ID: 1128213138

View in Genome Browser
Species Human (GRCh38)
Location 15:65916194-65916216
Sequence GCCACTGATGTGGTCACAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128213133_1128213138 7 Left 1128213133 15:65916164-65916186 CCCGGTGAAGCCTGTGCGGCAGG 0: 1
1: 0
2: 2
3: 16
4: 207
Right 1128213138 15:65916194-65916216 GCCACTGATGTGGTCACAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 178
1128213135_1128213138 6 Left 1128213135 15:65916165-65916187 CCGGTGAAGCCTGTGCGGCAGGT 0: 1
1: 0
2: 0
3: 20
4: 121
Right 1128213138 15:65916194-65916216 GCCACTGATGTGGTCACAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 178
1128213136_1128213138 -3 Left 1128213136 15:65916174-65916196 CCTGTGCGGCAGGTGCACTTGCC 0: 1
1: 0
2: 1
3: 15
4: 146
Right 1128213138 15:65916194-65916216 GCCACTGATGTGGTCACAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128213138 Original CRISPR GCCACTGATGTGGTCACAGC TGG Exonic
900392308 1:2438974-2438996 GCCACCCATGTGGCCAGAGCTGG - Intronic
900557883 1:3289201-3289223 GCCCCTGATAAGGTCACAGGTGG + Intronic
900598729 1:3494042-3494064 GCCACTGATGGGGTCGCAGGGGG + Exonic
900902784 1:5528117-5528139 GCCACTGCTGTGGTGCCCGCCGG - Intergenic
901172161 1:7266971-7266993 GCCACTGATGGGATCGTAGCAGG + Intronic
902369118 1:15994309-15994331 GCCACTGCTGGAGCCACAGCAGG + Intergenic
902788187 1:18746352-18746374 GCCACTGGTGTGGTCAAGGAAGG - Intronic
907420265 1:54342429-54342451 CCCACTGCTCTGGTCACTGCTGG - Intronic
913153428 1:116068612-116068634 GCCAATGTTCTGGGCACAGCAGG - Exonic
913344179 1:117791591-117791613 GCCACTGATGTAGTCCCAGTAGG - Intergenic
913554425 1:119950755-119950777 GCCACTTATGTCATCAAAGCAGG + Exonic
915709932 1:157885690-157885712 GCCGGTCATGTGGTCATAGCTGG - Intronic
916231037 1:162541625-162541647 GCCACTGATGCTGCAACAGCCGG + Intergenic
918844679 1:189594322-189594344 GGAACTGATGTGGTCTCAGACGG + Intergenic
920207095 1:204300110-204300132 TCCAATGATGTGTTAACAGCAGG + Intronic
920357086 1:205381853-205381875 GCCACTGATGTTTTCACAGGTGG - Exonic
921528351 1:216246640-216246662 GCCACTGATTGGGTCACAAATGG + Exonic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
1063460930 10:6214721-6214743 GGCACTGAGCTGGGCACAGCGGG - Intronic
1064034243 10:11902374-11902396 CCCAGCGATGTGGTCACTGCAGG - Intergenic
1065106184 10:22388498-22388520 GCTACTGGAGTGGTCACAGTAGG - Intronic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1067165712 10:43864890-43864912 GCCCCTGCTGTGGGCACATCTGG - Intergenic
1069248910 10:66244483-66244505 TCCAGTGATGTGGCCACAGTGGG + Intronic
1069410753 10:68150992-68151014 GGCACTTTTGTTGTCACAGCTGG + Intronic
1069716760 10:70526123-70526145 GCCACTCACGTGATCACAACAGG - Exonic
1071845674 10:89518796-89518818 GCCACAGTTTTGGTCACTGCTGG + Intronic
1073454889 10:103630404-103630426 ACCACAGATGTGGGCACATCTGG + Intronic
1073918216 10:108430416-108430438 GCTGGTCATGTGGTCACAGCTGG + Intergenic
