ID: 1128213590

View in Genome Browser
Species Human (GRCh38)
Location 15:65918671-65918693
Sequence GAGGGCCTTGTGAACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 334}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128213590_1128213598 14 Left 1128213590 15:65918671-65918693 CCTCCTGAGTTCACAAGGCCCTC 0: 1
1: 0
2: 1
3: 21
4: 334
Right 1128213598 15:65918708-65918730 TTCCAATTTGAGTCACTTGGAGG 0: 1
1: 0
2: 1
3: 15
4: 166
1128213590_1128213597 11 Left 1128213590 15:65918671-65918693 CCTCCTGAGTTCACAAGGCCCTC 0: 1
1: 0
2: 1
3: 21
4: 334
Right 1128213597 15:65918705-65918727 TATTTCCAATTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 20
4: 202
1128213590_1128213600 21 Left 1128213590 15:65918671-65918693 CCTCCTGAGTTCACAAGGCCCTC 0: 1
1: 0
2: 1
3: 21
4: 334
Right 1128213600 15:65918715-65918737 TTGAGTCACTTGGAGGATTTTGG 0: 1
1: 0
2: 0
3: 20
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128213590 Original CRISPR GAGGGCCTTGTGAACTCAGG AGG (reversed) Intronic
901892814 1:12282518-12282540 GAGGGCCTTGTGAACAGAAGTGG + Intronic
902399957 1:16152314-16152336 GAGGGCCATGTCACTTCAGGAGG - Intronic
903516927 1:23917339-23917361 GAGGGTCATGTGAGCCCAGGAGG + Intergenic
904131637 1:28280060-28280082 GAGGATCATTTGAACTCAGGAGG - Intronic
904149302 1:28424279-28424301 GAGGGTCACTTGAACTCAGGAGG - Intronic
904245547 1:29185336-29185358 GAGAACCGTGTGAACCCAGGAGG - Intergenic
904339347 1:29824119-29824141 GATGGCCTGGAGAACTCAGGAGG - Intergenic
904420061 1:30385512-30385534 GTGCCCATTGTGAACTCAGGGGG - Intergenic
904421779 1:30398761-30398783 GAGGGCGTTCTGAAGACAGGAGG - Intergenic
905162433 1:36048192-36048214 GAGGATCATGTGAGCTCAGGAGG + Intronic
905676430 1:39828782-39828804 GGGGAGCTGGTGAACTCAGGTGG - Intergenic
906349317 1:45044098-45044120 GAGGACCACTTGAACTCAGGAGG + Intronic
907371813 1:54008637-54008659 GAGGACTGTGTGAACCCAGGAGG - Intronic
908514767 1:64881170-64881192 GAGGACCTTTTGAGCCCAGGAGG + Intronic
911973357 1:104463726-104463748 AAAGGCCTGTTGAACTCAGGGGG - Intergenic
912208612 1:107534714-107534736 CAGGGCCTGGTCAACTCAGGAGG - Intergenic
912364627 1:109122865-109122887 GAGGACCATTTGAACCCAGGAGG + Intronic
913122027 1:115751334-115751356 AAGGGCCTTGTGATTTAAGGAGG + Intronic
914692572 1:150044026-150044048 GAGGACCTCTTGAACCCAGGAGG + Intergenic
914918966 1:151834828-151834850 GAGGACCTCTTGAACCCAGGAGG - Intergenic
916677578 1:167076636-167076658 GAGGGCCATGTGAGCTCCTGGGG + Intronic
919770546 1:201155423-201155445 GCAGGCCCTGTGAACTGAGGTGG + Intronic
922017004 1:221658276-221658298 GAGGGTCACTTGAACTCAGGAGG + Intergenic
922718227 1:227887686-227887708 GAGGGCCTTGCGCACCCAGGTGG + Intergenic
922882084 1:228988791-228988813 GAGGGCCTGGTGACCTCGGCTGG + Intergenic
923343123 1:233024333-233024355 GAGGGCCTTGTGGCCTCCGACGG + Intronic
924114805 1:240734721-240734743 GTGGGCTTTGGGAACTCAGGAGG - Intergenic
924434131 1:244023579-244023601 GAGGGGCTTGTAAAATCAAGAGG + Intergenic
1063581802 10:7314816-7314838 GAGAACCTTTTGAACTCAAGAGG + Intronic
1064077670 10:12282669-12282691 GTGGACTTTGGGAACTCAGGGGG - Intergenic
