ID: 1128219088

View in Genome Browser
Species Human (GRCh38)
Location 15:65955042-65955064
Sequence GAACCTATTAACTTCTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128219088 Original CRISPR GAACCTATTAACTTCTAAGA TGG (reversed) Intronic
910108159 1:83653654-83653676 GAACCTAGAAGCTTGTAAGAGGG - Intergenic
915673534 1:157510213-157510235 GAACATATTTGCTTATAAGAAGG - Intergenic
920407364 1:205726729-205726751 GTAAATATTAACTTCTTAGAGGG - Intronic
922142723 1:222906335-222906357 GAACAATTTAACTTCTAAGGTGG + Intronic
1064710401 10:18118173-18118195 TTACCTATTAAGTTATAAGATGG + Intergenic
1071043473 10:81342666-81342688 GAAGTTATTACCTTATAAGATGG - Intergenic
1073839820 10:107485325-107485347 GAACATATTAACTCCAGAGATGG + Intergenic
1074119731 10:110485028-110485050 GAACCTATTCATTTCTCAGCCGG - Intergenic
1078154826 11:8790352-8790374 TAAACTATTAAGTTCCAAGAAGG + Intronic
1087707195 11:101506667-101506689 CAACCTAATAATTTCTAAAATGG + Intronic
1089663014 11:119997962-119997984 GAAACTATTAACTTCACACAAGG + Intergenic
1091340445 11:134808506-134808528 AAAGCTATTAACTTCTGAAAGGG - Intergenic
1092970369 12:13688215-13688237 GAAGCCACAAACTTCTAAGATGG + Intronic
1097677601 12:62619788-62619810 TAACCTATTAAGTTCTAAAATGG + Intergenic
1097768839 12:63556984-63557006 GCACTTATAAACTTCTAAGATGG + Intergenic
1097785193 12:63751614-63751636 GCAGTTATAAACTTCTAAGATGG + Intergenic
1098565259 12:71927903-71927925 AGACCTATTAACTTCTAAGATGG + Intergenic
1100633664 12:96413566-96413588 GATACTATTAACTTCCCAGATGG + Intergenic
1103967826 12:124651439-124651461 GAAGCTATTAAGTTTTAAGCAGG - Intergenic
1105340149 13:19515552-19515574 GAACCTTTCAAGTTCTAAGTGGG + Intronic
1106852935 13:33814789-33814811 TAACATATTACCTTTTAAGAAGG + Intergenic
1107360616 13:39613845-39613867 TAACTAAATAACTTCTAAGATGG - Intergenic
1108634705 13:52321703-52321725 GAACCTCTCAAGTTCTAAGTGGG + Intergenic
1108653103 13:52501485-52501507 GAACCTCTCAAGTTCTAAGTGGG - Intergenic
1109847060 13:68007337-68007359 TAGCCTATTAATTTCTAAGTAGG - Intergenic
1111513870 13:89301232-89301254 GATCACATTAACTTTTAAGATGG + Intergenic
1118499884 14:66350292-66350314 GAACCTATGAACTTCAAAACAGG + Intergenic
1123930487 15:25169105-25169127 GAACCTGTTTACTTCTCTGAGGG + Intergenic
1128219088 15:65955042-65955064 GAACCTATTAACTTCTAAGATGG - Intronic
1137448472 16:48548541-48548563 GAACCTATGAATTTTTAAAAAGG - Intronic
1137879160 16:52028810-52028832 TATGCTAATAACTTCTAAGAAGG + Intronic
1141012026 16:80411766-80411788 GAACATACTTATTTCTAAGAAGG + Intergenic
1142531292 17:581308-581330 GAACCCATTAGGTTCTGAGAGGG - Intronic
1153604103 18:6814159-6814181 AAACTTATTAAATTCTATGAGGG - Intronic
1153673630 18:7436136-7436158 GAACATATTCCCTTCTAAAATGG + Intergenic
1154011514 18:10578829-10578851 GAACCTATTGATTCATAAGAGGG - Intergenic
1155608460 18:27635280-27635302 GAACTTATTAACTACAAAGAAGG + Intergenic
1156391940 18:36659235-36659257 GTCACTGTTAACTTCTAAGATGG + Intronic
1159378326 18:67623671-67623693 GAACCTATTAAATTTTAATTTGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
927225603 2:20763013-20763035 GAATCTTTTAAGTTCTAAGATGG - Intronic
