ID: 1128212758

View in Genome Browser
Species Human (GRCh38)
Location 15:65913857-65913879
Sequence GCTCCTGTTATTCCTCATTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128212758_1128212763 27 Left 1128212758 15:65913857-65913879 CCACAATGAGGAATAACAGGAGC 0: 1
1: 0
2: 1
3: 11
4: 115
Right 1128212763 15:65913907-65913929 TGCCGCTCTGCACCCAGTGCTGG 0: 1
1: 0
2: 1
3: 15
4: 200
1128212758_1128212764 28 Left 1128212758 15:65913857-65913879 CCACAATGAGGAATAACAGGAGC 0: 1
1: 0
2: 1
3: 11
4: 115
Right 1128212764 15:65913908-65913930 GCCGCTCTGCACCCAGTGCTGGG 0: 1
1: 1
2: 0
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128212758 Original CRISPR GCTCCTGTTATTCCTCATTG TGG (reversed) Exonic
907030505 1:51166417-51166439 TCTTCTGATGTTCCTCATTGAGG + Intergenic
910152159 1:84162820-84162842 ACTGCTTTTTTTCCTCATTGTGG + Intronic
910314534 1:85867335-85867357 GCTCCAGTATTTCCACATTGGGG - Intronic
910519378 1:88101720-88101742 GCTCCTTTTAGTCCTCAGGGAGG - Intergenic
911429581 1:97767105-97767127 GCTCCTGTTTTTCCCCTTTTTGG + Intronic
911701514 1:100958511-100958533 GTTTCTGTTTTTCTTCATTGAGG + Intronic
915073773 1:153292970-153292992 GCTCCTGTGACCCCTCACTGTGG - Intergenic
915765006 1:158353994-158354016 GCTCCTGTTCCTCCTCTTCGAGG + Exonic
916154171 1:161828033-161828055 CCTCTTCTTATTACTCATTGGGG + Intronic
917933456 1:179840433-179840455 TCTCCTGCTTTTCCTCACTGAGG - Exonic
918180657 1:182084001-182084023 GTTCCTTTATTTCCTCATTGTGG + Intergenic
919305582 1:195831029-195831051 GTTGCTGTTCTTTCTCATTGTGG + Intergenic
1063418712 10:5893461-5893483 TCTCCTGTCATTCCTCATCAGGG + Intronic
1066510105 10:36085838-36085860 GTTCCTGTTATTCTGCATTCTGG + Intergenic
1075952206 10:126489701-126489723 GATCCAGTAATTCCACATTGGGG + Intronic
1082653393 11:55822633-55822655 TCTTCTATTATTCCACATTGAGG + Intergenic
1082817356 11:57518036-57518058 GCACCTGCTATTCCTTCTTGTGG + Intergenic
1083459960 11:62804778-62804800 GCTGTTGTTATTCCACATTAAGG + Intronic
1083892231 11:65601355-65601377 GCTCACGTTATGCCTCATAGAGG + Intronic
1085247151 11:75111559-75111581 GCCTTTGTTATTGCTCATTGAGG - Intronic
1086513115 11:87582065-87582087 GCTCCTATCACTCATCATTGGGG - Intergenic
1089316422 11:117594233-117594255 TCTCCTGTTGTTTCTCAGTGGGG + Intronic
1089441335 11:118520020-118520042 CCTCCTCTTCTTCATCATTGGGG - Exonic
1090158354 11:124465255-124465277 GCTCCTGTAATTTCTCCTTGTGG + Intergenic
1090836265 11:130456319-130456341 GTCCCTCTTCTTCCTCATTGAGG + Intronic
1096154451 12:49334260-49334282 CCTCCTGTCAGTCCTCATGGAGG + Intronic
1097593316 12:61598195-61598217 AATCCTGTTAATCCTCATTAAGG + Intergenic
1099483063 12:83193097-83193119 GTTCTTGTTATTTCTCTTTGTGG + Intergenic
1099529903 12:83765149-83765171 ACACCTGTTATTACTTATTGGGG - Intergenic
1100599780 12:96103316-96103338 GCCCATGTTATTCCCCATTCAGG + Intergenic
1103852519 12:123942395-123942417 GCTGCTGTTACTCCTCCTTTTGG + Intronic
1108595701 13:51946690-51946712 GCTCCTGTAATGCCTCTTTGAGG - Intronic
1109060925 13:57619170-57619192 GTTGCTGTTATTCTACATTGGGG + Intergenic
1109730794 13:66410987-66411009 GCTTCTGTTATTCCTCATAATGG + Intronic
1112235303 13:97630598-97630620 GCTCCTCATAGTTCTCATTGGGG - Intergenic
1113508607 13:110833392-110833414 GCATCTGTTATTTCTCATTTTGG - Intergenic
