ID: 1128212275

View in Genome Browser
Species Human (GRCh38)
Location 15:65910992-65911014
Sequence GGACCCATACCAGGCAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128212275_1128212280 -10 Left 1128212275 15:65910992-65911014 CCCACTCTGCCTGGTATGGGTCC 0: 1
1: 0
2: 0
3: 13
4: 110
Right 1128212280 15:65911005-65911027 GTATGGGTCCGGGCACATTAAGG 0: 1
1: 0
2: 0
3: 3
4: 33
1128212275_1128212281 -9 Left 1128212275 15:65910992-65911014 CCCACTCTGCCTGGTATGGGTCC 0: 1
1: 0
2: 0
3: 13
4: 110
Right 1128212281 15:65911006-65911028 TATGGGTCCGGGCACATTAAGGG 0: 1
1: 0
2: 1
3: 0
4: 43
1128212275_1128212285 19 Left 1128212275 15:65910992-65911014 CCCACTCTGCCTGGTATGGGTCC 0: 1
1: 0
2: 0
3: 13
4: 110
Right 1128212285 15:65911034-65911056 CCTATGTATTATCTACACATAGG 0: 1
1: 0
2: 0
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128212275 Original CRISPR GGACCCATACCAGGCAGAGT GGG (reversed) Intronic
900176039 1:1291775-1291797 AGACCCACCCCAGGCAGTGTAGG - Exonic
900305260 1:2003697-2003719 GGACCCAGGCCAGCCAGAGGTGG - Exonic
902560513 1:17274441-17274463 GCACGCATAGCAGGCAAAGTCGG - Intronic
902764866 1:18607332-18607354 GGACCCATTCCAGAAAGAGGAGG - Intergenic
905909257 1:41642555-41642577 GCACCCATACAAGGTAGAGAAGG - Intronic
915554626 1:156654572-156654594 GAACCCAGCGCAGGCAGAGTCGG - Intronic
918987615 1:191653481-191653503 GTAAGCATGCCAGGCAGAGTTGG + Intergenic
920303351 1:205003031-205003053 GCACACACACCAGGCAGAGCAGG - Intronic
921303582 1:213773129-213773151 GGAGCCATCGCAGGCAGAGGTGG + Intergenic
922769844 1:228175861-228175883 AGGCTCATGCCAGGCAGAGTGGG - Exonic
924008312 1:239636833-239636855 GTACCCAAAGCAGGCAGGGTTGG - Intronic
924384258 1:243487768-243487790 GGACCCCGCCCAGGCAGAGCCGG - Intronic
1063368512 10:5506517-5506539 GGGCCCATCCCAGGGAGAGCTGG + Intergenic
1069589945 10:69635416-69635438 TGTCACATAGCAGGCAGAGTTGG - Intergenic
1069865731 10:71501774-71501796 GAGCCCATCCCAGGGAGAGTGGG + Intronic
1071452496 10:85810574-85810596 AGACCCATTCCAGGCAGACCTGG + Intronic
1074882152 10:117667703-117667725 GGGCCCATTCCAGGCAGCCTGGG - Intergenic
1076364016 10:129910632-129910654 GGACCCACAGCAGGGAGCGTAGG - Intronic
1077184132 11:1228878-1228900 GGACCCACCCCAGGCATAGTGGG + Intronic
1078638672 11:13075744-13075766 GGAGAGATACCAGGCAGAGAGGG - Intergenic
1078734667 11:14008958-14008980 GGACTCATAGCAGGCTGAGAAGG - Intronic
1080843778 11:36008202-36008224 GGACGCAAACCAGGCAGAATGGG + Intronic
1086743089 11:90391874-90391896 GAAGCCATGGCAGGCAGAGTGGG + Intergenic
1090981378 11:131725526-131725548 GGAAGCATCCCAGGCAGAGGAGG + Intronic
1091456825 12:614213-614235 GGACCCAAACCAAGCTGAGCAGG - Intronic
1092995357 12:13944603-13944625 GGAAGCCTACCATGCAGAGTTGG - Intronic
1096652514 12:53068809-53068831 AGGCCCATCCCAGGCAGAATTGG - Intronic
1102473880 12:113176029-113176051 GGAACCCTCCCTGGCAGAGTTGG - Intronic
1104135536 12:125934306-125934328 GGACTCATCCCAGGCAGAGCAGG - Intergenic
1104510331 12:129372095-129372117 GGACCCTTACCAGGGTGGGTGGG + Intronic
1112435297 13:99387607-99387629 GGAGCCATCCCAGCCAGAGGAGG + Intergenic
1113821495 13:113217003-113217025 GGACACATAGGAGGCAGAGTGGG + Intronic
1115213227 14:30989295-30989317 GCACCCATACCTGGAAGAGATGG + Intronic