929512551 2:42576239-42576261 AATTGTATTAACTTCTAAGAAGG + Intronic
930044869 2:47161251-47161273 GTATCTACTAACTTTTAAGATGG - Intronic
932180248 2:69640567-69640589 GACCCTATGAAGTTCTGAGATGG - Intronic
935943333 2:108264368-108264390 GAACCTATGAACTTAACAGAAGG - Intronic
939654471 2:144806550-144806572 GATCATATTAACTTTTATGAAGG + Intergenic
942667038 2:178330664-178330686 GGACCTCTTAGCTGCTAAGATGG - Intronic
943190796 2:184677993-184678015 TAACCTTTTAACATCTTAGAAGG + Intronic
943672215 2:190675111-190675133 GAACATAGAAACTGCTAAGAAGG + Intronic
1173402747 20:42739662-42739684 GAACATATTTAGTTCTAAAATGG + Intronic
1173900823 20:46587726-46587748 GAACCTATTATGTGCTAAGCTGG - Intronic
1176268794 20:64224538-64224560 GAAGCTATTAACTTCCAGGAAGG - Intronic
1176734062 21:10526216-10526238 GAACCTTTCAAGTTCTAAGTGGG - Intronic
1180886551 22:19248854-19248876 GAACCTATAAAACTCTTAGAAGG - Intronic
949170439 3:989980-990002 GAACCTATTTACTTGTAACAAGG - Intergenic
949678393 3:6484586-6484608 ACACCTATTATCTTTTAAGAAGG - Intergenic
949794681 3:7835465-7835487 GAACATTTCAACTTCTCAGAAGG - Intergenic
953669270 3:44948844-44948866 GGACCTATTCACTCCTGAGATGG + Intronic
954729464 3:52646376-52646398 GAACCATAAAACTTCTAAGATGG + Intronic
955075907 3:55613134-55613156 GAACCATTTGAGTTCTAAGATGG + Intronic
955567331 3:60261372-60261394 GAACGTATTAATTTCAGAGACGG + Intronic
956263768 3:67375269-67375291 GAACATATTAGCTACTAAAAAGG - Intronic
957326850 3:78706706-78706728 GAAACTCTTAACTTCTAACCAGG - Intronic
957646884 3:82940671-82940693 GCAACTTTTAACTTATAAGAGGG - Intergenic
959253370 3:103977015-103977037 GAAAATATTAACTCCTAGGATGG + Intergenic
963098479 3:141573177-141573199 GATCCTATTAAATTGAAAGAGGG + Exonic
965500587 3:169451397-169451419 GAACCTCTTCACAGCTAAGATGG - Intronic
965875255 3:173309855-173309877 GAACATATTAACTTTTGAGATGG + Intergenic
966848632 3:184150187-184150209 GACCCTATTAACTACTACGTTGG + Intronic
967275918 3:187774410-187774432 CAACCTTTTAACTTCTGACATGG + Intergenic
971559583 4:28059893-28059915 CAACCTATTACCTTTGAAGAAGG - Intergenic
971823028 4:31584370-31584392 TAACATATTAAGTTCTAATAAGG - Intergenic
974865701 4:67578508-67578530 GAACATGTTGACTTCTGAGAGGG + Intronic
975889979 4:79016233-79016255 GAATTTTTTAATTTCTAAGATGG + Intergenic
976200162 4:82570117-82570139 GAGACCTTTAACTTCTAAGAGGG - Intergenic
976987543 4:91320839-91320861 GAACCTATTATCTTTCAAGAGGG - Intronic
980590489 4:134881514-134881536 GAAACTACTAATTTCTAATAGGG - Intergenic
980955051 4:139419457-139419479 TAACCTATTAGCTTGCAAGAAGG - Intronic
981284755 4:143003627-143003649 GAGCAAATTAACTTCTAAGGAGG - Intergenic
981392041 4:144202385-144202407 GAACTTTTTAACTTCAGAGAAGG - Intergenic
982467245 4:155746268-155746290 TAACTTATTAACTTCCAAGTAGG + Intergenic
982925563 4:161332770-161332792 AAACATATTTGCTTCTAAGAGGG - Intergenic
983540505 4:168904465-168904487 CCTCCTATTAAATTCTAAGAAGG - Intronic
984743584 4:183191584-183191606 CAAGCTCTTAACTTCTAAGCCGG + Intronic
987760167 5:22151374-22151396 AAGCCTATTAAGTTCTAAGCTGG - Intronic
987870341 5:23609757-23609779 GATCATATTAACTGCAAAGAAGG + Intergenic
988078900 5:26390486-26390508 GCACATTTTAACTTCCAAGAAGG - Intergenic