1074116430 10:110460380-110460402 CACACTGACCTGGTCACAGCTGG + Intergenic
1077000614 11:320419-320441 GCCACTGACGTGGGCACACACGG + Intronic
1078506087 11:11947160-11947182 GCCACTCATGAGGACACATCTGG - Intronic
1078859505 11:15234223-15234245 GCCCCTGATGGGGTCTGAGCTGG + Intronic
1082100546 11:48169636-48169658 GGCAGTGATGTGGGCAGAGCAGG - Intronic
1088143333 11:106645017-106645039 ACAACTGAATTGGTCACAGCTGG - Intergenic
1090834335 11:130443084-130443106 GCCACAGAGGTGGGCAAAGCAGG - Intergenic
1093678410 12:21971235-21971257 GACACTGAAGTGGTTAGAGCAGG - Intergenic
1097437556 12:59570254-59570276 GCCAGTCACGTGGTCATAGCTGG + Intergenic
1098652625 12:72992251-72992273 GCTACTGTTGTGGTAGCAGCAGG + Intergenic
1100413601 12:94348555-94348577 GCCACTGAGGTGGTCATTGCCGG - Intronic
1102957137 12:117066094-117066116 GCCACTGAGGAGGCCACATCTGG - Intronic
1103590700 12:121990227-121990249 GCCAGGGATGGGGTCAGAGCTGG - Intronic
1104137483 12:125954218-125954240 GACACTGATGTGGTCCCTGGTGG + Intergenic
1106118597 13:26838569-26838591 CCCACTGAGGGTGTCACAGCTGG - Intergenic
1106397246 13:29393106-29393128 GTCACTGCTTTGCTCACAGCTGG - Intronic
1107875684 13:44788909-44788931 GGCACTGATGTGGTCTGGGCCGG - Intergenic
1114958249 14:27849695-27849717 GGCACTGATGTGATGCCAGCAGG - Intergenic
1117729711 14:58710245-58710267 GTGACTGGTGTGGGCACAGCTGG + Intergenic
1119084857 14:71730369-71730391 GCCACTCATGTGCTCAGAGAGGG + Intronic
1122104471 14:99441731-99441753 GCCCCTGATGAGGCCACAGCAGG + Intronic
1122292701 14:100688167-100688189 GCCACTGCCCTGCTCACAGCTGG + Intergenic
1122823120 14:104356923-104356945 GCCAGTGGTGTGGTCTCACCTGG + Intergenic
1122937648 14:104967378-104967400 GCCCCTGAGCTGGGCACAGCCGG + Intronic
1124786687 15:32688232-32688254 GCCATTGGTGTGGTCACCACTGG - Intronic
1128213138 15:65916194-65916216 GCCACTGATGTGGTCACAGCTGG + Exonic
1131512758 15:93058416-93058438 GGCACTGATGTGAGCAAAGCCGG + Intronic
1132747131 16:1441502-1441524 GCCCCTGCTGAGGCCACAGCAGG + Intronic
1132793101 16:1704639-1704661 GTCACTGATGTGGTTTCATCAGG + Intergenic
1133306561 16:4813292-4813314 GCCATTGACATGGTCACATCTGG - Intronic
1136612312 16:31373576-31373598 GCCACTAATGTGGAGACAGAGGG + Intronic
1138834528 16:60417647-60417669 GCCACTGAGCTGATCATAGCTGG + Intergenic
1141033384 16:80608559-80608581 GCCAATGATGTCATCACGGCTGG - Intronic
1141634983 16:85309851-85309873 GCAGCTGATGTGGTTACAGCTGG + Intergenic
1141635319 16:85311226-85311248 GGCACTGATGTGGGCACAAAGGG + Intergenic
1142160152 16:88553172-88553194 GCCACAGAGGTGGTGCCAGCCGG + Intergenic
1142577001 17:915856-915878 GCCACTTATGGTGTCAGAGCTGG + Intronic
1143729640 17:8873921-8873943 GACATGGCTGTGGTCACAGCAGG - Intergenic
1144673699 17:17147405-17147427 GCCTCTGCTGTGGAGACAGCTGG + Intronic
1145311038 17:21701191-21701213 GCCACTGATGTGCCCACCCCCGG - Intronic
1147537327 17:41329086-41329108 GCCACTGCTGCAGCCACAGCAGG + Intergenic
1148067083 17:44879605-44879627 TTCTCTGATGAGGTCACAGCTGG - Exonic
