAGGAGGAAGGGTAAGGGG - Intergenic
1173706873 20:45116369-45116391 GTGGAGGGAGGGAGGGGTGGAGG - Intergenic
1173756546 20:45521729-45521751 GGGTGGGGAGGGAGGGAAAGAGG - Intergenic
1173870740 20:46340518-46340540 TGGGTGGGTGGGAGGGTCAGTGG - Intergenic
1173900790 20:46587435-46587457 CTGGTGGGAAGGAAGGAAAGCGG - Intronic
1174058999 20:47819244-47819266 CTGCTGGGAGGGAGGGGCAGAGG - Intergenic
1174135307 20:48375011-48375033 ATGGAGAGAGGGAGGGGAAGGGG + Intergenic
1174198010 20:48786895-48786917 GAGGTGGAGGGGAGGGAAAGAGG + Intronic
1174350954 20:49967615-49967637 GGGGAGGCAGGGAGGGAAAGGGG - Intergenic
1174370302 20:50082367-50082389 GTGGGAGGCGGGAGGGTAAGGGG + Exonic
1174878807 20:54254441-54254463 GTGGTGGCAGAGAGGTGAAGTGG - Intergenic
1175207748 20:57324740-57324762 CTGGTGTGAGGGTAGGTAAGGGG + Intergenic
1175221189 20:57417427-57417449 ATGGAGGGAGGGAGGGTGAATGG + Intergenic
1175221215 20:57417548-57417570 ATGGAGGGAGGGAGGGTGATTGG + Intergenic
1175224938 20:57439359-57439381 GGGGTGGGAGGGTGGGGGAGTGG - Intergenic
1175332442 20:58174904-58174926 GTGGAGGGAGTGAGGGTATGGGG - Intergenic
1175717161 20:61262833-61262855 AGGGAGGGAGGGAGGGGAAGGGG - Intronic
1175834507 20:61984952-61984974 GGGGTGGGAGGGGGCGGAAGGGG + Intronic
1175853260 20:62104916-62104938 GAGGTGGGAGGCAGGGGAGGTGG + Intergenic
1176162195 20:63653547-63653569 GAGGAGGGAGGGAGGGTTGGGGG + Intergenic
1176286556 21:5021995-5022017 ATGGAAGGAGGGAGGGAAAGTGG - Intergenic
1176846887 21:13883821-13883843 GTGGGGGGAGGGGTGGTAGGGGG - Intergenic
1176856920 21:13981190-13981212 GTGGGGGGGGGGCGGGAAAGGGG - Intergenic
1176892294 21:14332497-14332519 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1176972223 21:15280080-15280102 GTTGTGGGCTGGAAGGTAAGGGG - Intergenic
1177149037 21:17436213-17436235 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1177457197 21:21355523-21355545 GAGGAGGGAGGGAGGGAGAGAGG + Intronic
1177516126 21:22153735-22153757 ATGATGGGAGGGAAGGGAAGGGG + Intergenic
1177948266 21:27500569-27500591 GTGGTGGCAGGGTGGGGAGGGGG + Intergenic
1178030142 21:28516673-28516695 GAGTTGGAGGGGAGGGTAAGAGG + Intergenic
1178271994 21:31199385-31199407 ATGGTGGGGGGGAGGGAAAAAGG - Intronic
1178319869 21:31597218-31597240 AAGGAGGGAGGGAGGGGAAGGGG - Intergenic
1178339655 21:31775197-31775219 GTGAGGGGAGGGGGGGTTAGAGG - Intergenic
1178533277 21:33392680-33392702 GTGTTGGGAGGGGGGGTTGGGGG + Intergenic
1178708689 21:34895437-34895459 CTGGTGGGAGGGAATATAAGAGG + Intronic
1178924335 21:36762365-36762387 GTGGGTGGAGGGAGGGTGCGGGG + Intronic
1179376927 21:40857855-40857877 GGAATGGGAGGGATGGTAAGTGG + Intergenic
1179487010 21:41716932-41716954 GGGGCGGGAGGGAGGATTAGGGG - Intergenic
1179870625 21:44241480-44241502 ATGGAAGGAGGGAGGGAAAGTGG + Intergenic
1179962043 21:44773045-44773067 GAGGTAGGAGGGAGGGAATGGGG - Intronic
1180086062 21:45508424-45508446 GTGGATGGATGGTGGGTAAGTGG + Intronic
1180086082 21:45508491-45508513 GTGGATGGATGGTGGGTAAGTGG + Intronic
1180175354 21:46084475-46084497 GTGGTGCCGGGGAGGGTCAGGGG + Intergenic
1181377284 22:22469536-22469558 AGGGTGGGAAGGAGGGAAAGTGG + Intergenic
1181973879 22:26714454-26714476 GTGGTGGGAGAAAGGGGCAGAGG + Intergenic
1182050698 22:27310593-27310615 GAGGGGGGAGGGAGGGAAGGAGG + Intergenic
1182050708 22:27310612-27310634 GAGGGGGGAGGGAGGGAAGGAGG + Intergenic
1182253197 22:29018303-29018325 GTGGAGAGAGGAAGGGGAAGGGG + Intronic
1182422423 22:30254870-30254892 GTGGAGGGGAGGAGGCTAAGTGG + Intergenic
1182668131 22:31973630-31973652 GGGGAGGGAGGGAGGGGAATTGG + Intergenic
1183472904 22:38019036-38019058 GTGGAGGGAGGGGGTGGAAGAGG + Intronic
1183483657 22:38078060-38078082 GTGGTGGGAGGGAGTCTGGGAGG - Intergenic
1183616330 22:38948049-38948071 GAAGTGGGGGTGAGGGTAAGAGG + Intergenic
1183672107 22:39279005-39279027 GTGTTGGGGGGGATGGTCAGGGG + Intergenic
1183705683 22:39473806-39473828 GTGGGGGGATGGAAGTTAAGGGG + Intronic
1183723929 22:39578116-39578138 GAGGTGGGAGGGCGGGAAGGTGG + Intronic
1183729962 22:39612845-39612867 GTGGAGGGATGGAGGGAAGGAGG - Intronic
1183891042 22:40928985-40929007 GAGGTGGGAAGGTGGGTATGGGG - Exonic
1184161915 22:42702065-42702087 GTGGCAGGAGGGAGAGAAAGAGG - Intronic
1184174175 22:42777348-42777370 GCGGTGCCAGGGAGGGGAAGAGG + Intergenic
1184230631 22:43156535-43156557 GGGGTGGGAGGGAGGGGGAGGGG + Intronic
1184412908 22:44336281-44336303 GCGGAGGGAGGGAGGATGAGGGG - Intergenic
1184418709 22:44366921-44366943 GTTGGGGGAGGTAGGGGAAGCGG - Intergenic
1184420774 22:44381760-44381782 GTGTGGGGAGGAAGGGGAAGGGG + Intergenic
1184421198 22:44383860-44383882 CTGGAGGGAGGGAGGGAGAGAGG + Intergenic
1184525645 22:45020851-45020873 GTAGGGGGAGTGAGGGAAAGGGG + Intergenic
1184525664 22:45020906-45020928 GTGGGGGGAGTGAGGGAGAGGGG + Intergenic
1184525695 22:45020986-45021008 GTGGGGGGAGTGAGGGAGAGGGG + Intergenic
1184581856 22:45423300-45423322 GTGGGGGGAGGGAGAGGCAGGGG - Intronic
1184596383 22:45516647-45516669 GAGGTGGGAGGGGGGCTGAGTGG + Intronic
1184598199 22:45526823-45526845 GTGTTGGGTGGGAGGGTGCGGGG - Intronic
1184627526 22:45748244-45748266 GGACTGGTAGGGAGGGTAAGAGG - Intronic
1184661548 22:45967703-45967725 GTGGTGGGTGGGAGGGGAAGGGG + Intronic
1184671468 22:46014109-46014131 GCGGTGGGAGGGAGGGAAGGTGG - Intergenic
1185110235 22:48896475-48896497 GTGATGGGGTGGAGGGCAAGGGG + Intergenic
1185391011 22:50561928-50561950 GTGGCAGGTGTGAGGGTAAGAGG + Intronic
949111712 3:269433-269455 GAGATGGTAGGGAGGGTCAGTGG + Intronic
949772611 3:7595594-7595616 ATGGTGGGAAGGAGAGTGAGAGG + Intronic
950271031 3:11615217-11615239 TTGGTGGCAGGGAGGGTTGGGGG + Intronic
950307462 3:11927564-11927586 GTGGTGGGAGAGAGGGATATGGG + Intergenic
950484394 3:13264535-13264557 CTGGAGGGAGGGAGGGGAGGAGG - Intergenic
950545518 3:13635911-13635933 GGGGTGGGATGGAGGGTGATGGG + Intronic
950609209 3:14114485-14114507 GTGGTGAGATGTAGGGGAAGGGG - Intronic
950728023 3:14931517-14931539 GTGGTGGGAGGAAGAAGAAGGGG - Intronic
951615072 3:24533283-24533305 GTGGCAGGAGAGAGGGAAAGGGG - Intergenic
951742789 3:25942785-25942807 CTGGTGGGAGGGAGGTAAACTGG - Intergenic
951827845 3:26888053-26888075 CTGGAGGGTGGGGGGGTAAGGGG + Intergenic
951959476 3:28300702-28300724 GAGGAAGGAGGGAGGGTGAGAGG - Intronic
952991649 3:38835958-38835980 GAGGTGGGAGTGTGGGTAAATGG + Intergenic
