ID: 1128222389

View in Genome Browser
Species Human (GRCh38)
Location 15:65978557-65978579
Sequence CTGGAGACACTGCTGAGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 325}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128222389_1128222395 -1 Left 1128222389 15:65978557-65978579 CCGAGCCTCAGCAGTGTCTCCAG 0: 1
1: 0
2: 5
3: 36
4: 325
Right 1128222395 15:65978579-65978601 GAGAGGCCTTTACAGGCAAAGGG 0: 1
1: 0
2: 4
3: 19
4: 246
1128222389_1128222394 -2 Left 1128222389 15:65978557-65978579 CCGAGCCTCAGCAGTGTCTCCAG 0: 1
1: 0
2: 5
3: 36
4: 325
Right 1128222394 15:65978578-65978600 AGAGAGGCCTTTACAGGCAAAGG 0: 1
1: 0
2: 2
3: 18
4: 220
1128222389_1128222392 -8 Left 1128222389 15:65978557-65978579 CCGAGCCTCAGCAGTGTCTCCAG 0: 1
1: 0
2: 5
3: 36
4: 325
Right 1128222392 15:65978572-65978594 GTCTCCAGAGAGGCCTTTACAGG 0: 1
1: 0
2: 0
3: 16
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128222389 Original CRISPR CTGGAGACACTGCTGAGGCT CGG (reversed) Intronic
900250439 1:1666011-1666033 CTGGCGACGCTGCGGAGGCAAGG + Exonic
900338857 1:2178311-2178333 GTGGAGACAATGCTGAGGGGAGG - Intronic
900398888 1:2464798-2464820 ATGGAGACACTGCGGACTCTGGG + Intronic
900568359 1:3346441-3346463 CTGGAGACACTGCTGTCCCACGG + Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900659642 1:3776186-3776208 CTGCAGCTCCTGCTGAGGCTGGG - Intergenic
900827151 1:4935894-4935916 TTGCAGACACTGCTGAAGCCAGG + Intergenic
900940906 1:5798119-5798141 CTGGAGATCCTGCTGAGTCTTGG + Intergenic
900986397 1:6075375-6075397 ATGGAGACACTGCAGAGGCCTGG - Intronic
901012874 1:6211057-6211079 CTGGAGCCACTGCTGCTGCTGGG + Exonic
902376498 1:16032432-16032454 CTGGAGACACTGCTGGGAGTGGG - Exonic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
903219301 1:21860080-21860102 CTGGGGACAGGGCTGAGGGTGGG - Intronic
904046921 1:27614731-27614753 CTGGAGGCACAGCTGATGCAGGG + Intronic
904396889 1:30228124-30228146 CAGGGGACACTGCTGGGGATTGG + Intergenic
904868277 1:33599945-33599967 CAGCAGATACTGCGGAGGCTGGG + Intronic
904901672 1:33862577-33862599 CTGGGGACACTTCTCAGCCTAGG - Intronic
905535232 1:38715941-38715963 CTGGAGAGACCACTGGGGCTTGG - Intergenic
905548003 1:38815563-38815585 CTGAAGTCACAGCTGAGACTTGG + Intergenic
905885128 1:41487658-41487680 CTCAAGACACTGATGGGGCTGGG + Intergenic
905974169 1:42163402-42163424 CAGGAGATACTTCAGAGGCTGGG - Exonic
906141495 1:43536481-43536503 CACGAGACCCTGCTGTGGCTGGG + Intronic
906448166 1:45921720-45921742 CAGGAGTCACAGCTCAGGCTCGG + Intronic
908087758 1:60654395-60654417 CTGGATCTACTGCTGAAGCTAGG - Intergenic
908729758 1:67213866-67213888 CTGGAGACACAGCTGCCTCTGGG + Intronic
912546191 1:110453433-110453455 CTGGCCCCTCTGCTGAGGCTGGG + Intronic