1148137735 17:45305792-45305814 GGAACAGATGTGGTCAAAGCAGG + Intronic
1148467374 17:47872994-47873016 GCCAGTTGTGTGGCCACAGCTGG - Intergenic
1155017191 18:21855699-21855721 ACCACTGATGTGGACAAAGTAGG - Intronic
1157126298 18:44959681-44959703 GCCACTGCTGTGTTCTCAGTGGG + Intronic
1166209921 19:41299874-41299896 GCCATTGATGTGGTCATCACTGG - Intronic
1167301089 19:48678083-48678105 GCCAGTGGTCTGATCACAGCTGG - Intergenic
1168291856 19:55361037-55361059 GCCCCTCATCTGGTCGCAGCTGG - Exonic
925808368 2:7674447-7674469 GCCACTGAAGAGCTTACAGCAGG - Intergenic
925906415 2:8542412-8542434 GCCACTGAGGGGGTTTCAGCCGG - Intergenic
926476510 2:13329221-13329243 GCCACTGCTGTGCTCTCAGAAGG + Intergenic
927057367 2:19378083-19378105 GCCCCAGATGTGGCCACATCAGG - Intergenic
927108223 2:19845532-19845554 GGCACAGATGTGGTCACACATGG + Intergenic
927485858 2:23488005-23488027 GCCAGTGATGTGGTCAGGACTGG + Intronic
930025850 2:47028752-47028774 GCCTCTAATGTGGGCACAGTGGG - Intronic
931564866 2:63605350-63605372 GTCCCTGACGTGGTCACAGATGG - Exonic
934094096 2:88582522-88582544 ACCTGTCATGTGGTCACAGCTGG - Intronic
935594186 2:104867042-104867064 GCGACTGCGGTGGGCACAGCAGG - Intergenic
937914053 2:127090288-127090310 GCTCCTCATGTGGCCACAGCGGG - Intronic
938190251 2:129273435-129273457 GCCAGTGATAAGGTCAGAGCTGG + Intergenic
938190736 2:129277859-129277881 GGCAAAGATGTGGTCTCAGCTGG - Intergenic
938692052 2:133800643-133800665 GCCACAGCTGGGGACACAGCAGG + Intergenic
943860090 2:192850428-192850450 GCCATTCATGTGGTCACTGGAGG - Intergenic
945195810 2:207236696-207236718 GGCACTGATGTGGTCACTAAGGG - Intergenic
946440966 2:219695467-219695489 GCAGCTGATGTGATGACAGCTGG + Intergenic
946471479 2:219964817-219964839 GCCACTGCTTTGGTGCCAGCAGG - Intergenic
948698328 2:239745366-239745388 GCCACAGCAGTGGTAACAGCAGG + Intergenic
1169155387 20:3325247-3325269 TCCACTGCTGTCATCACAGCTGG - Intronic
1169340911 20:4795589-4795611 ATCACTGATGAGGTCACAGGAGG - Intronic
1170949340 20:20921844-20921866 GCCACTGCCCAGGTCACAGCAGG - Intergenic
1171480936 20:25455154-25455176 GCCTCTGCTGGGGACACAGCTGG + Intronic
1174201800 20:48811435-48811457 GCCACAGATGTGATGAAAGCAGG - Intronic
1175050613 20:56152092-56152114 GCCACTGCTCTTGTCACAGCTGG + Intergenic
1175404554 20:58717841-58717863 GCCCCGGTTCTGGTCACAGCTGG + Intronic
1178420213 21:32437337-32437359 CCCACTGCTGTGGTCTCAGTTGG + Intronic
1179238595 21:39568679-39568701 GCCACTGAAGTGGAGAGAGCAGG - Intronic
1179602843 21:42492164-42492186 ATCACTAATGTGGTCACACCAGG + Intronic
1179627694 21:42657889-42657911 GCCACCGATGTGTTCAGACCTGG - Intronic
1179926511 21:44538051-44538073 GCCACGGCTGTGGTCAGAACAGG - Intronic
1182597749 22:31435244-31435266 GCAACTGGTGTGATCAAAGCAGG + Intronic
1182658338 22:31907096-31907118 GTCAATGAAGTGGTCACAGATGG + Intergenic
1184032680 22:41904218-41904240 GCCGCTGATGGGCTCTCAGCAGG - Intronic
1184050638 22:42001523-42001545 GCAGCTGATGTGGGCAAAGCTGG - Intronic