953373615 3:42410382-42410404 ATGGTGGGCAGGAGGGTAACGGG - Intronic
953966358 3:47309977-47309999 GTGGGGAGAGGGAGGGGGAGGGG + Intronic
954127278 3:48538988-48539010 GGGGTGGAAGGGTGGGTGAGGGG - Intronic
954202495 3:49032381-49032403 GTCGGGGGAGGGAAGGTATGAGG + Intronic
954388358 3:50256163-50256185 ATGGGGGGTGGGAGGGTCAGTGG - Intronic
954389263 3:50260323-50260345 GGGGAGGGAGGGAGGGTTGGAGG + Intergenic
954410064 3:50366661-50366683 GTGATGGGAGGGAGGAAAACTGG - Intronic
954698363 3:52439402-52439424 GTGCTGGGAGGGATGGTCAAGGG - Intronic
954711135 3:52505640-52505662 GTGGTGCAAGGGAGGCTCAGGGG - Intronic
954859601 3:53676272-53676294 GTGGTGGTTGGGAGGGCGAGGGG - Intronic
955107350 3:55911022-55911044 GCGCAGGGAGGGAGGGAAAGGGG - Intronic
955180055 3:56659366-56659388 GTGGTTGGAGAGAAGGGAAGTGG - Intronic
955425373 3:58783995-58784017 GTGGTGGAAGGGAGGGAAGGAGG - Intronic
955450139 3:59057611-59057633 ATGGTGGTAGGCAGTGTAAGTGG - Intergenic
955675533 3:61444352-61444374 GTGGAGGGAGGGAGGGAGGGAGG - Intergenic
956139108 3:66127859-66127881 GAGGAGGGAGGGAAGGGAAGGGG - Intergenic
956159669 3:66335891-66335913 GTGGTGGTGGGGAGGGAAGGAGG + Intronic
956550924 3:70458652-70458674 AGGGTGGGAAGGAGGGTTAGTGG + Intergenic
956609931 3:71112109-71112131 GTGGTGGGTGGGGGGGTGGGGGG + Intronic
956682499 3:71794272-71794294 GAGGTGAGAGGGAGGGAAACAGG - Intergenic
957078773 3:75620301-75620323 GGGGAGGGAGGGAGGGGGAGCGG - Intergenic
957146613 3:76432918-76432940 GAGGAGGGAGGGAGGGAAGGAGG + Intronic
958005232 3:87802075-87802097 GAGGAGGGAGGGAGGGAAGGAGG - Intergenic
958049169 3:88322278-88322300 GTGGAGGGAGAGAGAGAAAGTGG - Intergenic
958431182 3:94043576-94043598 GGGGAGGGAGAGAGGGGAAGAGG - Intronic
958484202 3:94682530-94682552 GTGGTGGGAGAGAGAGTAGTAGG + Intergenic
958598312 3:96259868-96259890 GTGGATGGAGGGAGAGTCAGGGG - Intergenic
958769803 3:98412562-98412584 GTTGTGGGATGGAGGGAAGGGGG + Intergenic
958890872 3:99781303-99781325 GTGGTGGGTGAGGGGGTAGGAGG + Intronic
959017630 3:101153584-101153606 GTGCTGGAAGGGATGGTATGTGG - Intergenic
959142000 3:102496847-102496869 GTGGAGGGTGGGAGGGTGGGAGG + Intergenic
959229572 3:103631291-103631313 GTGGTGGCAGGAAGGAGAAGGGG - Intergenic
959386442 3:105714281-105714303 ACGGTGGCAGGGAGGGGAAGGGG + Intronic
959407969 3:105984777-105984799 TTGGGTGGAGGGAGGGTAAAAGG - Intergenic
960054073 3:113264297-113264319 GCGAGGGGAGGGAAGGTAAGAGG + Intronic
960248910 3:115430739-115430761 GTTGGGGGATGGAGGGCAAGGGG + Intergenic
960306000 3:116061457-116061479 GTGGTGAGAGGCATGGTAGGTGG + Intronic
960384617 3:117007155-117007177 GTGGAGGGAGGGAGGGCATCAGG - Intronic
960846222 3:122006639-122006661 GTGGTGGGGGTGAGGGGAGGCGG + Intronic
960923052 3:122767842-122767864 GTGGTGGCAGAGAGGAGAAGGGG + Intronic
960923665 3:122774637-122774659 GTGTGGGAAGGGAGGGCAAGGGG + Intronic
961380204 3:126492083-126492105 GTGGTGGGAAGGAGGGCCTGGGG - Intronic
961384560 3:126516440-126516462 GTGATGAGGGGGAGGGTAGGTGG - Intronic
961384583 3:126516503-126516525 CTGGGGGGTGGGAGGGTAGGTGG - Intronic
961640327 3:128360891-128360913 GGGGTGGGAGGGATGGAAGGTGG - Intronic
961812624 3:129530710-129530732 GTGCTGGGAGGAGGGGGAAGGGG - Intronic
961914828 3:130363447-130363469 GTGGTGGAAGAGAGGATGAGAGG - Intronic
961931080 3:130533347-130533369 GTAGAGGGTTGGAGGGTAAGTGG - Intergenic
962256151 3:133871608-133871630 GTGGAGGGAGGCAGTGTCAGTGG - Intronic
962334862 3:134519014-134519036 GTGGTGGGGGGGTGGGTACATGG - Intronic
962340065 3:134575194-134575216 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
962679039 3:137779996-137780018 GTGGTGGGATGAAGGGGAAATGG + Intergenic
962711678 3:138091630-138091652 GTGGGGGGAGGGAGGGAGGGAGG + Intronic
962751208 3:138435673-138435695 GCGGAGGGAGGGAGGGAAGGAGG - Intronic
963009293 3:140754263-140754285 GGGGTAGGAAGGAGGGCAAGTGG + Intergenic
963110213 3:141682331-141682353 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
963320748 3:143806730-143806752 GTGGTGGTGGGGGGGGCAAGTGG + Intronic
963599077 3:147361484-147361506 GTGGAGGGAGGAAGGAAAAGCGG - Intergenic
963603753 3:147397400-147397422 GTGGGGTGAGGGAGGGAAAGAGG - Intronic
964753608 3:160074810-160074832 GTAGTGGGAGGCAGGGTGGGCGG + Intergenic
965026881 3:163313617-163313639 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
965186901 3:165476518-165476540 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
965186953 3:165476684-165476706 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
965202506 3:165677477-165677499 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
966868516 3:184275946-184275968 GTGGGGGGAGGGTGGGGGAGAGG - Intronic
966884505 3:184369059-184369081 GACCTGGGAGGGAGGGTAAGTGG + Intronic
967013377 3:185459865-185459887 GTGGTGGGGAGGAGGGAATGGGG - Intronic
967033636 3:185631459-185631481 GGGGAGGGAGGGAGGGGGAGGGG - Exonic
967863103 3:194168044-194168066 GTGTTGGGAGGAAGGGGAAGAGG + Intergenic
968058672 3:195712221-195712243 GGTGTGGGAGGGAAGGTGAGAGG - Intergenic
968087146 3:195878901-195878923 GTGGTGGGAGGCACGGGAAGTGG + Intronic
968123126 3:196140408-196140430 GTGGGGGGCGGGGGAGTAAGTGG - Intergenic
968339318 3:197941478-197941500 AGGGAGGGAGGGAGGGGAAGGGG - Intronic
968910724 4:3475845-3475867 GTGGTGGGAGGGGAGGGAGGTGG + Intronic
968940090 4:3633286-3633308 AAGGAGGGAGGGAGGGGAAGGGG - Intergenic
968949757 4:3684364-3684386 GTGGTGGGATGGAGGGTAGGGGG - Intergenic
969121504 4:4914708-4914730 GTGGTGGGAGAGAAGGAGAGAGG - Intergenic
969166669 4:5322022-5322044 GTGGTGGGAGTGGGGGTGGGGGG + Intronic
969198021 4:5578651-5578673 GTGGATGGAGGGAGGGAAAAGGG + Intronic
969335917 4:6510219-6510241 GTGGTGGGAGGTGGTGAAAGGGG - Intronic
969392678 4:6901731-6901753 GTGGTGGGAGGGGACGTAAAGGG - Intergenic
969411597 4:7031992-7032014 GTGCTGGGAAGGAGGGCACGGGG - Exonic
969481596 4:7449374-7449396 GTGCTGGGAGGGAGGGAGGGAGG - Intronic
969573277 4:8022547-8022569 GTGCTGGGAGGGAGGGACCGAGG - Intronic
969607812 4:8211234-8211256 GTGGGGAGAGGGAGGGAGAGGGG - Intronic
970196591 4:13557028-13557050 TTGGTGGGAGCGAGGGTGGGAGG + Intergenic
970506546 4:16736091-16736113 GAGGTGGGAAGGAGTGTAGGAGG - Intronic
970559588 4:17269553-17269575 TTGGTGGAAGGAAGGGAAAGGGG - Intergenic
970641316 4:18069476-18069498 GTGGAGGGAGGTAGGGGAGGTGG - Intergenic
971059881 4:22955597-22955619 CTGATGGGAGGGTGGGAAAGTGG + Intergenic