1064151894 10:12872272-12872294 GAGGGCCTGGTGACAGCAGGGGG + Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1065576585 10:27126337-27126359 GAGGGCCGCCTGAACTCGGGAGG + Intronic
1065658326 10:27977475-27977497 GAGAACGTTGTGAACCCAGGAGG + Intronic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1067134672 10:43597367-43597389 GAGGGTCTCTTGAGCTCAGGAGG - Intergenic
1067922652 10:50476182-50476204 GAGAGTCATTTGAACTCAGGAGG + Intronic
1068624762 10:59230671-59230693 GATGCCCTGGTGACCTCAGGAGG + Intronic
1068890738 10:62146242-62146264 GAAGGCCTGATGAACTGAGGTGG - Intergenic
1069723905 10:70565627-70565649 GTGGGCCTTGGGACGTCAGGTGG + Intronic
1069793148 10:71036164-71036186 GAGGGCCCTATGATGTCAGGTGG - Intergenic
1069927961 10:71864343-71864365 GAGGATCATGTGAACCCAGGAGG - Intergenic
1070697130 10:78571801-78571823 GAGTGCCCTGTGTCCTCAGGTGG - Intergenic
1072062971 10:91835377-91835399 GAGAACCATGTGAACCCAGGAGG - Intronic
1072736873 10:97885132-97885154 CAGGGCCTTGTCTAGTCAGGTGG + Intronic
1072886989 10:99285833-99285855 GAGGATCATGTGAACCCAGGAGG + Intergenic
1073535000 10:104268802-104268824 GAGGCCTTTGTGAAGTCAGTCGG - Intergenic
1073631876 10:105157365-105157387 AAGGGTCTTAGGAACTCAGGTGG + Intronic
1075781017 10:125017178-125017200 GAGGCCCTGGTGAAATCAGAAGG + Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1080392507 11:31861284-31861306 ATGGGGCTGGTGAACTCAGGAGG + Intronic
1081417284 11:42831259-42831281 GAGGATCCTGTGAACCCAGGAGG - Intergenic
1081666643 11:44920591-44920613 AAGGGCATTGTGAACTCATAAGG - Intronic
1082546986 11:54344146-54344168 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082547143 11:54346193-54346215 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082547294 11:54348241-54348263 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082547449 11:54350288-54350310 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082547758 11:54354380-54354402 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082547918 11:54356428-54356450 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082548228 11:54360522-54360544 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082548385 11:54362569-54362591 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082548541 11:54364615-54364637 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082548703 11:54366663-54366685 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082548858 11:54368711-54368733 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082548936 11:54369736-54369758 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082549248 11:54373829-54373851 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082549401 11:54375878-54375900 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082549547 11:54377924-54377946 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082549849 11:54382021-54382043 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082549995 11:54384067-54384089 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082550607 11:54392257-54392279 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082550765 11:54394305-54394327 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082551064 