1113588919 13:111484549-111484571 GCTCCTGCTCTTCCTGCTTGTGG + Intergenic
1115451148 14:33548988-33549010 GCTCCTGTAATTACTAACTGGGG - Intronic
1117773261 14:59156138-59156160 GTTCCTCTTATTCAGCATTGGGG - Intergenic
1118875458 14:69781166-69781188 ACTCCTGTTATTACTCAAAGGGG + Intronic
1120353482 14:83395496-83395518 GATCCTGCTTTTTCTCATTGAGG + Intergenic
1127993919 15:64141437-64141459 GCTCCTGTTATTCCTTGTAGAGG - Intronic
1128212758 15:65913857-65913879 GCTCCTGTTATTCCTCATTGTGG - Exonic
1130551199 15:84890905-84890927 GCTCCTGTGACTCCTCTGTGTGG - Intronic
1132771643 16:1566919-1566941 GCCACTGTTTTTCCTCCTTGGGG + Intronic
1133690456 16:8209655-8209677 CCTCCTCTTTTTCCTCACTGTGG - Intergenic
1135269522 16:21057033-21057055 CCTCCTGTTACTCCTCTTAGAGG - Intronic
1137002319 16:35240097-35240119 GCTCCTGTAATTCCCAAGTGTGG + Intergenic
1145104200 17:20101575-20101597 ACTCCTGTAAATCCTCCTTGTGG + Intronic
1146305679 17:31728274-31728296 GCTCCTGTGATTCCTAATACTGG - Intergenic
1151902547 17:77026207-77026229 ATTCCTGCTATCCCTCATTGTGG - Intergenic
1153340857 18:3973438-3973460 GCTCCTGTTACTCCTGGTTTGGG + Intronic
1153399278 18:4665875-4665897 GTTTCTGTTATTACTCATGGTGG - Intergenic
1156985092 18:43341637-43341659 GGTCCTGTTATTCATTGTTGAGG + Intergenic
1160483846 18:79269962-79269984 GCTCCTGCTTATCCTCCTTGCGG + Intronic
1160713927 19:566587-566609 GCTCCTGTTCTTTCTCAATGCGG - Intergenic
1162771931 19:12954288-12954310 GTTTCTGTTTTTCCTCCTTGAGG + Exonic
1162850328 19:13426144-13426166 TTTCCTGTGATTCCTCATTCTGG - Intronic
1163101050 19:15096789-15096811 GCACCTGTTGTTACACATTGTGG - Intergenic
1163234573 19:16023108-16023130 GGTCCTGTAGTTCCTCATGGAGG - Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1167415045 19:49365580-49365602 GCTCCTGGTTCTCCTCTTTGTGG - Exonic
930014747 2:46962629-46962651 GCTCCTGCCATGGCTCATTGGGG + Intronic
932201842 2:69835447-69835469 GCTCTTATTCTTCCTCATGGTGG + Intronic
933069074 2:77835464-77835486 GCTCCAGATAATCCTCAGTGAGG + Intergenic
934813467 2:97304459-97304481 GGTCTTGCTATTCCTCAGTGAGG + Intergenic
934824228 2:97404021-97404043 GGTCTTGCTATTCCTCAGTGAGG - Intergenic
938822479 2:134973682-134973704 TCTCTTGTTATTTATCATTGTGG + Intronic
940581339 2:155584456-155584478 GCCCCTGCTACTCCTCACTGGGG + Intergenic
941922229 2:170862746-170862768 GCTCCTGTGCTTCCTCATTCAGG + Intergenic
942955667 2:181770166-181770188 GCTCCTTTTAATTTTCATTGTGG + Intergenic
944203803 2:197136124-197136146 GTTCCAGTTATACCTCACTGAGG + Intronic
1169702847 20:8467422-8467444 TCTCCATTTATTCCTCACTGGGG + Intronic
1172889829 20:38256186-38256208 GCTCCTCTTAGTCATCATAGTGG + Intronic
1173064735 20:39699540-39699562 GCTCCTGTTTTTCCAGTTTGGGG - Intergenic
1178679614 21:34661923-34661945 TCTCTTATTATTCATCATTGTGG - Intergenic
1184608093 22:45585888-45585910 GCTGCTGTTATCCCTCCTTGAGG + Intronic
949493185 3:4608678-4608700 TCATCTGTAATTCCTCATTGTGG - Intronic
952326432 3:32324581-32324603 GGTCCTTTTTTTCCTCATTTAGG + Intronic
960210745 3:114962535-114962557 GATCCTGGTATTCCCCCTTGGGG + Intronic
969760780 4:9179904-9179926 GCTCCTGTTCTTCCTCTTAATGG + Intergenic
969935531 4:10676709-10676731 TCTCCTCTTATTCCACTTTGTGG + Intronic