971111672 4:23592358-23592380 GGGGAGGGAGGGAGGGGGAGGGG - Intergenic
971248209 4:24949429-24949451 GTGGTGGCAGGGAGGGGGGGTGG + Intronic
971886373 4:32454637-32454659 GTGGAGAGAGAGAGGGCAAGAGG - Intergenic
972351945 4:38244236-38244258 GTGGAGGAAGGGAGGGCAGGAGG - Intergenic
972643665 4:40947859-40947881 GAGATGGGAGGGAGGGAGAGAGG + Intronic
972645334 4:40962721-40962743 GTGGGGGAAGGGAGGGAAGGAGG + Intronic
972731419 4:41798808-41798830 GTGGTGATAGGAAGGGTGAGGGG - Intergenic
972971622 4:44583200-44583222 GTGGGGGGAGGGGGGGTTGGTGG - Intergenic
973138342 4:46734235-46734257 GTGGTGGGAGGCAGGTTTGGAGG + Intergenic
973256086 4:48115195-48115217 GTTGTGGGGTGGAGGGCAAGGGG - Intronic
973597662 4:52509011-52509033 GTAGTGGGAGGGAGGGGTAGAGG + Intergenic
973807898 4:54543085-54543107 GGGGTGGGTGGGAGGATGAGAGG + Intergenic
973835605 4:54806337-54806359 GGGGAGGGAGGGAGGGAAAAGGG + Intergenic
973869593 4:55152285-55152307 GTGGTGGGATGGGAGGGAAGAGG - Intergenic
974333548 4:60510383-60510405 AGGGTGGGAGGGAGGGAAGGAGG + Intergenic
974891554 4:67890271-67890293 GTGGTGGCAGTGAGGATGAGAGG - Intergenic
975848197 4:78547322-78547344 GTGGGGAGAGGGAGGGGGAGGGG - Intergenic
975894003 4:79064266-79064288 GGGGTGGAAGTGAGGGCAAGAGG - Intergenic
976029419 4:80733599-80733621 GTAGTGGGAGGCAGGGAATGGGG - Intronic
976426828 4:84913837-84913859 GAGGTGGAAGGGAAGGGAAGGGG - Intronic
976703816 4:88000968-88000990 GAGGAGGGAGGGAGGGAAAGGGG + Intergenic
977271794 4:94926042-94926064 TGGGGGGGAGGGAGGGTAGGAGG - Intronic
977407556 4:96619351-96619373 GTGGAGGAAGGGAGGGATAGTGG - Intergenic
978058960 4:104312084-104312106 GTGATGGGATGGGGAGTAAGGGG + Intergenic
978692404 4:111529669-111529691 GTGGTGGGAGGGAAGTGAGGGGG + Intergenic
978720892 4:111907818-111907840 GTGGTGGGAGTGATGGTTTGAGG - Intergenic
978899604 4:113931021-113931043 GTGGTGGGGTGGGGGGAAAGGGG + Intronic
979267200 4:118717443-118717465 GAGGTGGGAGGGAGGGAGTGGGG - Intergenic
979367252 4:119840313-119840335 GGGGTGGGAGGGCGGGGATGGGG - Intergenic
979807585 4:124993965-124993987 GTTGTGAGAGAGAGGGTGAGAGG - Intergenic
980107236 4:128599637-128599659 GAGGTGGGAGGATTGGTAAGGGG - Intergenic
980475069 4:133303613-133303635 GATGTGGTAGGGTGGGTAAGAGG - Intergenic
980499988 4:133637235-133637257 GTGGTTGCAGGGAGGGGAAGGGG + Intergenic
980509494 4:133766709-133766731 AGAGTGGGAGGGAGGGAAAGAGG + Intergenic
980941394 4:139278917-139278939 GTGGTGGGAGGGAAGGACGGAGG - Intronic
981012936 4:139944324-139944346 GTGGTGGGATGGGGGGAAGGGGG - Intronic
981226004 4:142294946-142294968 GTGGTGTGGGGAAGGGAAAGAGG + Intronic
981264374 4:142764702-142764724 GAGGTGGGAGGGTGGGGTAGAGG - Intronic
981546873 4:145902773-145902795 GTGGTGGGAAGGCGGGGAAAAGG + Exonic
981671356 4:147290846-147290868 GGGATGGGAGTGAGAGTAAGAGG + Intergenic
981674237 4:147322821-147322843 CAGGAGGGAGGGAGGGAAAGAGG + Intergenic
981851374 4:149234247-149234269 GTCGTGGGGTGGGGGGTAAGGGG - Intergenic
982087225 4:151848192-151848214 TTGGGGAGAGGGAGGGAAAGGGG - Intergenic
982233307 4:153229017-153229039 GAGGTGGGAGTGAGGGTACGTGG + Intronic
982334577 4:154219921-154219943 GTGGGAGGAGGGAGGGAAGGAGG - Intergenic
982435909 4:155383432-155383454 GTGGTGGGAGGCGGGGGGAGGGG - Intergenic
982480841 4:155908196-155908218 GTGGTGGGAGGAAGAAAAAGAGG + Intronic
982510327 4:156274729-156274751 GGGGTGGGATGGAGGGGATGGGG + Intergenic
982575293 4:157101812-157101834 TTGGTGGGGGGGAGGGTTTGGGG + Intronic
982775695 4:159439336-159439358 GTTGGGGGACGGGGGGTAAGCGG - Intergenic
983144464 4:164196802-164196824 GTGGAGGGAGGGAGGGCAGGAGG - Intronic
983213466 4:164980776-164980798 TTGGGGGGTGGGAGGGCAAGGGG + Intergenic
983254245 4:165379671-165379693 GTGGAGGGAGGGATGGAAATGGG + Intronic
983263473 4:165482810-165482832 GTGGTGTCAGGGAGGGGAAGTGG + Intronic
983343672 4:166500036-166500058 GAGATGGGAGGGAGGGAAATTGG - Intergenic
983462534 4:168046481-168046503 GTGGGGGTAGGGAGGGAGAGAGG - Intergenic
983589098 4:169388227-169388249 GTTGCGGGGGGGAGGGCAAGGGG - Intergenic
983593841 4:169443347-169443369 GTGGTGGGTGGGGGGGTTTGGGG - Intronic
983597665 4:169489269-169489291 GCGGAGGGAGGGAGGGAAGGAGG + Intronic
983693400 4:170499775-170499797 CTGGTGGTAGGGAGTGGAAGTGG + Intergenic
983872899 4:172842715-172842737 GGGGAAGGAGGGAGAGTAAGAGG + Intronic
984743926 4:183195377-183195399 GTGTTGAGAAGGAGGCTAAGAGG - Intronic
984793996 4:183641684-183641706 GTGGTGTGTGGGTGGGTGAGCGG + Intronic
985300935 4:188488677-188488699 GTGGAGGGAGGGAGGGAGGGAGG - Intergenic
985434268 4:189913802-189913824 GTGGAAGGTGGGAGGGCAAGAGG - Intergenic
985578719 5:685590-685612 GAGGGCGGAGGGAGGGTGAGTGG - Intronic
985707041 5:1407412-1407434 CTGGTGGGAGGCAGGGTCTGGGG - Intronic
987068104 5:14309064-14309086 TGGGTGGGTGGGTGGGTAAGTGG - Intronic
987132240 5:14871176-14871198 GGGGAGGGAGGGAGGGAATGGGG + Intronic
987415369 5:17656029-17656051 CTTGTGGGAGGGATGGTAGGTGG + Intergenic
987416868 5:17671093-17671115 GAGGTGGGAGGCAGGGCAAGGGG + Intergenic
987447131 5:18034067-18034089 GTGGTGGGAGAGAGGAAATGTGG - Intergenic
987690883 5:21265335-21265357 GTGGTAGGTGGCAGGGTGAGAGG + Intergenic
988024928 5:25673389-25673411 GTGAGGGGTGGAAGGGTAAGGGG + Intergenic
988209473 5:28184673-28184695 GTGGTGGGATGGGGGGAAGGGGG - Intergenic
988766194 5:34380497-34380519 GAGGTGGGGGGGGGGGCAAGTGG + Intergenic
988989050 5:36651527-36651549 GGGGTGGGAGGGTGGGGAGGAGG - Intronic
989077191 5:37576106-37576128 GCGGAGGGAGGGAGGGAAGGAGG - Intronic
990446189 5:55896589-55896611 GTGGGGGAAGGGAGGGGAGGGGG - Intronic
990543422 5:56797607-56797629 GAGGAGGGAGGGAGGGAAGGAGG + Intergenic
990589656 5:57249775-57249797 GAGGGGGGAAGGAGGGGAAGGGG - Intronic
990731267 5:58811781-58811803 GTGGAGGGAGGGTGGGTCTGGGG - Intronic
990773044 5:59271892-59271914 ATGGTAGGAGTGAAGGTAAGGGG - Intronic
990855296 5:60260108-60260130 GTGGTGGTTGGGAGGGGATGGGG - Intronic
991975078 5:72177368-72177390 GTGGTGGGATGGAGGGGCACAGG + Intronic
992029312 5:72705213-72705235 GGGTGGGGAGGGAGGGTAAAGGG + Intergenic
992033835 5:72751626-72751648 GAGGAGGGAGGGAAGGAAAGAGG + Intergenic
992077397 5:73204013-73204035 GTAGTGGGGGCGAGGGGAAGCGG - Intergenic
992589328 5:78277355-78277377 TTGGTGGGAGGGAGTTTAAGGGG + Intronic
992757901 5:79926205-79926227 GTGGTGGGTGTGAGGGGCAGAGG + Intergenic