11:54398401-54398423 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082551215 11:54400449-54400471 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082551374 11:54402497-54402519 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082551531 11:54404546-54404568 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082551675 11:54406593-54406615 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082551835 11:54408640-54408662 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082551994 11:54410688-54410710 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082552155 11:54412737-54412759 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082552307 11:54414782-54414804 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082552455 11:54416830-54416852 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082552608 11:54418874-54418896 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082552762 11:54420923-54420945 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082552922 11:54422971-54422993 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082553074 11:54425018-54425040 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082553269 11:54527635-54527657 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082553425 11:54529683-54529705 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082553580 11:54531730-54531752 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082553733 11:54533777-54533799 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082553890 11:54535822-54535844 GAGGGCTTTGTGGACTGTGGTGG + Intergenic
1082646752 11:55735578-55735600 TTGGGCCTTGTGAACCCTGGAGG - Intergenic
1084162063 11:67355417-67355439 CAGGGCTTGGTGGACTCAGGAGG - Intronic
1084227710 11:67727647-67727669 AAGGGCCTATTGAACTCCGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084309704 11:68309792-68309814 GAGGGCCTCTTGGACTCAAGTGG - Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085805220 11:79629710-79629732 GAGGCTTTTGTGATCTCAGGAGG + Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1091097638 11:132839233-132839255 AACGGCCTTGGGAAATCAGGTGG + Intronic
1091105287 11:132913581-132913603 GTCGGCCTTGTGAAATGAGGAGG - Intronic
1091458053 12:622845-622867 GGGGTCCATGTGAACTCAGGAGG - Intronic
1091491022 12:932682-932704 GGGAGTCTTGTGAACTCTGGAGG - Intronic
1091715875 12:2775757-2775779 GAGGGCCATGTGAAATCATAAGG - Intergenic
1091766136 12:3120945-3120967 TTGGGCCTTCAGAACTCAGGTGG + Intronic
1091921729 12:4310113-4310135 AAGGGCCTTGTCATCTAAGGAGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092717615 12:11407368-11407390 GTGGACTTTGGGAACTCAGGGGG - Intronic
1095535439 12:43240526-43240548 GAGGTCCTTGAGAACACAGAGGG - Intergenic
1095754393 12:45747551-45747573 GAGCTTCTTATGAACTCAGGTGG + Intronic
1095870196 12:47018384-47018406 GAGCACCTTGTGAACAGAGGTGG - Intergenic
1096410277 12:51372296-51372318 GAGGGTCACCTGAACTCAGGAGG - Intronic
1099201350 12:79681023-79681045 GAGGATCTCTTGAACTCAGGAGG + Intronic
1099324956 12:81203106-81203128 CAGAGGCTTGAGAACTCAGGGGG + Intronic
1100616929 12:96238002-96238024 GTGGGTGTTGTGAACTCAGCTGG + Intronic