973025566 4:45265635-45265657 GCTACTGTATTTCTTCATTGTGG - Intergenic
975581188 4:75908244-75908266 GCTCCTCTTCTTCCTCTTTCAGG + Intergenic
976119820 4:81767744-81767766 GTTACTGTTATTTCTCATAGTGG + Intronic
981915972 4:150033609-150033631 CCTTTTGTTATTCCTCATTTGGG + Intergenic
1202767857 4_GL000008v2_random:166494-166516 CCTCCTGTTATTCTCTATTGCGG - Intergenic
988236718 5:28555532-28555554 TGTCCTTTTATTTCTCATTGAGG + Intergenic
989782144 5:45280584-45280606 ACTCCTGTCAGTCCTTATTGTGG - Intronic
990518310 5:56551798-56551820 GCTCCTGCAATTCCTCTGTGAGG + Intronic
993844558 5:92924519-92924541 GCTCCTGTTACTCTTCATAAAGG + Intergenic
994357592 5:98811306-98811328 GCTCCTGTAATTTATCACTGTGG - Intergenic
996654538 5:125921092-125921114 GCTCCTGTTATTCGTCTATTTGG + Intergenic
998949211 5:147374865-147374887 GCTTTTGTTTTTACTCATTGAGG + Intronic
1003436463 6:6093170-6093192 GCTCTTGTTATTCCTCAGTTTGG + Intergenic
1012925980 6:105268265-105268287 GCTCCTGTTGGTCCACATTCTGG - Intergenic
1012963909 6:105652285-105652307 GCTTCTGTTATTCATCAGTTGGG - Intergenic
1014807323 6:125844840-125844862 GCTGCTGTTATTCTTACTTGGGG - Intronic
1019201464 6:170319691-170319713 GCTCCAGTTCTACCTCTTTGGGG - Intronic
1024000815 7:45188332-45188354 GCTCCTGTCCTTACTCACTGGGG + Intergenic
1028478702 7:91280401-91280423 GCTCCTGGTATTCCCCAGCGTGG + Intergenic
1028597877 7:92566201-92566223 ACTCCTGTTATATCTCAATGAGG + Intronic
1029891242 7:103932590-103932612 GCTTCTGTTATTCCACCTGGTGG + Intronic
1036197483 8:6732872-6732894 GCTCTTTTTATTCCTCTTTAAGG - Intronic
1036280442 8:7395835-7395857 GCTTCTGTTATTTATCATTGAGG - Intergenic
1036341028 8:7915735-7915757 GCTTCTGTTATTTATCATTGAGG + Intergenic
1036845728 8:12169014-12169036 GCTCCTGTTCTTCCTCTTAATGG - Intergenic
1036867094 8:12411333-12411355 GCTCCTGTTCTTCCTCTTAATGG - Intergenic
1038439323 8:27560507-27560529 GCTCCTGTTCTTCCCCATTGTGG + Intergenic
1039609029 8:38904304-38904326 GCTCCTGATATTGCCCAGTGTGG + Intronic
1042836912 8:73087328-73087350 GCTGATGTTAGTCCTCATTTTGG - Intronic
1043424370 8:80133856-80133878 GACCCTGTTATTCTTCCTTGGGG - Intronic
1050755186 9:8993804-8993826 GCACCTGTTATTACACACTGGGG + Intronic
1054752065 9:68917431-68917453 GCTCCTGTTATTCCTCCCAGCGG - Intronic
1055790324 9:79916416-79916438 GCTCCTATTTTTGCTCTTTGGGG + Intergenic
1061032025 9:128090859-128090881 GCTACTGTCATTCCTCGCTGAGG - Intronic
1062514895 9:136927957-136927979 GTTCCTGATATTCCTGATTACGG + Intronic
1185877329 X:3712141-3712163 ACTCCTGTTTGTCCTCATTTTGG - Intronic
1186756305 X:12674982-12675004 TCTGCTGTTATTCATCATTATGG - Intronic
1187699736 X:21953755-21953777 TCTCCTGTTATTCCTAATATTGG + Intronic
1191608704 X:63088595-63088617 GCTCCAGGTAATCCTCAGTGAGG + Intergenic
1191682141 X:63851977-63851999 ACTCCTGTTATTGGTCACTGAGG + Intergenic
1194169818 X:90566907-90566929 GCTCCAGATAATCCTCAGTGAGG - Intergenic
1194398877 X:93419164-93419186 GCTCCAGATAATCCTCAGTGAGG - Intergenic
1194850632 X:98864619-98864641 GCTCCAGATAATCCTCAGTGAGG + Intergenic
1198004279 X:132476150-132476172 GCTCATATTATTCCTCATGTTGG - Intronic
1200211189 X:154347241-154347263 GCTACTTTTATTTCTCACTGGGG - Intergenic
1200516059 Y:4144680-4144702 GCTCCAGATAATCCTCAGTGAGG - Intergenic