993479173 5:88401598-88401620 GTGGTGGGTGGGTGGGTTGGGGG + Intergenic
994133805 5:96262285-96262307 GGGTTGGGAGGGAGGAGAAGGGG + Intergenic
994738605 5:103590125-103590147 GTGGATGGATGGTGGGTAAGGGG + Intergenic
994745122 5:103668488-103668510 GGGGTTGGAGGGTGGGTGAGTGG - Intergenic
994913693 5:105945659-105945681 TGGGAGGGAGGGAGGGAAAGAGG + Intergenic
995193116 5:109340659-109340681 GTGGGGAGAGGGAGGGGGAGGGG - Intronic
995421926 5:111977535-111977557 GTGATGGGAGGTAGGGAAAAAGG - Intronic
995735405 5:115295715-115295737 GGGGTGCGAGGGAGGGTGAGGGG + Intronic
996184128 5:120455948-120455970 GTGGAAGGATGGAGGGTGAGAGG + Intergenic
996229996 5:121051428-121051450 GAGGTGGGAAGGAGGGTCAAGGG - Intergenic
996595077 5:125191447-125191469 GAGGAGGGAGGGAGGGTGGGAGG - Intergenic
996677997 5:126198581-126198603 AAGGTGGGAGTGAGGGCAAGGGG + Intergenic
996697568 5:126415521-126415543 AGGGTGGGAAGGAGGGAAAGAGG + Intronic
996781313 5:127189705-127189727 GGGGAGGGAGGGAGGGAAGGAGG - Intergenic
996961272 5:129253351-129253373 GTGGTGGGAAGGAGAGTGTGAGG - Intergenic
997240517 5:132303427-132303449 GTGCTGGGAGGAAGGGGAAGGGG - Intronic
997418848 5:133750439-133750461 GTGATGGGAGGGAGGGAAGCTGG - Intergenic
997679905 5:135742964-135742986 GGGGGGGGAGGGAGGGGAGGGGG - Intergenic
997690288 5:135823492-135823514 AGGGTGGGAGGGAAGGAAAGAGG - Intergenic
997790538 5:136755836-136755858 GGGCTGGGAGGGAGGGAATGAGG - Intergenic
998139814 5:139693370-139693392 CTGGTGGGAGGGAGGGGTGGTGG + Intergenic
998383382 5:141741738-141741760 GAGGTGGGAGGGAGGGAGGGTGG + Intergenic
998757929 5:145400993-145401015 GTGGTGGGAGGGAGGCTGTCTGG - Intergenic
999152924 5:149438451-149438473 GTGGTGGGATGGAGGCGGAGTGG + Intergenic
999343742 5:150796425-150796447 CTGGTGGGAGGGAGTGAAGGGGG - Exonic
999451103 5:151678875-151678897 GAGATGGGAGGGAAGGGAAGCGG + Intronic
999455825 5:151714858-151714880 GTGGGGAGAGGGAGGGGGAGGGG + Intergenic
999492317 5:152063462-152063484 GTGGTGGTAGGGAGAGTAATGGG + Intergenic
999501296 5:152149115-152149137 GTGGTGGGAAGAAGGGGAAGAGG - Intergenic
999510864 5:152250463-152250485 GTGGTGGGAGGGAGAGCATCAGG - Intergenic
999982872 5:156974860-156974882 GTGGGGGGAGGGAGGGAGGGAGG + Intergenic
1000115371 5:158148928-158148950 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
1001108485 5:168875747-168875769 GAGGGGGAAGGGAGGATAAGAGG + Intronic
1001541065 5:172539810-172539832 GTGATGGGATGGAGGCTCAGAGG + Intergenic
1001647024 5:173289740-173289762 AGGGTGGGAGGGAGGGAGAGAGG - Intergenic
1001733216 5:173975479-173975501 AGGGTGGGAGTGAGGGTGAGGGG - Intronic
1001740433 5:174048706-174048728 GAGGTGGGTGGGAGAGTAAGGGG - Intronic
1001824395 5:174733729-174733751 GGGGTGGGAGAGCGGGTAAAGGG - Intergenic
1001996966 5:176169763-176169785 GGGGAGGGAGGGAGAGAAAGAGG + Intergenic
1002061789 5:176629789-176629811 GGGGTGGGATGGGGGGAAAGCGG - Exonic
1002067609 5:176660005-176660027 TAGGTGGGAGGGTGGGTGAGTGG - Intergenic
1002184347 5:177447250-177447272 GAGGGGGGAGGGAGGGGGAGGGG - Intronic
1002297291 5:178238797-178238819 GTGGGGGGAGGGAAGATAGGAGG - Intronic
1002330530 5:178437508-178437530 GTGGTGGGGAGGAGGGTAGAAGG + Intronic
1002473939 5:179453386-179453408 GTGATGGGTGGGAGGGTGGGAGG - Intergenic
1002937734 6:1687818-1687840 GTGGTTGGAGAGAGGGCATGGGG + Intronic
1002940105 6:1708364-1708386 GTGGAGGGAAGGCGGGTAGGGGG + Intronic
1003136020 6:3435328-3435350 ATGGTGGAAGAGAGGGGAAGTGG - Intronic
1003318931 6:5035599-5035621 GGGGAGGGAGGGAGGGGAGGAGG - Intergenic
1003318984 6:5035704-5035726 GGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1003318999 6:5035735-5035757 GGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1003336784 6:5180931-5180953 GTGGATGTAGGGAGGGTGAGAGG - Intronic
1003349312 6:5301065-5301087 GGGGTGGGAGGGAGTGTTTGGGG + Intronic
1003542562 6:7031327-7031349 GTTGTGGGGTGGAGGGGAAGGGG + Intergenic
1003673479 6:8181413-8181435 GGGAGGGGAGGGAGGGAAAGAGG - Intergenic
1003847241 6:10185885-10185907 GTGGTGAATGGAAGGGTAAGAGG - Intronic
1003872214 6:10412452-10412474 GAGGAGGAAGGGAGGGAAAGAGG + Intronic
1004249895 6:14015213-14015235 GTGGAAGGTGGAAGGGTAAGAGG + Intergenic
1004334778 6:14754821-14754843 GAGGTGGCAGGGAGGTGAAGAGG + Intergenic
1004570540 6:16840389-16840411 GTGGGGGTGGGGAGGGAAAGTGG + Intergenic
1004615313 6:17282557-17282579 GTGGGGGGAGGCAGGGTTAGAGG + Intronic
1004652273 6:17621701-17621723 GTGGTGGTAGGAAGGGAAGGTGG + Intronic
1004771359 6:18786135-18786157 GGGAGGGGAGGGAAGGTAAGGGG - Intergenic
1004797785 6:19107811-19107833 GGGGTGGGAGGGAGGAAATGAGG - Intergenic
1005277759 6:24238167-24238189 ATGGAGGGAGGGAGGGGAGGGGG + Intronic
1005344580 6:24876729-24876751 GCGGTCGGGGGGAAGGTAAGAGG + Intronic
1005357266 6:24996549-24996571 GTGGTGGGAGGGAAGGGAAAGGG - Intronic
1005799674 6:29408408-29408430 GGGGTGGGAGGGTAGGGAAGGGG + Intronic
1005840281 6:29740704-29740726 GTGGTGGCAGGGAGAGTTATGGG - Intergenic
1005849571 6:29811549-29811571 GTGGTGGCAGAGAGAGTTAGGGG - Intergenic
1005861410 6:29905477-29905499 GTGGTGGCAGAGAGAGTTAGAGG - Intergenic
1005865093 6:29931373-29931395 GTGGGGGGAGGGAGGGAGGGAGG + Intergenic
1005919746 6:30390169-30390191 GTGGTGGGGGGCGGGGTATGTGG + Intergenic
1006014340 6:31068059-31068081 GTGGGGAGAGGGAGGGGGAGAGG + Intergenic
1006032482 6:31187314-31187336 GTGGAGAGAGGGAGAGTACGGGG + Intergenic
1006407598 6:33854378-33854400 GGGGAAGGAAGGAGGGTAAGAGG - Intergenic
1006411140 6:33874133-33874155 GTGGTGGGATAGAGGGTAGTGGG + Intergenic
1006583735 6:35091912-35091934 CTGGTGGCAGGGAGAGGAAGGGG + Intergenic
1006670423 6:35726838-35726860 GTGGTGGGAGGCGGGGGCAGTGG + Intronic
1006804428 6:36778958-36778980 CTGGTGGGAGGGAGGGAGAACGG + Intronic
1006841271 6:37029348-37029370 ATGGTGGGAGGAAGGGTGACGGG + Intergenic
1006888218 6:37400093-37400115 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1006908085 6:37546279-37546301 GTGGTGAGGGGGAAGGGAAGAGG - Intergenic
1007348790 6:41252971-41252993 GATGTGGGAGTGAGGGAAAGGGG + Intergenic
1007359729 6:41346342-41346364 GTGGTGGGAATGAGATTAAGAGG - Intronic
1007384040 6:41508669-41508691 GAGGCTGGAGGGAGGGAAAGGGG - Intergenic
1007436916 6:41820361-41820383 GTGGTGGTAGGGAGGGAAGCTGG - Intronic
1007521644 6:42454644-42454666 GTGCTGGGAGGGAGGTGGAGGGG - Intergenic