1115373928 14:32652077-32652099 GGAACCATAGCATGCAAAGTGGG - Intronic
1127847189 15:62881112-62881134 AGAAACATAACAGGCAGAGTTGG - Intergenic
1127860458 15:62989573-62989595 GTGCCCAGAGCAGGCAGAGTGGG - Intergenic
1128212275 15:65910992-65911014 GGACCCATACCAGGCAGAGTGGG - Intronic
1130301218 15:82680808-82680830 GGGCCCAGCCCAGGCAGAGCGGG - Intronic
1132003485 15:98203887-98203909 GAACACAGACCCGGCAGAGTTGG + Intergenic
1132346550 15:101112264-101112286 GGACCCAGCCCAGGCTGAGCTGG + Intergenic
1132986881 16:2771897-2771919 GGACCCATCCCAGGGAGGGGCGG + Intronic
1134113472 16:11530834-11530856 AGACCCTTCCCAGGCAGACTCGG - Intergenic
1134232220 16:12437953-12437975 GAGCCCACACCAGGCAGAGCTGG - Intronic
1135167930 16:20156959-20156981 GGCCCCATGCCAGGAAGTGTGGG - Intergenic
1137670592 16:50276075-50276097 GGTGACATCCCAGGCAGAGTCGG - Intronic
1138502098 16:57452984-57453006 GGAGTCACACCAGGCAGAGCGGG + Intronic
1141410246 16:83828240-83828262 GGACCCATGTGAGGCAGACTCGG + Intergenic
1141703274 16:85651978-85652000 GGCCCTATGCCAGGCAGGGTAGG + Intronic
1147462312 17:40581174-40581196 GGCCTAATACCTGGCAGAGTAGG - Intergenic
1148458612 17:47824606-47824628 GGATCGATCCCAAGCAGAGTGGG - Intronic
1152942092 17:83178145-83178167 GGAGCCTCACCAGGCAGAGATGG + Intergenic
1156450813 18:37265654-37265676 GGAGCCAGGCCAGGCAGAGGAGG - Intronic
1157703960 18:49785593-49785615 TGACACATACCAGACACAGTGGG + Intronic
1161206753 19:3045436-3045458 AGACCGATTCCAGGCAGAGTTGG - Intronic
1161441958 19:4296874-4296896 GGACCCATCCTGGGCAGAATCGG - Intronic
1161614562 19:5262832-5262854 GTAAACATACCAGGCAGAGTGGG + Intronic
1168547311 19:57264052-57264074 GGGCACACACCAGGCAGTGTAGG - Intergenic
926042108 2:9681589-9681611 GGGCCCATGGCAGGCAGAGGAGG - Intergenic
926835601 2:17016129-17016151 TGACTCTTACAAGGCAGAGTAGG - Intergenic
930031271 2:47059463-47059485 GGGCACAAACCAGGCAGTGTTGG - Intronic
930898950 2:56480673-56480695 AGACCCATTCCAGGTAGATTTGG - Intergenic
935363623 2:102267948-102267970 GGAGCAATGCCAGGCAGAGTGGG - Intergenic
935394697 2:102594496-102594518 GGTCTAATACCAGGAAGAGTTGG - Intergenic
935796271 2:106644496-106644518 GGAGCCATCCATGGCAGAGTGGG + Intergenic
938710607 2:133973358-133973380 GGACCCATCCCATGGATAGTAGG - Intergenic
947412804 2:229859256-229859278 AGGCTCATACCAGGAAGAGTGGG - Exonic
948178838 2:235964416-235964438 GGCACCATACCTGGCAAAGTGGG + Intronic
1169016157 20:2294268-2294290 GCACCCATGCCAGGCAGAATGGG - Intergenic
1169227669 20:3866333-3866355 GGACCCACACAAGGCACCGTGGG - Exonic
1170791920 20:19515671-19515693 GGACCCCCACCAGGCAGCGTGGG - Intronic
1171058129 20:21927870-21927892 GCACCCATCCCAGGCCGAGGTGG + Intergenic
1172644094 20:36459154-36459176 GAATCCCTACAAGGCAGAGTTGG - Intronic
1173361298 20:42346878-42346900 GGGCTCACACAAGGCAGAGTTGG + Intronic
1174048673 20:47751997-47752019 GCTCACATACCTGGCAGAGTGGG + Intronic
1174198995 20:48794065-48794087 GGACCCCTACCCCACAGAGTGGG + Intronic
1175300804 20:57941435-57941457 GGATCCAGGCCAGGCAGGGTGGG + Intergenic
1175851041 20:62093120-62093142 GGACCCCTGCCTGGCAGAGCTGG + Intergenic
1176055699 20:63146777-63146799 GCATCCATACCAGACAGGGTGGG - Intergenic