1184177684 22:42798451-42798473 GCCACTCATATCGTCACAGATGG + Intronic
1184449058 22:44572159-44572181 GCCACTGCTGTGGTTCCAGCCGG - Intergenic
1184735547 22:46395626-46395648 CCCACTCATGGGGTCACAGCCGG + Intronic
950432753 3:12960418-12960440 GCCACTGGAGTGCGCACAGCTGG + Intronic
952032269 3:29157980-29158002 TCCACAGATGTTGTCACAGAAGG - Intergenic
952207940 3:31199109-31199131 GCCACTGTGGTGGTCACTGGAGG - Intergenic
952621045 3:35342921-35342943 AACAATGATGTGGTCTCAGCTGG - Intergenic
952795827 3:37238276-37238298 ACCACTGATGGGGTTGCAGCAGG + Intergenic
953063128 3:39444275-39444297 GCCACTGAAATGGGCACATCGGG - Intergenic
955418357 3:58713852-58713874 ACCAGTCATGTGGTCATAGCTGG + Intergenic
956368539 3:68532953-68532975 GCCAATGATGAGGACACACCTGG + Intronic
956379844 3:68654023-68654045 GCCAGTGCTGTGGCCAGAGCTGG - Intergenic
957309560 3:78502220-78502242 GCCACTGAAATGGTCATAGAAGG - Intergenic
961144545 3:124583378-124583400 CCCACTGATGTGGTCCAAGTGGG + Intronic
961883791 3:130082169-130082191 CCCACTGCTGTGGTCTCAGTTGG - Intronic
968452166 4:680884-680906 GCCGCTGATGGGGACAGAGCCGG - Intronic
968975848 4:3821724-3821746 GGCACTGATGTGGTCTCAGCAGG + Intergenic
969297623 4:6279110-6279132 GTCACTGATGTGGCCAAAGCAGG + Intronic
969820983 4:9720134-9720156 CCCACTGCTGTGGTCTCAGGTGG + Intergenic
970149952 4:13079154-13079176 GCCACTACTGTGGGCAGAGCTGG - Intergenic
977592092 4:98838456-98838478 GCCACTGAGCTGGTCATTGCTGG - Intergenic
978680573 4:111376850-111376872 GCCACTGATGTGATAAGAGGTGG + Intergenic
978878017 4:113665528-113665550 GCCACTGTAGTTGTCAGAGCTGG - Intronic
979809307 4:125015350-125015372 GCCACTGAGCTGGTCATTGCTGG + Intergenic
981273227 4:142868318-142868340 TCCACTGCTGTCTTCACAGCCGG - Intergenic
981477582 4:145202997-145203019 GCCTCTGATGTTTTCAAAGCAGG + Intergenic
982436296 4:155385278-155385300 GCCACTGCTATAGCCACAGCAGG + Intergenic
983785228 4:171721627-171721649 GCCGGTCATGTGGTCATAGCTGG + Intergenic
996804860 5:127443058-127443080 CCCAGTGATGTGGTCGCAGGTGG - Exonic
996903907 5:128575941-128575963 CCCAATGATGTGGTCAATGCAGG + Intronic
998130094 5:139647497-139647519 GCCACTGATGGAGTGAAAGCGGG + Intronic
1002174586 5:177394340-177394362 GCCACTGAGGTACTGACAGCTGG + Intronic
1005349234 6:24918053-24918075 GCCACTGACGTGGTCCCTACAGG - Intronic
1005388730 6:25311885-25311907 GCCACTGATTTTGTCTCAGGAGG + Intronic
1007696651 6:43737939-43737961 GGAGCTGATGTGGCCACAGCTGG + Intergenic
1010486355 6:76419065-76419087 GCTTCAGATGTGGTCACTGCTGG + Intergenic
1011370369 6:86630817-86630839 GTCACTGATTGGGTCACAGAAGG + Intergenic
1012842469 6:104346579-104346601 GCCACTGAGCTGGTCATTGCAGG - Intergenic
1012850836 6:104444717-104444739 GTCTCTGATGTGGTTACTGCAGG - Intergenic
1012987351 6:105888781-105888803 TCCACTGACGTGGTTGCAGCTGG + Intergenic
1017759899 6:157560243-157560265 GCAACTGATGTGGCAACAGTCGG - Intronic
1018747009 6:166770105-166770127 GCCTCTGCAGCGGTCACAGCAGG - Intronic
1020134713 7:5580769-5580791 CTCACTGATGTGGTCACTACAGG - Intergenic