1007599121 6:43070918-43070940 GTGGGGGGAGGGGGGGCAGGCGG + Intronic
1007631290 6:43274977-43274999 GTGCAGGGAGGGAGGGTGAGTGG - Intronic
1007759855 6:44127519-44127541 GCGGGGGGAGGGAGGGGGAGGGG - Intronic
1008048149 6:46872758-46872780 GTGGAAGGAGGGAGAGTAAAGGG - Intronic
1008221831 6:48863730-48863752 GTTATGGGAGGGAGGAGAAGAGG - Intergenic
1009279451 6:61728297-61728319 GTGGAGGGAGGGAGGGCATCAGG + Intronic
1009602626 6:65821853-65821875 GTAGTGGGAGTGGGGGGAAGTGG + Intergenic
1009916201 6:70000008-70000030 GTTGAGGGATGGAGGGTGAGGGG - Intronic
1010376453 6:75176230-75176252 GCAGTGGGAGGGAGGGCAATGGG + Intronic
1010773557 6:79860090-79860112 GGAGTGGGAGGGAGGGTAAGGGG - Intergenic
1010865194 6:80967794-80967816 GTGGTGGTGGGAAGGGTGAGGGG + Intergenic
1011017783 6:82777703-82777725 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1011069609 6:83365703-83365725 GGGGTGGGAGTGAGGGACAGGGG - Intronic
1011474384 6:87736833-87736855 GTGGGGAGAGGGAGGGGGAGGGG + Intergenic
1011474431 6:87736904-87736926 GAGGGGGGAGGGAGGGGGAGGGG + Intergenic
1011749737 6:90443051-90443073 CTAGTGGGAGGGAGGGGAAGAGG - Intergenic
1011826940 6:91318799-91318821 GTGGTGGGAGGGATGGAGAGAGG - Intergenic
1011831422 6:91376599-91376621 GTGGTGGTGGAGTGGGTAAGGGG - Intergenic
1012062786 6:94510192-94510214 GAGGTGGTAGGTAGAGTAAGAGG + Intergenic
1012172467 6:96035186-96035208 GGAGAGGGAGGGAGGGAAAGAGG + Intronic
1012259344 6:97069632-97069654 GTGAAGGGAGGGAGGGTATAAGG - Intronic
1012422326 6:99078639-99078661 ATGGTGGGAGGGAGAGACAGAGG + Intergenic
1012549541 6:100454504-100454526 GTGGTAGGGGGGTGGGTAGGGGG - Intronic
1013239400 6:108229422-108229444 GGGGAGGGAGGGAGGGGGAGAGG - Intronic
1013292859 6:108733453-108733475 GTGGCTGGAGGGATGGTGAGTGG + Intergenic
1013350205 6:109298772-109298794 GTGGTGGGAAGGAGGAGAGGTGG - Intergenic
1014001252 6:116369011-116369033 GTGGGGGGTGTGAGGGTAAAGGG + Intronic
1014335314 6:120126437-120126459 GTGGAAGGTGAGAGGGTAAGCGG + Intergenic
1014428231 6:121334799-121334821 TTGGTGGGAGGGAGTGCAACTGG + Intergenic
1014453251 6:121606305-121606327 GAGGTGGGAGGGAAGGAAGGGGG - Intergenic
1015158605 6:130126096-130126118 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1015592363 6:134834062-134834084 GGGGAGGGAGGGTGGGTTAGGGG + Intergenic
1015771184 6:136769841-136769863 AGGGAGGGAGGGAGGGGAAGGGG + Intronic
1015804651 6:137096305-137096327 CTGATGGGAGGTAGGGTAGGTGG - Intergenic
1015808700 6:137140112-137140134 AAGGTGGGAGCGAGGGCAAGGGG + Intergenic
1015963460 6:138674464-138674486 GTGGTGCGAGGGAGGGCTAGGGG - Intronic
1017260366 6:152378738-152378760 GAGGTGGGAAGGAGGGCAGGGGG - Intronic
1017377289 6:153786046-153786068 GTTGGGGGATGGAGGGTGAGGGG + Intergenic
1017567108 6:155699319-155699341 AGGGTGGGAGGGAGGGAAGGAGG - Intergenic
1017616527 6:156252167-156252189 GTGGTTGGAGGGAAGGTGAGGGG - Intergenic
1017681191 6:156865792-156865814 GTGGAGGGAAGGAGGGAAGGAGG - Intronic
1018647402 6:165961106-165961128 GTGGTGGGAGGGTGGGGATGGGG + Intronic
1018665484 6:166132809-166132831 GGGGAGGGAGAGAGGGAAAGAGG + Intergenic
1018666259 6:166141191-166141213 GTGGTGGGGGTGAGGGTGACCGG - Intergenic
1018767266 6:166944459-166944481 GTGGGGGGCTGGAGGGGAAGAGG - Intronic
1018837908 6:167498825-167498847 GTGCTGGGAGGGGAGGTCAGTGG - Intergenic
1018973603 6:168546603-168546625 GTGGAGAGAGGGAGGGCCAGAGG + Intronic
1019059083 6:169242795-169242817 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059106 6:169242861-169242883 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059165 6:169243042-169243064 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019059182 6:169243092-169243114 GTGGTGGGAAGGTGGGAAGGTGG - Intronic
1019273945 7:166196-166218 GAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1019393100 7:800842-800864 TGGGTGGGAGGGAGAGAAAGAGG - Intergenic
1019419796 7:945723-945745 CTGGGAGGAGGGAGGGAAAGAGG - Intronic
1019704850 7:2492699-2492721 TAGGTGGGTGGGTGGGTAAGTGG - Intergenic
1019730587 7:2627413-2627435 AAGGAGGGAGGGAGGGAAAGAGG + Intergenic
1019805049 7:3117562-3117584 GAGGAGGGAGGGAGAGAAAGAGG + Intergenic
1019968831 7:4523904-4523926 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1020235681 7:6353530-6353552 GAGGTGGGAGGGAGGGAGCGAGG + Intergenic
1020510275 7:9047738-9047760 CTGGTGGGAGGGGGGGTGGGGGG + Intergenic
1020687100 7:11309577-11309599 GTGGAGGGACAGAGGGTTAGAGG + Intergenic
1021011146 7:15467921-15467943 AGGGTGGCAGGGAGGGTACGGGG - Intronic
1021057463 7:16067659-16067681 GGGGTGGGAGGGTGGGGAAGGGG + Intergenic
1021080755 7:16361677-16361699 GAGCTGGGAGGGAGGGGAAGAGG + Intronic
1021569730 7:22052604-22052626 GTGGAGGGAGGAAGGGAGAGAGG + Intergenic
1021752134 7:23812658-23812680 AAGGTGGGAGGGTGGGAAAGGGG - Intronic
1022016224 7:26350677-26350699 ATGGAGGGAGGGAGGGTGGGAGG - Intronic
1022102228 7:27175400-27175422 GGTATGGGAGGGAGGGGAAGAGG - Intronic
1022149475 7:27586396-27586418 AGGGAGGGAGGGAGGGGAAGGGG + Intronic
1022153857 7:27639437-27639459 GAGGGGGGAGGGAGGGACAGAGG + Intronic
1022256220 7:28661072-28661094 GTGGTGGGAATGGGGGTGAGGGG + Intronic
1022341214 7:29469935-29469957 AAGAAGGGAGGGAGGGTAAGAGG + Intronic
1022630545 7:32080289-32080311 GGGGTTGGAGGGAAGGTCAGGGG - Intronic
1023329473 7:39099368-39099390 TTGGAGGGAGGGAGGGACAGCGG - Intronic
1023332451 7:39132753-39132775 GTGGGGCGAGGAAGGGGAAGGGG + Intronic
1023539053 7:41245385-41245407 GTGGTTGTAGGGAGGTGAAGGGG - Intergenic
1023707285 7:42954280-42954302 GTGGTGGGTGGGGGCGTGAGAGG + Intergenic
1023818803 7:43969025-43969047 CTGGTGGGAGTGTGTGTAAGTGG - Intergenic
1024257546 7:47549917-47549939 GGGGTGGGAGGGCGGGGACGTGG - Intronic
1024507028 7:50170415-50170437 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1024594517 7:50920852-50920874 GGGGAGGCAGGGAGGGGAAGGGG - Intergenic
1024974948 7:55104697-55104719 GGGTTGGGAGAGAGGGGAAGAGG - Intronic
1025193330 7:56912931-56912953 GTGGTGGGTGGGAAGGGGAGGGG - Intergenic
1025235913 7:57234784-57234806 CTGCTGGGAGGGAGGGGCAGAGG + Intergenic
1025678611 7:63663993-63664015 GTGGTGGGTGGGAAGGGGAGGGG + Intergenic
1026012262 7:66645831-66645853 GTGGTGTGGTGGAGGGTCAGGGG - Intronic
1026104163 7:67407888-67407910 GAAGTGGGAGGGAGGGGAGGAGG - Intergenic
1026285062 7:68955521-68955543 GAGGTGGGAGAGAGGGAGAGAGG + Intergenic