912635143 1:111284920-111284942 CTGGAGCCACAGCTCAGCCTTGG + Intergenic
912864890 1:113248139-113248161 CTGGAGGGAGTGATGAGGCTCGG + Intergenic
913509591 1:119549740-119549762 CTGGCAACACTGCTGAGGATAGG - Intergenic
913513442 1:119582921-119582943 CTGGCAACACTGCTAAGGATAGG - Intergenic
913517074 1:119613869-119613891 CTGGCAACACTGCTGAGGATAGG - Intergenic
914720628 1:150285851-150285873 CTGTAGTCCCAGCTGAGGCTGGG + Intronic
914907352 1:151757472-151757494 CTGGACACGCTCCTGAGGTTTGG - Intergenic
915076171 1:153309613-153309635 CTGGAGAGACTGCTGAGGACAGG + Intronic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
915556430 1:156663423-156663445 CTGGAGACACAGCTGAGTCATGG + Intergenic
916869356 1:168895730-168895752 GTGAAGAAACTACTGAGGCTTGG + Intergenic
918018969 1:180665717-180665739 CTGGCCACACTGCTGGGGTTTGG + Intronic
920199671 1:204251839-204251861 CTGGAGGCACTGCAGAGGCTGGG + Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
921512338 1:216047460-216047482 ATGGAGAAAATGCTGAGGCTGGG + Intronic
921939887 1:220828420-220828442 GTGGAGCCACAGCTGAGGCATGG - Intergenic
921980431 1:221251455-221251477 ATTGAGACATTTCTGAGGCTTGG - Intergenic
922307495 1:224357026-224357048 CGGGGGACACGGCTGAGGGTGGG + Intronic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1063219698 10:3955699-3955721 CTGGAGATTGTGCTGAGGCCTGG - Intergenic
1065887251 10:30089329-30089351 CTGGAGAGAAGGCAGAGGCTCGG + Intronic
1067048545 10:42999430-42999452 CCGGGGACACTTCTGACGCTAGG - Intergenic
1067291970 10:44950216-44950238 GGGGAGACCCTGCTGAGGCTAGG - Intergenic
1067296392 10:44977432-44977454 CTGAGGACACTGCTGGGGCGGGG + Exonic
1068229850 10:54157369-54157391 ATGTGGAAACTGCTGAGGCTTGG + Intronic
1068779121 10:60900294-60900316 ATGGTGACTCTGCTGAGCCTGGG + Intronic
1069830233 10:71278531-71278553 CAGGAGACCATGCTGAGACTGGG - Intronic
1069909776 10:71751971-71751993 TTGGAGATGCTGCTGAGGCTTGG - Intronic
1070369000 10:75764052-75764074 ATGGAGACCCGGCTGAGGGTGGG + Intronic
1070705511 10:78635005-78635027 CAGGAGACATTCCTGAGGCTAGG - Intergenic
1070737128 10:78870800-78870822 CTGTAGAGAATGATGAGGCTGGG + Intergenic
1070778905 10:79126324-79126346 CTGGACACTCTGCTAAGCCTTGG - Intronic
1070826110 10:79391447-79391469 CTGGAGCCACTGCGGAGACTGGG + Intronic
1071272030 10:84016744-84016766 CTAACCACACTGCTGAGGCTAGG - Intergenic
1071771982 10:88739450-88739472 CTGAAGACACTGCTGAGGACAGG + Intronic
1072047193 10:91668869-91668891 CTGGAGACATTGCCGGGGGTTGG + Intergenic
1074283175 10:112072651-112072673 CAAGAGACTTTGCTGAGGCTAGG - Intergenic
1074297496 10:112204098-112204120 CTGGAGGCACTGATTAGGCACGG - Intronic
1075546705 10:123360500-123360522 TTGGTAATACTGCTGAGGCTGGG + Intergenic
1075615618 10:123889177-123889199 CTGTGGACACTGCTCAGGCCAGG + Intronic