1020317770 7:6918705-6918727 CCCACTGCTGTGGTCTCAGCTGG - Intergenic
1020423422 7:8035947-8035969 GCCCCTGATGGGGACAAAGCTGG - Intronic
1021877819 7:25064856-25064878 GCCACTGGAGTGTTCCCAGCAGG + Intergenic
1023149171 7:37183612-37183634 AGCACAGATGTGCTCACAGCAGG + Intronic
1025950537 7:66141914-66141936 AGCACTGCTGTGGTCACAGCAGG - Intronic
1026281746 7:68928375-68928397 GCCAAAGATGTGGTCAGTGCAGG - Intergenic
1026387373 7:69863706-69863728 TCCACTGCTGTAGCCACAGCTGG + Intronic
1028238309 7:88387559-88387581 GCCAATGATTTGCTCTCAGCTGG + Intergenic
1029539000 7:101172159-101172181 GCCCCAGCTGTGGTCACAGCTGG - Exonic
1034292653 7:149945183-149945205 GGCACTGATGTGGTCCCAACTGG + Intergenic
1034813417 7:154151709-154151731 GGCACTGATGTGGTCCCAACTGG - Intronic
1039510080 8:38084864-38084886 GCCTCTGGTGTGGTCGTAGCAGG + Intergenic
1039742549 8:40395890-40395912 GCCTATGATGTGATCACAGATGG + Intergenic
1041319497 8:56598762-56598784 GCCACAGACGTGGTCATAGGAGG - Intergenic
1047659775 8:127020450-127020472 GCCACTGAGCTGGTCATTGCTGG - Intergenic
1047878596 8:129168287-129168309 GCCACAGATAAGCTCACAGCTGG - Intergenic
1048203409 8:132395929-132395951 GCCCTGGCTGTGGTCACAGCCGG + Intronic
1048242793 8:132760681-132760703 GCCACTGATGTGAGCCCAACAGG - Intronic
1051104910 9:13568631-13568653 GTCACTGATGAAGTCACTGCTGG + Intergenic
1051250032 9:15150327-15150349 GCCTCTGAGGGGGTGACAGCTGG + Intergenic
1053678783 9:40465216-40465238 GGCACTGATGTGATGCCAGCAGG - Intergenic
1053845419 9:42231521-42231543 GCCCATGATGGGGGCACAGCAGG - Intergenic
1053928768 9:43093569-43093591 GGCACTGATGTGATGCCAGCAGG - Intergenic
1054284940 9:63159726-63159748 GGCACTGATGTGATGCCAGCAGG + Intergenic
1054291861 9:63300754-63300776 GGCACTGATGTGATGCCAGCAGG - Intergenic
1054389879 9:64605297-64605319 GGCACTGATGTGATGCCAGCAGG - Intergenic
1054505835 9:65911079-65911101 GGCACTGATGTGATGCCAGCAGG + Intergenic
1054832768 9:69644802-69644824 GCCACTGATGGTTTCTCAGCAGG + Intronic
1057422744 9:94925673-94925695 GACACTGATGTGCACACTGCTGG - Intronic
1057818975 9:98316735-98316757 GACAATGATGTGCTCACTGCTGG + Intronic
1189496418 X:41513008-41513030 GCCACTTTTGAGGTCCCAGCAGG + Intergenic
1190311917 X:49122773-49122795 CACACTGATGTGGACACAGAGGG + Exonic
1190343240 X:49313849-49313871 GCCTCTGGTGTGGTCAGAGCAGG - Intronic
1191818098 X:65271172-65271194 ACCACTGATGTGGTCATCTCCGG - Intergenic
1194676577 X:96801627-96801649 GGCACTGAAGTGGTAACAGGAGG - Intronic
1196867399 X:120082805-120082827 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic
1196875700 X:120153477-120153499 GCCTCCGGTGTGGTCAGAGCAGG - Intergenic
1197705348 X:129630776-129630798 GTCACTGATCTGGACCCAGCAGG - Intergenic
1201694174 Y:16806590-16806612 GCCACTGATGTGATAAGAGGCGG - Intergenic
1202051952 Y:20790811-20790833 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic
1202071318 Y:20994411-20994433 GCCTCTGATGTGGCCCTAGCAGG - Intergenic