1026590771 7:71693664-71693686 GTGGTAGGAGGGAGGGGATCAGG + Intronic
1026662819 7:72317162-72317184 GGGGAGGGAGGGAGGGAAGGAGG + Intronic
1026927460 7:74204231-74204253 AGGGAGGGAGGGAGGGAAAGAGG + Intronic
1027443900 7:78249706-78249728 GTAGTGGGAAGGAGGGGTAGGGG + Intronic
1027592569 7:80134782-80134804 GTGGTGGGAGGGGCGGGCAGGGG + Exonic
1027624143 7:80527325-80527347 GGGAAGGGAGGGAGGGTGAGAGG + Intronic
1027638057 7:80700920-80700942 GAGGTGGGAGGGAGGGCAGCAGG - Intergenic
1027644839 7:80785012-80785034 ATGGAGGGAGGAAGGGAAAGAGG - Intronic
1028086870 7:86646012-86646034 GGGGTGGGAGGGAGTTTAGGGGG + Intronic
1028414045 7:90560884-90560906 GTTGTGGGAAGGAGGGAATGGGG + Intronic
1028504301 7:91554762-91554784 GTGGAGGGAGGGTGAGGAAGTGG - Intergenic
1028561588 7:92181828-92181850 GAGGTGGGAGGGAGGGATGGGGG - Intergenic
1029205530 7:98867465-98867487 GGGGTGGCAGGGAGGGGATGGGG - Intronic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029421891 7:100476230-100476252 GTTGGGGGAGGGGGGGTAGGAGG + Intronic
1029541027 7:101182046-101182068 GGGGTGGGGGAGAGGGTAGGGGG - Intergenic
1029654328 7:101914391-101914413 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1029654336 7:101914411-101914433 ACGGAGGGAGGGAGGGAAAGAGG - Intronic
1029673103 7:102047493-102047515 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
1029743850 7:102505991-102506013 CTGGTGGGAGTGTGTGTAAGTGG - Intronic
1029761839 7:102605154-102605176 CTGGTGGGAGTGTGTGTAAGTGG - Intronic
1029941400 7:104484357-104484379 GTGAAGGGAAGGAGGGAAAGGGG - Intronic
1029995272 7:105001258-105001280 GTGTTGGGAGGGAGTTTGAGAGG + Intergenic
1030005326 7:105112781-105112803 GGGGTGGGGGTGGGGGTAAGTGG - Exonic
1030007999 7:105137370-105137392 GTGAGGCGAGGGTGGGTAAGGGG + Intronic
1031010497 7:116521610-116521632 ATGGTGGTAGGGATGGGAAGAGG + Intergenic
1032094347 7:128930080-128930102 CTGGAGGGAGGGAGGGAGAGTGG + Intergenic
1032157087 7:129477185-129477207 GTGGGGAGAGGGAGGGGGAGGGG + Intronic
1032195990 7:129788889-129788911 GAGGTGGGAGGAAGAGGAAGAGG - Intergenic
1032618703 7:133503820-133503842 GTGGTTTGGGGGAGGGTACGTGG + Intronic
1032675827 7:134129123-134129145 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1032900541 7:136302195-136302217 GTTGTGGGAGAGATGATAAGGGG - Intergenic
1032989815 7:137381296-137381318 GTGGAGGGAGGGTGGGTGGGGGG - Intronic
1033098591 7:138451549-138451571 GTGGTGGGTGGGAGGGGGAATGG + Intergenic
1033490420 7:141837919-141837941 TTGGTGGTGGCGAGGGTAAGGGG + Exonic
1033810579 7:145006429-145006451 GTGGGGGGTGGGGGGGTAAATGG - Intergenic
1034015960 7:147586564-147586586 AGGGAGGGAGGGAGGGAAAGAGG + Intronic
1034030902 7:147762722-147762744 GTGGGGGGAGGGAGGGAGGGAGG + Intronic
1034260386 7:149751674-149751696 AGGGTGGGAGGGAGGGAAAGAGG - Intergenic
1034286098 7:149883989-149884011 GTGGAGGGAGGGAGGGAGGGAGG + Intergenic
1034326781 7:150242783-150242805 GTGGTGGTAGGGAGGGGATTTGG + Intergenic
1034520720 7:151617265-151617287 AAGGAGGGAGGGAGGGAAAGAGG + Intronic
1034520734 7:151617293-151617315 GGGGAGGGAGGGAGGGAGAGAGG + Intronic
1034628692 7:152514056-152514078 GTGGAGGGTGGGAGGGAAGGAGG - Intergenic
1034757388 7:153635523-153635545 GAGGGGGGAGGGAGGGACAGAGG - Intergenic
1034766425 7:153726482-153726504 GTGGTGGTAGGGAGGGGATTTGG - Intergenic
1034917669 7:155054328-155054350 GTGGGAGGAGGGAGAGTATGAGG - Intergenic
1035108785 7:156463414-156463436 GTGGTGGGAGCAGGGGGAAGAGG + Intergenic
1035114279 7:156509784-156509806 ATGGTGAGAGGCAGGGTATGGGG - Intergenic
1035600768 8:895681-895703 GTGGTGTGAAGGAGGGTTATGGG + Intergenic
1036206034 8:6806312-6806334 GCGGGGGGATGGAGGGTGAGAGG + Intergenic
1036282745 8:7415720-7415742 GGGGAGGGAGGGAGGGAAGGAGG - Intronic
1036457205 8:8920225-8920247 ATGGAGGGAGGGAGGGAGAGAGG + Intergenic
1036457214 8:8920249-8920271 ATGGAGGGAGGGAGGGAGAGAGG + Intergenic
1036484496 8:9166947-9166969 GTGGCGGGAGGGAGAGTATTAGG + Intronic
1036718862 8:11153869-11153891 ATGGTGGTAGGGATGATAAGTGG - Intronic
1036763210 8:11527402-11527424 GTGGTTGGAGGTAGCATAAGGGG - Intronic
1037098025 8:15008728-15008750 GGGGGAGGAGGGAGGGGAAGAGG + Intronic
1037110537 8:15159734-15159756 GGGGTGGGGGGGAGGGTGGGGGG - Intronic
1037238678 8:16752153-16752175 GTGGGGGGATGGGGGGCAAGGGG + Intergenic
1037409855 8:18584904-18584926 GTGGTGAGAGGGAGAGGGAGCGG + Intronic
1037414589 8:18635884-18635906 GGGGTGGGGTGGAGGGCAAGGGG + Intronic
1037418222 8:18674160-18674182 ATGGTGGGAGGAAGGGTATGCGG + Intronic
1037761800 8:21746415-21746437 TTGGTGGGAGATAGGGAAAGAGG + Intronic
1037804560 8:22051836-22051858 TTGATGGTAGGGAAGGTAAGTGG - Intronic
1038129226 8:24710686-24710708 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1038461512 8:27721093-27721115 GGGGAGGGAGGGAGGGAAGGAGG - Intergenic
1039518950 8:38154564-38154586 ATGGAGGGAGGGAGGGAGAGAGG - Intergenic
1039774358 8:40720873-40720895 AAGGTGGGAGGGAGGGAAGGGGG + Intronic
1040334074 8:46407287-46407309 GTGCCGAGAGGCAGGGTAAGCGG + Intergenic
1040913491 8:52544591-52544613 GTTGAGGGAGGGAGGGAATGGGG + Intronic
1040963379 8:53059361-53059383 GTTGTGGGGTGGAGGGCAAGGGG + Intergenic
1041007315 8:53508017-53508039 GTGGTGGGGTGGAGGGTGAGTGG - Intergenic
1041692460 8:60702174-60702196 GTGGTGTGTGGGTGGGTGAGAGG + Intronic
1041702515 8:60806898-60806920 GAGGTGGTAGGGAGGGGCAGGGG + Intronic
1042124558 8:65525093-65525115 GTGGTTGGAGGGAAGATGAGTGG - Intergenic
1043054845 8:75424530-75424552 AAGGTGGGAGGGAGAGAAAGGGG - Intronic
1043734280 8:83724370-83724392 GTAATGGGAGGGAGGCTGAGAGG - Intergenic
1043794270 8:84516004-84516026 GTGGTCGGGGGCAGGGTAGGGGG + Intronic
1043888565 8:85631071-85631093 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1044114013 8:88312052-88312074 GTGGTGGGAAGTAGTGTCAGAGG + Intronic
1044128709 8:88492322-88492344 GGGGTGGGAGGCAGGGGGAGGGG + Intergenic
1044723121 8:95169519-95169541 GTGGGGTGAGGGAGAATAAGTGG + Intergenic
1044767930 8:95597099-95597121 GGGGAGGGAGGGAAGGGAAGGGG - Intergenic
1044815473 8:96108148-96108170 CTGGTCGGGGGCAGGGTAAGAGG + Intergenic
1044840005 8:96329372-96329394 CAGGAGGGAGGGAGGGTGAGCGG - Intronic
1044973394 8:97641779-97641801 GTGGTGGGAGGAAGGAGAAATGG - Intergenic
1045055622 8:98365629-98365651 GGGGAGGGAGGGAGGGGAACAGG - Intergenic
1045117828 8:99003006-99003028 GTGGGAGGCAGGAGGGTAAGGGG + Intergenic