1076191989 10:128489555-128489577 CTGCAGAACCTGCTCAGGCTCGG + Intergenic
1076895879 10:133311716-133311738 CTGGGGCTTCTGCTGAGGCTGGG - Exonic
1077268185 11:1662387-1662409 CTGGGGTCACTGCTGAGGAGGGG - Intergenic
1077272697 11:1689231-1689253 CTGGGGTCACTGCTGAGGAGGGG + Intergenic
1079201887 11:18383639-18383661 CTGGAGAGGAAGCTGAGGCTGGG + Intergenic
1081660254 11:44883791-44883813 CTGGAGAGACTGCCTAGGTTCGG + Intronic
1083343299 11:61972725-61972747 CTGGAGACATAGATGAGGATTGG + Intergenic
1084514157 11:69626943-69626965 CTGCAAACACTCCTGAGGCTGGG - Intergenic
1084566437 11:69931435-69931457 CTGGAGACCCTGCTCTGCCTGGG - Intergenic
1087830139 11:102810788-102810810 CTGAAGACACCTCTGAGACTAGG - Intergenic
1088933255 11:114373587-114373609 CTGGAAACATAGCTTAGGCTTGG - Intergenic
1089685934 11:120146944-120146966 CTGGGGACACAGCTGAGCCCAGG + Intronic
1090175231 11:124642968-124642990 CTGGAGTCTCATCTGAGGCTTGG - Intronic
1090463895 11:126915973-126915995 CTGGAGACTGTTCTGTGGCTGGG - Intronic
1092263138 12:6963008-6963030 CTGGAGACAGGGGTGAGACTAGG + Intergenic
1092281596 12:7101794-7101816 CTTGAGTGACAGCTGAGGCTGGG - Intronic
1093561787 12:20551668-20551690 CTGGGAACACTGCTGAGGGGCGG - Intronic
1095443804 12:42265195-42265217 CAGGAAATCCTGCTGAGGCTGGG + Intronic
1095832642 12:46604096-46604118 CTGCTGACACTGCTGCTGCTGGG + Intergenic
1096183668 12:49564998-49565020 CTGGAGTTGGTGCTGAGGCTGGG - Intronic
1097275515 12:57810784-57810806 CTTGAGAAAGTGCTAAGGCTAGG + Intronic
1097335001 12:58372186-58372208 CTGGGGAGAATGCTAAGGCTTGG + Intergenic
1097867469 12:64570863-64570885 CTGGAGACACTTCTTAACCTTGG + Intergenic
1099439754 12:82686486-82686508 CTGGAGAGACTTCTGAGACCGGG - Intergenic
1100273863 12:93052767-93052789 TTGGAGAAACTGCTGATTCTAGG - Intergenic
1102348085 12:112172359-112172381 CTGGAGGCCCCGCTGAGGCCAGG - Intronic
1102977701 12:117218415-117218437 CTGGAAACACCGCTGCTGCTTGG + Intronic
1103358110 12:120336661-120336683 ATAAAGACACTTCTGAGGCTGGG + Intergenic
1103920582 12:124397177-124397199 CTGGCAGCACTGCTGAGGCCGGG - Intronic
1104072811 12:125361144-125361166 TGGGAGCCACTGCTGAGGGTGGG - Intronic
1104131928 12:125902404-125902426 CTGGAGACACTGGGCAGGTTTGG - Intergenic
1104618670 12:130292779-130292801 CTGGATTCACTGCTGATGTTGGG + Intergenic
1105636315 13:22219003-22219025 CTGGAGTCACTGCTGAATCTTGG + Intergenic
1106374257 13:29169543-29169565 CAGGAGACTCTTCTGGGGCTGGG + Intronic
1107282817 13:38755945-38755967 ATGTAGACACAGCTGTGGCTTGG - Intronic
1107430819 13:40338586-40338608 CTGGAGACTCTGACAAGGCTGGG + Intergenic
1111928208 13:94485330-94485352 TTGGAAACACTGATGATGCTCGG - Intergenic
1112052845 13:95661295-95661317 CTGGAGTCATTGCTCTGGCTGGG + Intergenic