1102371187 12:112383194-112383216 GAGGATCTCTTGAACTCAGGAGG + Intergenic
1103794505 12:123494094-123494116 GAGGGCTTGGTGAAGTCAAGAGG - Intronic
1103937766 12:124485643-124485665 GCGGGGCTGGTGAACTCAGGTGG - Intronic
1104126663 12:125853268-125853290 GAGGGTTGTCTGAACTCAGGCGG + Intergenic
1105869422 13:24491029-24491051 GAGGATCTATTGAACTCAGGAGG - Intronic
1106213480 13:27673087-27673109 GTGGACTTTGGGAACTCAGGGGG + Intergenic
1107346243 13:39464063-39464085 GAGGGCATTGTAAACTAAGGAGG + Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1110430857 13:75421355-75421377 GGGGACTTTGTGAACTCAGCTGG + Intronic
1111972714 13:94933794-94933816 GAGTGCCTCCTGAACTCAAGAGG - Intergenic
1113159468 13:107363507-107363529 GAGGACTGTGTGAACCCAGGAGG + Intronic
1115353774 14:32425498-32425520 GAGGATCATGTGAACCCAGGAGG + Intronic
1118397172 14:65347644-65347666 GAGGATCATGTGAGCTCAGGAGG - Intergenic
1118489794 14:66247869-66247891 GAAGGCAGTGTGAAATCAGGGGG - Intergenic
1119318820 14:73717601-73717623 TAGGGCCTTGGGAATTTAGGGGG + Exonic
1123588279 15:21778012-21778034 GAGAGTGTTGTGAACCCAGGAGG - Intergenic
1123624918 15:22220575-22220597 GAGAGTGTTGTGAACCCAGGAGG - Intergenic
1123932320 15:25177841-25177863 GCGGGCCTTCCCAACTCAGGAGG - Intergenic
1123941278 15:25217763-25217785 GCGGGCCTTCCCAACTCAGGAGG - Intergenic
1125709075 15:41769190-41769212 GAGAGTCTTGGGAAATCAGGAGG - Exonic
1126845149 15:52752799-52752821 GAGGGACAGGTGAAGTCAGGTGG + Intergenic
1127985241 15:64064725-64064747 GAGGGTCACTTGAACTCAGGAGG - Intronic
1128213590 15:65918671-65918693 GAGGGCCTTGTGAACTCAGGAGG - Intronic
1128716281 15:69910561-69910583 AAGAGCCATGTGACCTCAGGAGG - Intergenic
1132063916 15:98714963-98714985 GAGGGGCTTGTGGACCCTGGAGG + Intronic
1133456528 16:5947124-5947146 GAGGATCATGTGAACTCAGGAGG + Intergenic
1134258341 16:12630127-12630149 GAGTACGGTGTGAACTCAGGAGG + Intergenic
1134415049 16:14035889-14035911 GTGGGCCTTGGGGACTCAGAGGG - Intergenic
1135414430 16:22257931-22257953 GAGGGCTTTGTGCACTGAGCTGG - Intronic
1135818403 16:25656996-25657018 GATGGCTTTTTGAACTGAGGTGG + Intergenic
1135829761 16:25762785-25762807 GAGGATCCTTTGAACTCAGGAGG + Intronic
1137082567 16:36079650-36079672 GAGGGCTTTGAGAACTATGGTGG + Intergenic
1138665600 16:58565200-58565222 GAGGATCATCTGAACTCAGGAGG - Intronic
1139614840 16:68082695-68082717 GAGAGCCCTGTGAAACCAGGAGG - Intergenic
1139730358 16:68938980-68939002 GAGGGTCTTTTGAGCCCAGGAGG + Intronic
1140072918 16:71668324-71668346 GAGGATGGTGTGAACTCAGGAGG + Intronic
1140555432 16:75915984-75916006 GAGGGCCTTTTGGACTTAGGAGG + Intergenic
1142129470 16:88426117-88426139 GAGGGTCCTGTGACCTCAGGAGG + Intergenic
1143273304 17:5691462-5691484 GAGGATCTTTTGAGCTCAGGGGG + Intergenic
1143457933 17:7079796-7079818 GAGAATCTTGTGAACCCAGGAGG - Intronic
1144812864 17:18011910-18011932 GAGGATCATGTGAACCCAGGTGG - Intronic
1146139423 17:30352424-30352446 GAGGGTCATTTGAACCCAGGAGG - Intergenic
1146323276 17:31863790-31863812 GAGGGTCACTTGAACTCAGGAGG - Intronic
1146372674 17:32275298-32275320 GAGGCCCTTGGGTACCCAGGAGG - Intronic
1147017751 17:37506173-37506195 GAGGGTCATTTGAACCCAGGAGG + Intronic