1045211699 8:100106169-100106191 GAGGAGGAAGGGAGGGTAGGGGG - Intronic
1045263367 8:100596862-100596884 GTGGGGGGAGGGGAGGCAAGAGG + Intronic
1045451919 8:102335277-102335299 GGGGTGTGAGGGAGGGAAAATGG + Intronic
1046859114 8:119070513-119070535 ATGGAGGGAGGGAGGGAAGGAGG - Intronic
1047369006 8:124239723-124239745 GTTGGGGGATGGAGGGCAAGGGG - Intergenic
1047879015 8:129171835-129171857 GAGGGAGGAGGGAGGGAAAGAGG - Intergenic
1047894756 8:129354207-129354229 GTGGTGGCATGGGGGGTAATTGG - Intergenic
1047951897 8:129941770-129941792 CTGGTGGGAGATAGGGTTAGAGG - Intronic
1048144330 8:131825451-131825473 GGGGTAAGAGGGAGGGTGAGAGG - Intergenic
1048265936 8:132985953-132985975 GTGGAGGGAGAGAGGATAAAGGG + Intronic
1048363203 8:133715504-133715526 ATGGAGGGAGGGAGGGAGAGGGG - Intergenic
1048522155 8:135166423-135166445 ATGGAGGGAGGGAGGGAGAGAGG - Intergenic
1048798646 8:138175257-138175279 GGGGAGGGAGGGAGGGCCAGAGG - Intronic
1049047665 8:140165587-140165609 GGGGAAGGAGGGAGGGGAAGGGG + Intronic
1049311772 8:141937361-141937383 AAGGTGGGAGGGAAGGGAAGAGG - Intergenic
1049311782 8:141937388-141937410 GAGGTGGGAGGGAAGGAAGGAGG - Intergenic
1049370350 8:142261332-142261354 GAGGAGGGAGGGAGGGAGAGTGG + Intronic
1049370369 8:142261383-142261405 GAGGGGGGAGGGAGGGATAGTGG + Intronic
1049381827 8:142320042-142320064 CTGGTGGGAGCGGGGGTGAGGGG - Intronic
1049457534 8:142701048-142701070 GAGGTGGGCGGGAGGGCACGTGG + Intronic
1049582634 8:143419846-143419868 GCTGTGGAAGGGAGGGTGAGGGG + Intronic
1049583304 8:143422271-143422293 TGGGTGGGAGGGAGGCAAAGGGG + Intronic
1049660302 8:143816867-143816889 GTGGCGGGGGAGAGGGTAGGGGG - Intronic
1049685111 8:143936262-143936284 GTGGTGGCAGTGAGGGTTGGGGG - Intronic
1049762164 8:144336594-144336616 GCGGGGGGGGGGAGGGGAAGGGG - Intergenic
1050302827 9:4276382-4276404 GTGAGGGGAGGGAAGGGAAGGGG + Intronic
1050578112 9:7020943-7020965 GTGGTGGGGGTGAGGGGAATGGG - Intronic
1050599781 9:7238755-7238777 GTGTGAGGAGGGAGGCTAAGAGG - Intergenic
1051107212 9:13593941-13593963 GTGGTGGGTGTGTGGGTATGGGG - Intergenic
1051216410 9:14802982-14803004 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1051529520 9:18084692-18084714 AGGGTGGGAGGGAGGGAGAGAGG - Intergenic
1051744545 9:20283021-20283043 GAGATGGGAGGGAAGGGAAGAGG - Intergenic
1051799587 9:20917585-20917607 ATGGTGGAAGGGAGTGTAACTGG - Intronic
1052274375 9:26661028-26661050 GTGGTGAGAGGGAGAGAGAGTGG + Intergenic
1052416496 9:28184561-28184583 GGGGGAGGAAGGAGGGTAAGAGG + Intronic
1052475687 9:28956611-28956633 GGGGAGGGAGGGAGGGTGGGAGG - Intergenic
1052862767 9:33447081-33447103 GGTGTGGGAGGCAGGGGAAGTGG + Intronic
1052885587 9:33644669-33644691 GTGGGGGGAGGGAGGGCATTAGG + Intergenic
1053123414 9:35561921-35561943 GAGGTGGGTGGGAGGGTGGGAGG - Intronic
1053337241 9:37286848-37286870 GGGGAGGGAGGGAGGGAAGGGGG - Intronic
1053337257 9:37286875-37286897 GGGGAGGGAGGGAGGGAAGGGGG - Intronic
1053337271 9:37286900-37286922 GGGGAGGGAGGGAGGGAAGGGGG - Intronic
1053337294 9:37286944-37286966 GGGGAGGGAGGGAGGGAAGGGGG - Intronic
1053410712 9:37914572-37914594 GAGGTGGGGGAGAGGGGAAGAGG + Intronic
1053472238 9:38355138-38355160 GGGGAGGGAGGGAGGGAATGAGG + Intergenic
1053723357 9:40971964-40971986 GTGGAAGGCGGGAGGGCAAGAGG - Intergenic
1054342607 9:63880032-63880054 GTGGAAGGCGGGAGGGCAAGAGG + Intergenic
1054450660 9:65401987-65402009 AAGGAGGGAGGGAGGGGAAGGGG + Intergenic
1054706012 9:68462687-68462709 AGGGTGAGAGGGAGGGTACGGGG - Intronic
1054807944 9:69411379-69411401 GCAGAGGGAGGGAGGGTGAGAGG - Intergenic
1054951938 9:70861935-70861957 GGGGTGGGGGGCAGGGAAAGGGG + Intronic
1055002425 9:71467223-71467245 GTGGTGGGAGAGAGAGGGAGAGG - Intergenic
1055363122 9:75516545-75516567 GTGGTGGCAGGGAGGAGATGGGG - Intergenic
1055515706 9:77031141-77031163 AGGGAGGGAGGGAGGGGAAGAGG - Intergenic
1055938963 9:81631219-81631241 GTGGGTGGAGGGAGGGTTATTGG - Intronic
1056859045 9:90162944-90162966 GTGGTGGGGGGGTAGGTATGTGG - Intergenic
1057003360 9:91533497-91533519 GGGGTGGGAGGCAGGGCCAGCGG - Intergenic
1057151523 9:92800122-92800144 GTGGTGGGGGGCAAGGGAAGGGG + Intergenic
1057292779 9:93818098-93818120 GTGAAGGGAAGGAGGGAAAGAGG + Intergenic
1057292791 9:93818131-93818153 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1057317522 9:93979350-93979372 GTGATGGTACGGAGGGCAAGTGG + Intergenic
1057341310 9:94204333-94204355 GGGGTGGGAGGGAGAGAATGAGG + Intergenic
1057392047 9:94648290-94648312 GAGATGGGAGGGAGGAGAAGGGG - Intergenic
1057416012 9:94862765-94862787 GTGTTGGGAGAGAGGATAGGTGG + Intronic
1058442376 9:105021426-105021448 ATGGTGGGGGAGAGGGAAAGTGG + Intergenic
1058781394 9:108339529-108339551 GGGGTGGGAGGGAGGGGGTGGGG + Intergenic
1058875195 9:109238010-109238032 ATGGTGGGATGAAGGGTGAGAGG + Intronic
1058934447 9:109755303-109755325 GTGGTGGGAGGTGAGGAAAGAGG - Intronic
1058944199 9:109841616-109841638 GTGGGGGGGTGGAGGGAAAGAGG + Intronic
1059016235 9:110519064-110519086 GTGGTGGGAGTCAGGGGAAGGGG - Intronic
1059201065 9:112416949-112416971 GTGGTAGGTGGTAGGGTGAGGGG + Intronic
1059499321 9:114737532-114737554 AGGGAGGGAGGGAGGGGAAGGGG - Intergenic
1059608053 9:115858035-115858057 GTGGTGGGGTGGGGGATAAGGGG - Intergenic
1059660485 9:116395280-116395302 AGGTTGGGAGGGAGGGAAAGAGG + Intronic
1059700290 9:116769363-116769385 GTGGTGGGCGGGAGAGTAAGTGG + Intronic
1059766020 9:117384847-117384869 GGGGTGGAAGGGAGGATAGGTGG + Intronic
1059874203 9:118615798-118615820 ATGGAGGGAGGCAGGGAAAGTGG - Intergenic
1060026664 9:120177748-120177770 GTTGTGGGGTGGAGGGTGAGGGG - Intergenic
1060149030 9:121275606-121275628 GTGGTGGGAGGGGAGGTGGGAGG - Intronic
1060389497 9:123267217-123267239 GAGGTAGGACGGAGGGTGAGGGG - Intronic
1060824347 9:126679422-126679444 GTGGTGGATGGATGGGTAAGTGG + Intronic
1060912841 9:127364309-127364331 GAGGTGGGAGAGAGGGCAGGAGG + Intronic
1060967672 9:127720876-127720898 GAGGAGGGAGGAAGGGGAAGGGG - Intronic
1061050120 9:128190449-128190471 GTGTTGGGAGGGGGTGTCAGAGG + Intronic
1061061872 9:128254529-128254551 GTGGTGGGAGGGCCGGGGAGGGG - Intronic
1061102744 9:128504628-128504650 CTGGTGGGAGGGCGGGAACGCGG + Intergenic
1061226479 9:129283681-129283703 GTGATGGGAGTGAGGGTAGGGGG + Intergenic
1061700032 9:132409019-132409041 GTTGTGGGTGGGTGGGTAAGGGG + Intergenic