1182287639 22:29257805-29257827 GGCCACATAACTGGCAGAGTGGG + Intronic
1184475770 22:44720490-44720512 AGACCCCTTCCAGGCAGAGGAGG - Intronic
1184858998 22:47162773-47162795 GGACCCAGTGCAGGGAGAGTCGG + Intronic
951529559 3:23685923-23685945 GGACTCATTCCAGGCAGAGAGGG - Intergenic
956608214 3:71094742-71094764 GGAGCCACACCAGGAAGTGTTGG + Intronic
957500324 3:81048189-81048211 GGACTCATTCCAGGCCCAGTGGG - Intergenic
968707949 4:2092060-2092082 GGACCCAGCCCAGGGAGAGTTGG - Intronic
970111250 4:12640221-12640243 GCACTCATCTCAGGCAGAGTTGG - Intergenic
973188972 4:47365565-47365587 GGACACAAAGCAGGCAGAGAAGG - Intronic
974576726 4:63734666-63734688 GTGCCCATCCCAGCCAGAGTAGG - Intergenic
976590752 4:86847617-86847639 GGGCTCATACCATGCAGAATAGG - Intronic
980083789 4:128370650-128370672 GGTCCCAGACTAGGCAGTGTGGG + Intergenic
982916848 4:161222233-161222255 GTACCCATCCCAGGCAGAGATGG - Intergenic
984191056 4:176606200-176606222 GGTCCTACACCAGGCAGAGTAGG + Intergenic
990828595 5:59930694-59930716 GGAAGAAAACCAGGCAGAGTAGG + Intronic
993507830 5:88733061-88733083 AGACCAATACAAGGCAGCGTAGG + Intronic
994337353 5:98583295-98583317 GGACACATATCTGGGAGAGTAGG - Intergenic
994726110 5:103437557-103437579 GGACCAGTAGCAGTCAGAGTGGG + Intergenic
997341402 5:133147868-133147890 GACACCATACCAGGCAGAGGAGG - Intergenic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
1000099728 5:158003775-158003797 GCACCCACATCAGACAGAGTGGG + Intergenic
1003306765 6:4935999-4936021 GGACCCACACCCGGGAGAATGGG - Intronic
1004914059 6:20315045-20315067 GCACCCAAACCATGCAGTGTTGG - Intergenic
1007397233 6:41584922-41584944 GGAGCCAGGCCAGGCAGAGGAGG - Intronic
1007416606 6:41694746-41694768 GGACCCTTTCCAGGCATGGTGGG - Intronic
1019401753 7:858505-858527 GGACGCATACCAAGGAGACTGGG - Intronic
1021660317 7:22913440-22913462 GGAGTCATACCCGGCACAGTAGG + Intergenic
1025641050 7:63369654-63369676 GGCACCATGCCAGCCAGAGTTGG + Intergenic
1029058118 7:97768071-97768093 GGACACCTTCCAGGCAGAGGAGG + Intergenic
1033672929 7:143510906-143510928 AGGCCCGTACCAGGCAGAGGGGG - Intergenic
1035303479 7:157914802-157914824 GGAGCCATAGAGGGCAGAGTAGG - Intronic
1039947329 8:42140895-42140917 GGCCCCATTCCAGGCTGGGTCGG + Intergenic
1040370147 8:46762320-46762342 GGACACCTTCCAGGCAGAGGAGG - Intergenic
1042483807 8:69330627-69330649 GGACCCATACCAGTCACCCTGGG - Intergenic
1043494970 8:80790718-80790740 GGAGCCACACTGGGCAGAGTGGG + Intronic
1046535852 8:115509246-115509268 GGACCTATTCCAGGCAAAGCTGG + Intronic
1049404225 8:142444480-142444502 GCACCCAGGCCAGGCAGCGTGGG - Intergenic
1049606990 8:143534401-143534423 GGACTCCTGCCAGGAAGAGTGGG - Intronic
1053599713 9:39598483-39598505 GCAGCCTTCCCAGGCAGAGTAGG + Intergenic
1053857415 9:42352667-42352689 GCAGCCTTCCCAGGCAGAGTAGG + Intergenic
1054253814 9:62743903-62743925 GCAGCCTTCCCAGGCAGAGTAGG - Intergenic
1054567877 9:66778067-66778089 GCAGCCTTCCCAGGCAGAGTAGG - Intergenic
1054765801 9:69041592-69041614 GGACCCATACCTCGCAGGGGAGG - Intronic
1058639398 9:107068379-107068401 CTAGTCATACCAGGCAGAGTTGG - Intergenic
1059495425 9:114705210-114705232 GGTCCCAGAGCAGGCAGAGCTGG - Intergenic
1196833432 X:119793923-119793945 AGACCCGAACCAGACAGAGTAGG - Intergenic