1148144039 17:45349780-45349802 ATGGACCTTGGGAACTCAGGAGG + Intergenic
1148246232 17:46032532-46032554 AAGTGCCTAGTGAATTCAGGAGG + Intronic
1149121922 17:53179557-53179579 GTGGGCTTTGGGGACTCAGGAGG - Intergenic
1149439364 17:56662167-56662189 CAGGGCCTTGTGGACACAGCCGG - Intergenic
1149776270 17:59359987-59360009 GAGAGTCTCTTGAACTCAGGAGG - Intronic
1150294708 17:64001595-64001617 GAGGGCCCTGTGCCCTCTGGTGG + Intronic
1152196713 17:78922844-78922866 GAAGGCCATGTGAAGACAGGCGG + Intronic
1154134114 18:11761092-11761114 GGGGGCCGTGTGGACTGAGGTGG - Intronic
1154169451 18:12039805-12039827 GAGAGCCTCTTGAACCCAGGAGG + Intergenic
1155730167 18:29147234-29147256 GAGGATCTCTTGAACTCAGGAGG + Intergenic
1155806679 18:30178693-30178715 GAGGATCTTTTGACCTCAGGAGG + Intergenic
1156455103 18:37288655-37288677 GAGGCCCTGCTGAGCTCAGGAGG + Intronic
1159454395 18:68642315-68642337 GAGGGTCTTGGGAACTCAACAGG - Intergenic
1159687823 18:71445179-71445201 GAGGATCTTTTGAGCTCAGGAGG - Intergenic
1161587504 19:5113605-5113627 AAGGGGCTTGTGGACACAGGCGG + Intronic
1162109996 19:8394838-8394860 GAGGATCTCTTGAACTCAGGAGG + Intronic
1162349666 19:10140970-10140992 AAGCGCCTTGTTAACTCAGGCGG + Intronic
1162879580 19:13648191-13648213 GAGGATCTTTTGAACACAGGAGG + Intergenic
1163317078 19:16548120-16548142 GAGGGCCAGGTGCACTGAGGGGG + Intronic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1165162974 19:33828854-33828876 CAGGTACTTGGGAACTCAGGAGG + Intergenic
1166601910 19:44103778-44103800 GAGAATCATGTGAACTCAGGAGG - Intronic
925441424 2:3889841-3889863 GTGGGCTTTGGGGACTCAGGGGG - Intergenic
925729510 2:6908385-6908407 GTGGGCCTTGGGGACTCAGTAGG + Intergenic
930327121 2:49933925-49933947 AGAGGCCTTGTGAATTCAGGTGG + Intronic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
934062720 2:88310377-88310399 GAGGGTCTTTTGAGCCCAGGAGG + Intergenic
936901942 2:117491141-117491163 TGGGGCCTTGGGAACCCAGGAGG - Intergenic
937182666 2:120010652-120010674 GAGAATCTTTTGAACTCAGGAGG - Intergenic
937942344 2:127295733-127295755 GAGGATCTCTTGAACTCAGGAGG + Intergenic
939101027 2:137895069-137895091 GAGGATCGTTTGAACTCAGGAGG + Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941968942 2:171329073-171329095 GAGAGTCGTTTGAACTCAGGAGG - Intronic
944537203 2:200722900-200722922 GAGGCCCTTGTCAACCCAGTTGG - Intergenic
945631688 2:212286689-212286711 GAGGATTGTGTGAACTCAGGAGG - Intronic
946305236 2:218853153-218853175 CCGGGTCTTCTGAACTCAGGTGG - Intergenic
946973209 2:225118909-225118931 GAGAACCATTTGAACTCAGGAGG - Intergenic
947280186 2:228443422-228443444 GTGGGCTTTGGGAACTCAAGGGG - Intergenic
947593892 2:231399237-231399259 GAGGTCCTGGTGACCTCTGGAGG + Exonic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
948750909 2:240132420-240132442 GAGTGCTTTGTGAACTTAGTGGG + Intronic
948781772 2:240325857-240325879 GTGGCCCCTGTGAAGTCAGGGGG + Intergenic
1168914209 20:1473064-1473086 GAGGGCCTTCACAACGCAGGAGG - Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1172446202 20:34994702-34994724 AAGGGCCATGGGAACCCAGGTGG + Intronic
1175571971 20:60030275-60030297 GAGGCTCTGGAGAACTCAGGTGG - Intronic