1113482475 13:110631813-110631835 CAGGACACACTGCTAATGCTCGG + Intronic
1113510858 13:110853799-110853821 CAGGAGACACTGGGGAGGCTCGG + Intergenic
1113565133 13:111315363-111315385 CTGGAGACTGGGCTGAGGCTTGG + Intergenic
1114221247 14:20699411-20699433 CTGCTGACCCTGCTGGGGCTGGG + Exonic
1114671038 14:24411226-24411248 TTGGTGACACTGTGGAGGCTGGG - Intronic
1114696336 14:24630776-24630798 CTGGAGAAACTGGTGTGGATAGG + Intergenic
1115934546 14:38536994-38537016 GTGGAGACACAGCTAAGGCCGGG - Intergenic
1118010927 14:61609738-61609760 CTGGAGACACAGCAGAGGGAAGG - Intronic
1118617398 14:67583799-67583821 CTGGAGAAGATGCTGAGCCTTGG - Exonic
1119172388 14:72545060-72545082 CTGGGGATTCTGCTGAGTCTAGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120202838 14:81555964-81555986 TTGGAGATACTGCTGACGTTAGG - Intergenic
1120377787 14:83731178-83731200 TTGGAGACACTGATAAGGCTTGG - Intergenic
1122765180 14:104064155-104064177 CTGGGGACAAGGGTGAGGCTGGG - Intergenic
1122793798 14:104195604-104195626 CAGGAGACGCAGGTGAGGCTGGG + Intergenic
1122853452 14:104548714-104548736 CTGGGGAGAATGCTGGGGCTGGG - Intronic
1123122825 14:105926025-105926047 CTGCAGAGGCTGCTGAGGCCTGG + Intronic
1123758002 15:23412036-23412058 CTGGAGACCCGGCTGAGGGAGGG - Intergenic
1125757992 15:42078110-42078132 CTGGACACACTGCTGATGGGTGG + Intronic
1125967161 15:43883741-43883763 CTGGGGACGCTGCTCAGCCTTGG + Exonic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1128682575 15:69662495-69662517 CTGGACACCATGCTGTGGCTTGG + Intergenic
1129174902 15:73832804-73832826 CTGTGGACACTTCTGAGGATTGG - Intergenic
1129412679 15:75358692-75358714 CTGGAGACACGGTATAGGCTGGG - Exonic
1129414465 15:75367726-75367748 CTTGTGACACTGCAGATGCTTGG - Intronic
1130938876 15:88491443-88491465 CTGGAAACAGGGCTGAGGCCAGG + Intergenic
1131047691 15:89326579-89326601 CTAGATACACTGCTGGGGGTGGG + Intronic
1132761106 16:1509050-1509072 GTGGAGCCACTGATGGGGCTGGG + Intronic
1133224638 16:4335046-4335068 CTGGTTACACTGCGGAGGATGGG - Exonic
1137231527 16:46571471-46571493 CGGGAGATGCTGATGAGGCTGGG + Intergenic
1141618855 16:85225915-85225937 CTGAAGGCTCTGCTGGGGCTGGG + Intergenic
1141639958 16:85335287-85335309 ATGGTGGCACTGCTGAGGCCGGG + Intergenic
1141954354 16:87360461-87360483 CTGGAGATGGGGCTGAGGCTAGG - Intronic
1142241421 16:88948580-88948602 CAAGAGACACTCCTGAGGCAGGG - Intronic
1142245520 16:88968457-88968479 CCTGAGACGCAGCTGAGGCTGGG - Intronic
1144703012 17:17350942-17350964 CTGGGGACCCTGCTGAGGATGGG + Intergenic
1145017699 17:19409969-19409991 GTGGAGACACCCCTGAAGCTGGG - Intergenic
1145238191 17:21223721-21223743 CTGGATACATTGCTGACTCTGGG + Intergenic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1145943942 17:28759299-28759321 CTGGAGACCCTGGTGAGCCAGGG + Exonic