1061777915 9:132978098-132978120 GGGGAGGGAGGGAGGGGAGGAGG + Intronic
1061835275 9:133324573-133324595 GTGGTGGGAGGGATGGTTTGGGG - Intergenic
1061869890 9:133515054-133515076 ATGGAGGGAGGGAGGGTAGGAGG - Intronic
1061900226 9:133668815-133668837 GAGGGGAGAGGGAGGGTGAGGGG - Intronic
1061900378 9:133669252-133669274 GAGGGGAGAGGGAGGGTGAGGGG - Intronic
1061931349 9:133834669-133834691 GAAGTGGGAGGGTGGGTAAAGGG - Intronic
1062123622 9:134847870-134847892 GTGGGGAGAGGAAGGGGAAGTGG + Intergenic
1062449214 9:136608463-136608485 GAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1062533233 9:137010779-137010801 CTGGTGGCAGGGAGGGGCAGTGG - Intronic
1062561480 9:137144139-137144161 GTGGTGGGCTGCAGGGGAAGAGG + Intronic
1203451792 Un_GL000219v1:124017-124039 GTGGAAGGCGGGAGGGCAAGAGG + Intergenic
1185556075 X:1022222-1022244 GGGGTGGGAGGGAGAGCAACAGG + Intergenic
1185768828 X:2749213-2749235 AGGGAGGGAGGGAGGGAAAGGGG - Intergenic
1185878811 X:3722090-3722112 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1186269056 X:7865299-7865321 GTGGTGGGAGGGAAGTCATGTGG + Intergenic
1186469343 X:9809040-9809062 TTGGGGGAAGGGAGGGAAAGGGG - Intronic
1186930015 X:14379023-14379045 TTGGTGGGAGGGAGGGAGGGAGG - Intergenic
1186960428 X:14730587-14730609 GAGGGGGGAGGGAGGGTCATGGG + Exonic
1187126792 X:16461903-16461925 AGGGAGGGAGGGAGGGAAAGGGG + Intergenic
1187460046 X:19478149-19478171 GGGAAGGGGGGGAGGGTAAGGGG + Intronic
1187695350 X:21913718-21913740 GAGGAGGGAGGGAGGGAAGGAGG + Intergenic
1187751042 X:22465437-22465459 ATGGAGGGAGGGAGGGCAGGGGG - Intergenic
1187797624 X:23021667-23021689 GAGGAGGGAGGGAGGGGAAAGGG - Intergenic
1188277289 X:28216006-28216028 GGGGAAGGAGGGAGGGAAAGAGG - Intergenic
1188768536 X:34125959-34125981 GAGGTGGGAGGAAGGGTGAGGGG + Intergenic
1190138862 X:47823180-47823202 GAGGAGGGCAGGAGGGTAAGAGG + Intergenic
1190141585 X:47850599-47850621 TTGCAGGGAGGGAGGGAAAGAGG + Intronic
1190249339 X:48710138-48710160 GGGGTGGGGGGGAGGGTAGAAGG + Intergenic
1190751832 X:53368861-53368883 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1190915685 X:54809512-54809534 GTGGAGGGAGGGAGAGAAGGTGG + Intronic
1190953138 X:55165523-55165545 AGGGAGGGAGGGAGGGAAAGAGG - Intronic
1190980074 X:55449249-55449271 GTCGTGGGGTGGAGGGTAGGGGG + Intergenic
1192184631 X:68938751-68938773 GTGGTAAGAGGGAGGGGGAGAGG + Intergenic
1192214757 X:69150505-69150527 GTGATGGGCTGGAGGGTAGGGGG + Intergenic
1192430760 X:71110009-71110031 GTTGGAGGAGGGAGGGTAGGGGG + Intronic
1192568163 X:72180514-72180536 ATGGTGGGAGGGATTGTAAGGGG + Intergenic
1192638242 X:72840999-72841021 AGGGTGGGAGGGAGGGAAGGAGG + Intronic
1192643472 X:72879813-72879835 AGGGTGGGAGGGAGGGAAGGAGG - Intronic
1193083048 X:77424430-77424452 TAGCTGGGAGGCAGGGTAAGGGG - Intergenic
1193355514 X:80515811-80515833 ATGGTGGGAGGGTGGGAAAGAGG - Intergenic
1193655112 X:84188404-84188426 GTGGTGGGATAGAGGGGAGGGGG + Intergenic
1193744314 X:85257313-85257335 GAGGTGGGAGGGAGGGAGTGGGG - Intronic
1193772128 X:85600169-85600191 ATGGTGGGGGAGAGGGTTAGTGG - Intergenic
1194329812 X:92567854-92567876 GTGGTGGGAGGGAGAGCATCAGG + Intronic
1194483209 X:94453505-94453527 GTGATGAGGGGGTGGGTAAGGGG - Intergenic
1195100781 X:101552214-101552236 GAGGTGGAATGGAGGGTTAGAGG + Intronic
1195201015 X:102550089-102550111 GAGGTGGGTAGGAGGTTAAGGGG + Intergenic
1195250063 X:103034916-103034938 GTGGAGGGAGGGATGAAAAGAGG - Intergenic
1195254481 X:103079295-103079317 GAGGTGGGTAGGAGGTTAAGGGG - Intronic
1195264184 X:103164143-103164165 CTGGAGGGTGGGAGGGGAAGTGG + Intergenic
1195524288 X:105868710-105868732 GTGGTGGGGGGCGGGGGAAGTGG - Intronic
1196060450 X:111402819-111402841 GTGCGGAGGGGGAGGGTAAGTGG + Intronic
1196424374 X:115555274-115555296 AGGGAGGGAGGGAGGGAAAGAGG - Intergenic
1196697822 X:118632965-118632987 GCGGTGGGGGGGGGGGTGAGGGG + Intronic
1196741095 X:119026715-119026737 GTGGTGGGAGGGAGAGCATCAGG + Intergenic
1196746733 X:119077909-119077931 ATGGAGGGAGGAAGGGAAAGGGG - Intergenic
1196829541 X:119765422-119765444 GGGGTGGAAGGGAAGGAAAGAGG + Intergenic
1196830609 X:119772778-119772800 GCAGAGTGAGGGAGGGTAAGTGG - Intergenic
1197332484 X:125171162-125171184 GTGGTGAGTTGGAGGGAAAGTGG - Intergenic
1197456167 X:126678094-126678116 GTAGTGGGAGGGAGGGCATCAGG + Intergenic
1197527288 X:127578255-127578277 GTGGTGGGAGAGGGGGTGTGAGG - Intergenic
1197532150 X:127642667-127642689 GAGGTGGGAGGGAGGGCAAGGGG - Intergenic
1197709153 X:129653854-129653876 GGGGTGGGATGGAGGCTATGGGG + Intronic
1197762692 X:130038911-130038933 GTAATGGGAGGGAGGAAAAGGGG + Intronic
1197844433 X:130786067-130786089 ATTGTGGGAGGGAGGGAGAGAGG - Intronic
1198156998 X:133970730-133970752 GTGGTGGGAAGGTGGGGAACAGG + Intronic
1198246681 X:134838677-134838699 GTGGGGAGAGGGAGGGGGAGGGG - Intronic
1198393102 X:136196184-136196206 GAGGTGGGAGTGAGGGAAAGGGG + Intronic
1198430274 X:136558898-136558920 GTGGTGGGTGGGAGGGAATGGGG - Intergenic
1198687590 X:139244018-139244040 GTGGTGGGAGAGAGAGTATCAGG + Intergenic
1198783883 X:140266570-140266592 GTGGTGGGAGGGTGTGTTGGGGG - Intergenic
1198787967 X:140312072-140312094 GAAGGGGGAGGGAGGGAAAGGGG + Intergenic
1198992039 X:142525844-142525866 GTAGGGGGAGGGAGGGTATCAGG - Intergenic
1199277083 X:145957899-145957921 TGGGTGGGAGGAAGGGTAAGGGG + Intergenic
1199282103 X:146013988-146014010 GAGGAGGGAGGGAGGGAAATGGG + Intergenic
1199411541 X:147529313-147529335 CTGGTGGGAAGGAGGGTAGAAGG - Intergenic
1199510337 X:148614581-148614603 GAGAAGGGAGGGAGGGAAAGAGG - Intronic
1199938388 X:152600223-152600245 GTGGTGGGAGGGAGGGTCTCAGG - Intergenic
1200216022 X:154368613-154368635 GTGGGGTGAGGCAGGGGAAGTGG + Intronic
1200232143 X:154449442-154449464 CTGGTGGGAGGGAAGGGAAGAGG - Intronic
1200638514 Y:5687036-5687058 GTGGTGGGAGGGAGAGCATCAGG + Intronic
1201451139 Y:14116181-14116203 AGGGAGGGAGGGAGGGAAAGAGG + Intergenic
1201618379 Y:15927060-15927082 GTGGGGGGAGGGAGAGAATGAGG + Intergenic
1201697441 Y:16841162-16841184 GGGGAGGGAGGGAGGGAAGGGGG + Intergenic
1201949491 Y:19548486-19548508 GAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1202017644 Y:20428321-20428343 GTATTGGGAGGGAGGGGAAGAGG + Intergenic
1202580882 Y:26379251-26379273 ATAGGAGGAGGGAGGGTAAGAGG - Intergenic
1202596996 Y:26550601-26550623 CTGTTGGGAGGGAGGGGATGGGG + Intergenic