1176321961 21:5336405-5336427 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1176479617 21:7268190-7268212 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1176758829 21:10752277-10752299 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1177284351 21:19029465-19029487 GAGGGCCTTGTAAATCCACGTGG - Intergenic
1177306512 21:19324971-19324993 GAGGGCCATCTGCACTCAGTTGG + Intergenic
1177920035 21:27141319-27141341 GAGAACCGTGTGAACCCAGGAGG - Intergenic
1178068473 21:28934093-28934115 GAGTGCCTTGTGATCTGAGTGGG - Intronic
1180397807 22:12372651-12372673 GAGGGCTTTGTGACCTATGGTGG - Intergenic
1180398323 22:12380195-12380217 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1180401943 22:12491994-12492016 GAGGGCTTTGTGACCTATGGTGG + Intergenic
1181299823 22:21871735-21871757 GAAGGTCTCTTGAACTCAGGAGG + Intergenic
1181308102 22:21928277-21928299 GAGGGCCTTGGGCATCCAGGAGG - Intronic
1181624916 22:24116733-24116755 GATGGCCTAGTGAACTCAGGGGG - Intronic
1182751807 22:32647534-32647556 GAGGGTCACTTGAACTCAGGAGG - Intronic
949130949 3:499761-499783 GAGGGCCTTGTGAACTCTCATGG + Intergenic
952254041 3:31680334-31680356 CCTGGGCTTGTGAACTCAGGGGG + Intronic
952988881 3:38813576-38813598 ATAGGCCTTGTGAACTCAGCTGG - Intergenic
956740541 3:72272338-72272360 GAGGACCTTGTCATCTCATGAGG - Intergenic
956819495 3:72940769-72940791 GAGGGTCCTCTGAGCTCAGGAGG - Intronic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
962355584 3:134691526-134691548 GAGGATCTTTTGAACCCAGGAGG + Intronic
967333408 3:188316186-188316208 GAGAACCATTTGAACTCAGGAGG + Intronic
969029337 4:4198746-4198768 GAGGGCCTTCTCATCACAGGAGG + Intronic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970589707 4:17548453-17548475 GAGAGTCATGTGAACCCAGGAGG + Intergenic
975976218 4:80099296-80099318 GAGGACCTCTTGAGCTCAGGAGG + Intronic
976628662 4:87214886-87214908 GAGGATCATGTGAACCCAGGAGG - Intronic
977879459 4:102187370-102187392 GAGAGTCTTTTGAACTCAGGAGG + Intergenic
979667021 4:123323383-123323405 GTGGACTTTGGGAACTCAGGAGG + Intergenic
979712175 4:123792499-123792521 GTGGACTTTGGGAACTCAGGGGG - Intergenic
980963348 4:139498187-139498209 TAGGGCCTTGTGGGCTCTGGAGG + Intronic
981696042 4:147559795-147559817 GAGGATCGTTTGAACTCAGGAGG - Intergenic
983176059 4:164589073-164589095 GAGGATCTTGTGAGCCCAGGAGG - Intergenic
986337508 5:6766480-6766502 GATGGGCTTGTGAACTGAGGCGG + Intergenic
992357630 5:76001961-76001983 GTGGACTTTGGGAACTCAGGGGG - Intergenic
993033852 5:82735345-82735367 GAGTGGCTTGTGACCACAGGAGG - Intergenic
993376162 5:87151087-87151109 GAGGATCATGTGAGCTCAGGGGG + Intergenic
997419760 5:133756628-133756650 GAGGGCCAGGTGCACTCAGTGGG - Intergenic
997977832 5:138450552-138450574 GAGAATCTCGTGAACTCAGGAGG - Intergenic
998529865 5:142874621-142874643 GAGTGGCTTGAGGACTCAGGAGG + Intronic
998554759 5:143112389-143112411 GAGGGCCTTGAGAGGTCAGCTGG + Intronic
999184839 5:149699407-149699429 GAGGATCATTTGAACTCAGGAGG + Intergenic
999740800 5:154549865-154549887 GAGGATCATTTGAACTCAGGAGG - Intergenic
999835276 5:155363762-155363784 CAGGGGCATGTTAACTCAGGTGG - Intergenic
1001567268 5:172707586-172707608 GAAGGCCTGCTGAACTCAGAGGG + Intergenic