989490903 5:42051810-42051832 GATTCCATTATCTTCTAAGAAGG + Intergenic
989540029 5:42607338-42607360 CAACCCTTTAACTTCTAAGAAGG + Intronic
991894903 5:71384811-71384833 AAGCCTATTAAGTTCTAAGCTGG - Intergenic
993409915 5:87560594-87560616 GAAGCTATTATATTCTATGATGG + Intergenic
993428732 5:87803750-87803772 GAATCTATTAAGATCTTAGAAGG - Intergenic
993984231 5:94578170-94578192 GAATCTATTCAATTCAAAGATGG + Intronic
995378881 5:111510539-111510561 GAACCTATTATATTCTGATAAGG - Intronic
995600184 5:113787805-113787827 GAATCTATTATCCTTTAAGAAGG + Intergenic
996398111 5:123033367-123033389 GAACCCATTCACTACTGAGATGG - Intronic
1000028985 5:157385396-157385418 CAAAATATTAACTTCTGAGAAGG + Intronic
1008710612 6:54221865-54221887 AAACCTATTAATTGCCAAGATGG + Intronic
1009674542 6:66801070-66801092 TAACTTAATAACTTCTGAGAAGG - Intergenic
1014522227 6:122458852-122458874 AAACTTAGCAACTTCTAAGAAGG + Intronic
1016149994 6:140728855-140728877 GAAGCTATTAACTACTAGAATGG - Intergenic
1016714416 6:147207411-147207433 GAATCTGTTAATTTCTGAGACGG + Intronic
1017325598 6:153138098-153138120 GAGCCTTTTAACTTCAAAGTTGG - Intergenic
1018384310 6:163289299-163289321 GAACCTAATCAGTTCCAAGATGG + Intronic
1018490826 6:164291308-164291330 ACACCTATAAACTTCTATGAAGG - Intergenic
1024162609 7:46693020-46693042 TAACCTATTTACTTCATAGAAGG - Intronic
1027381939 7:77620496-77620518 GAACCTTGTGACTTCTAAGTTGG + Intronic
1029232536 7:99082769-99082791 GTACCTATTAACATCCCAGAAGG - Intronic
1033140503 7:138822163-138822185 GAACCTATCAACTCCTCATAAGG - Intronic
1041498032 8:58508692-58508714 CAACCTATTACCCTCTAAGATGG - Intergenic
1041619538 8:59950306-59950328 GTGCTTATTAAATTCTAAGAAGG - Intergenic
1042987874 8:74604090-74604112 GCACCTATCAACATCTCAGAAGG - Intronic
1043820473 8:84857089-84857111 GTGCCTATTCATTTCTAAGAAGG - Intronic
1044197965 8:89401471-89401493 CAACCTGTTATCTTCCAAGAAGG + Intergenic
1044657398 8:94562965-94562987 AAACCTATTAATTTTTAAAAAGG + Intergenic
1044670434 8:94674881-94674903 AAACGTATTAACCTTTAAGAAGG + Intronic
1047017059 8:120734959-120734981 GAACTTGTGAAGTTCTAAGAAGG + Intronic
1047623163 8:126629405-126629427 AAACCTAGTAAATTCTAGGACGG + Intergenic
1048131033 8:131697822-131697844 GAAAATATTAACTTCTCAGTGGG - Intergenic
1050653410 9:7798337-7798359 GAACCTGTTTACTTCTCTGAGGG + Exonic
1053303512 9:36968455-36968477 GAGCCTGTTGACTTCTACGAGGG - Intronic
1055647724 9:78376729-78376751 GAACCTAGTCTCTTCTGAGAAGG - Intergenic
1056021060 9:82438829-82438851 GACCATTTTAACTTATAAGATGG - Intergenic
1057836039 9:98446106-98446128 AAATCTATTAACTTGTAAGAAGG - Intronic
1191112610 X:56818896-56818918 CAGCCAATTAACTTCTGAGAAGG + Intergenic
1193340445 X:80343204-80343226 AAACCTATTAACTTCTGACAAGG + Intronic
1194275786 X:91879349-91879371 AAATCTATTGACTTCAAAGAGGG + Intronic
1195077053 X:101337237-101337259 GAACCCATTAACTTCTACAATGG + Intergenic
1196971858 X:121118254-121118276 GAACCTATTGCCTTCTGATAAGG + Intergenic
1200593030 Y:5100783-5100805 AAATCTATTGACTTCAAAGAGGG + Intronic
1201250362 Y:12051543-12051565 TAACCTATTTACCACTAAGATGG - Intergenic
1202592093 Y:26495721-26495743 GAACCTTTCAAGTTCTAAGTGGG - Intergenic