1001915145 5:175554008-175554030 GAGGGTCTATTGAGCTCAGGAGG + Intergenic
1005525133 6:26639983-26640005 GATGTCCTTGTGAACAAAGGGGG - Intronic
1005718793 6:28580362-28580384 GAGGATCATTTGAACTCAGGAGG + Intronic
1006434540 6:34019401-34019423 TTGGGGCTTGTGAAGTCAGGAGG - Intronic
1006748413 6:36361309-36361331 GAGGGCAGTGTGAGCTCAGAGGG - Intronic
1008466981 6:51842261-51842283 GGGGGCTGTGTGAACTCGGGAGG + Intronic
1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG + Intronic
1012788829 6:103666293-103666315 GAGGGAATTGTGAACTGAGCAGG - Intergenic
1013092100 6:106909195-106909217 GAGGACCACTTGAACTCAGGAGG + Intergenic
1014112604 6:117636406-117636428 GAGGGCTGCGTTAACTCAGGAGG - Intergenic
1015636384 6:135279156-135279178 GAGAGTCATGTGAACCCAGGAGG - Intergenic
1016863473 6:148744947-148744969 GTGGGACTTGTGAACACAGAGGG + Intergenic
1017177903 6:151521894-151521916 GAGGACGGTGTGAACCCAGGAGG + Intronic
1018229483 6:161661931-161661953 GTGGGTCATTTGAACTCAGGAGG + Intronic
1019172427 6:170140596-170140618 GAAGGCCTTGTGATCACAGGAGG + Intergenic
1019401124 7:854566-854588 GAGGGCCTTGGGCTCTCACGTGG + Intronic
1019916523 7:4136617-4136639 GAGGGACGTCTGTACTCAGGGGG - Intronic
1020100627 7:5392371-5392393 GAGGATCTCTTGAACTCAGGAGG + Intronic
1020183071 7:5937166-5937188 GAGGAACGTGTGAGCTCAGGAGG + Intronic
1020299841 7:6787591-6787613 GAGGAACGTGTGAGCTCAGGAGG - Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1022103127 7:27180855-27180877 GAGGGCCTTGGGGCCTGAGGTGG - Intergenic
1022295003 7:29042513-29042535 GAGGGTCTTTTGAACCCAGGAGG + Intronic
1022954996 7:35372606-35372628 GAGGCCCTTGGTCACTCAGGAGG + Intergenic
1024448841 7:49515007-49515029 GAGGGCTTTATGACCTTAGGGGG - Intergenic
1024584036 7:50825533-50825555 GTGGGCCCTATGAAATCAGGTGG + Intergenic
1024831189 7:53459931-53459953 GAGGGTCATTTGATCTCAGGTGG + Intergenic
1025309331 7:57909526-57909548 GAGCGCCTTGAGACCTAAGGTGG - Intergenic
1026798670 7:73382945-73382967 GAGGACCTCTTGAACCCAGGAGG + Intergenic
1027184624 7:75963543-75963565 CAGGGCCCAGTGAAGTCAGGAGG - Intronic
1027992814 7:85384679-85384701 GATGGACTTGTGTATTCAGGTGG - Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1029546633 7:101213604-101213626 GAGAATCTTTTGAACTCAGGAGG - Intronic
1029978771 7:104858743-104858765 GAGGGGATTAAGAACTCAGGAGG - Intronic
1031707483 7:124999123-124999145 GAGGATCTTCTGAACCCAGGAGG - Intergenic
1032726390 7:134593284-134593306 GAGGGCATTCTGAATTAAGGTGG - Intergenic
1033081388 7:138301743-138301765 GAGGTTCTTTTGAGCTCAGGAGG - Intergenic
1034225643 7:149478521-149478543 GAGAGCCATGGCAACTCAGGAGG + Intronic
1034519443 7:151608058-151608080 GAGGGCCACGTGAAGACAGGTGG + Intronic
1034711241 7:153193215-153193237 GTGGGCCCTGTGAGCTCAGCAGG - Intergenic
1035671849 8:1424100-1424122 AAGGTCCTTGTGAACTAAAGCGG + Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1037611568 8:20480530-20480552 GAGGGCTTTATGGATTCAGGTGG + Intergenic
1038182964 8:25246195-25246217 GATGGCCTTGTGGAGCCAGGAGG - Intronic
1038211240 8:25520929-25520951 GAGAATCTCGTGAACTCAGGAGG + Intergenic
1038314597 8:26473040-26473062 GAGGGTCACTTGAACTCAGGAGG + Intronic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1040084758 8:43328030-43328052 GAGAGTCATGTGAACCCAGGAGG - Intergenic
1040290476 8:46121577-46121599 GAGGGCCTCCAGGACTCAGGGGG - Intergenic
1040293346 8:46136680-46136702 GAGGGCCTCAAGGACTCAGGGGG - Intergenic
1040301910 8:46192409-46192431 GTGGGCCTTAGAAACTCAGGGGG + Intergenic
1040302248 8:46194131-46194153 GAGGGCCGCAGGAACTCAGGAGG + Intergenic
1040314454 8:46253632-46253654 GCGGGTCATGTGTACTCAGGGGG + Intergenic
1040332186 8:46391323-46391345 GTGGGCCATGGGGACTCAGGGGG + Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1042153228 8:65812115-65812137 GAGGATCATTTGAACTCAGGAGG + Intronic
1042246900 8:66717113-66717135 GAGAACCTCTTGAACTCAGGAGG + Intronic
1042323455 8:67503384-67503406 GAGGACCTGTTGAACTCAGGAGG - Intronic
1043618993 8:82164549-82164571 GAGGGCTTTGTGAACACAGAGGG + Intergenic
1045150159 8:99397233-99397255 GAGAATCTTTTGAACTCAGGAGG - Intronic
1047878723 8:129169460-129169482 GAGGGCCTTGCAAAAACAGGGGG - Intergenic
1048741533 8:137566207-137566229 GAGGACCATTTGAAGTCAGGAGG - Intergenic
1051044674 9:12858479-12858501 TAGGGCCTAGAGAACTCAAGGGG - Intergenic
1051506584 9:17833747-17833769 GAAGGCATTGTTAACACAGGAGG - Intergenic
1056027141 9:82510748-82510770 GTGGGCTTTGGGAACTCAGGGGG + Intergenic
1056045664 9:82713189-82713211 GAGTGCCTTGGGAGCTCAAGTGG - Intergenic
1056785497 9:89589944-89589966 AAAGGCCTTTTCAACTCAGGGGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1057596901 9:96422266-96422288 GAGAGTCTTTTGAACCCAGGAGG + Intergenic
1060088237 9:120720716-120720738 TAGGGCCTTGTGTCCCCAGGTGG - Intergenic
1062088402 9:134660901-134660923 GAGTGCTTTGTAAACTCAGAGGG + Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1062268288 9:135697352-135697374 CAGGGCCCTGCCAACTCAGGTGG - Intronic
1062433249 9:136535246-136535268 AGGGGCCTTGTGAACCCTGGGGG - Intronic
1203379009 Un_KI270435v1:11535-11557 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1203379534 Un_KI270435v1:18890-18912 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1203397342 Un_KI270519v1:36159-36181 GAGGGCTTTGAGGACTAAGGTGG - Intergenic
1203397511 Un_KI270519v1:38857-38879 GAGGGCTTTGAGGACTAAGGTGG - Intergenic
1185927891 X:4167592-4167614 GAGGATCATGTGAGCTCAGGAGG - Intergenic
1189212512 X:39295799-39295821 GGGGGCCTGGTGGACACAGGAGG + Intergenic
1190284556 X:48953619-48953641 AAGGGGCATGTGAACTGAGGTGG - Intronic
1191784715 X:64904912-64904934 GAGGGGCTGTTGAAATCAGGAGG + Intergenic
1193208213 X:78773952-78773974 GTGGGCTTTGGGAACTCAGGGGG - Intergenic
1193812836 X:86072069-86072091 GAGGATCATGTGAACCCAGGAGG - Intergenic
1195672887 X:107484177-107484199 GAGGGCCCAGTGAACTCATTTGG - Intergenic
1197433611 X:126397860-126397882 TAGGACCTTTTGTACTCAGGAGG + Intergenic
1198752894 X:139952988-139953010 GAGAACCTTTTGAACCCAGGAGG + Intergenic
1200277093 X:154744122-154744144 GAGAACTTTGTGAACCCAGGAGG + Intronic
1201793460 Y:17868081-17868103 GAGAGCCGTTTGAACCCAGGAGG - Intergenic
1201808094 Y:18037905-18037927 GAGAGCCGTTTGAACCCAGGAGG + Intergenic
1202354845 Y:24035897-24035919 GAGAGCCGTTTGAACCCAGGAGG - Intergenic
1202515933 Y:25634212-25634234 GAGAGCCGTTTGAACCCAGGAGG + Intergenic