1146562111 17:33879161-33879183 CTGTAAAGACTACTGAGGCTAGG + Intronic
1146874084 17:36394100-36394122 CTCGTGAGACTGCAGAGGCTTGG - Intronic
1146881438 17:36445011-36445033 CTCGTGAGACTGCAGAGGCTTGG - Intergenic
1147065302 17:37918773-37918795 CTCGTGAGACTGCAGAGGCTTGG + Intergenic
1148380638 17:47194317-47194339 CCAGAGACAGAGCTGAGGCTGGG - Intergenic
1148485913 17:47990966-47990988 GTGGGGACACTGCTGAGAGTGGG + Intergenic
1148863654 17:50617711-50617733 CTGGAGACAGGGCTGAGGATGGG + Intronic
1149659071 17:58324991-58325013 CTGGGGACCCTCCTGAGGTTGGG + Exonic
1149774026 17:59343345-59343367 CTGTAGACACTACTGGGGGTGGG + Intronic
1150224224 17:63514304-63514326 TCAGAGACACTGCTTAGGCTGGG + Intronic
1150465159 17:65386452-65386474 CAGCAGCCACTACTGAGGCTTGG + Intergenic
1151386004 17:73755820-73755842 CTGGAGCCTCAGCTGAGGCCTGG - Intergenic
1151482981 17:74381037-74381059 CTGGGGACAATCCTGAGGCTGGG - Intergenic
1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG + Intergenic
1152085112 17:78213363-78213385 CTGGAGTCACTTCTGGAGCTGGG - Intergenic
1152699943 17:81813756-81813778 CTGGACGCCCAGCTGAGGCTGGG + Exonic
1152751302 17:82063649-82063671 CTGGAGACACTGCTGGTTCTGGG - Intronic
1152828526 17:82482836-82482858 ATGGAGCCACTGCAGAGCCTGGG - Intronic
1152945710 17:83196384-83196406 TTGGAGACACAGAGGAGGCTGGG + Intergenic
1154009069 18:10560092-10560114 CTGGACACACAGCCTAGGCTGGG - Intergenic
1154980759 18:21500441-21500463 CAGGAGACACTGCAGAGCCAAGG + Intronic
1156201350 18:34835640-34835662 CTGTACACAGTACTGAGGCTAGG + Intronic
1156892668 18:42208143-42208165 CTTGAGACCCTCCTGAGGCAGGG + Intergenic
1157045704 18:44099859-44099881 CTGGAGACATACCTGAGACTGGG - Intergenic
1157623417 18:49029147-49029169 CTCCAGGCACTTCTGAGGCTGGG + Intergenic
1157713706 18:49867476-49867498 CGGGAGAGTGTGCTGAGGCTGGG + Intronic
1157905225 18:51563698-51563720 CAGGAGGCACTGGAGAGGCTGGG - Intergenic
1158144143 18:54291315-54291337 CTGGCAACACTGCTGAGTGTGGG + Intronic
1160575319 18:79849683-79849705 CTGGAGGCAGAGCGGAGGCTGGG + Intergenic
1160947670 19:1651269-1651291 CGGGAGACACCTCCGAGGCTGGG + Intronic
1160981868 19:1819924-1819946 CAGGACTCACTGCTGAGGCCGGG + Exonic
1161555791 19:4941897-4941919 CTGGGAACACTGCTGAGGGGCGG - Exonic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1163161087 19:15464446-15464468 CTGGAGGCAGAGCTGAGGGTGGG - Intronic
1163255377 19:16153018-16153040 GCGGAGACACTGCGGGGGCTGGG - Intronic
1163351574 19:16779454-16779476 CTGGACACACAGGTGAGACTTGG + Exonic
1163389859 19:17023870-17023892 CTAGAGACACTATTGAGGCCAGG - Intronic
1163520821 19:17790620-17790642 CTGGGGACACAAATGAGGCTGGG + Intergenic
1163702617 19:18793756-18793778 CTGGTCACAGTGCTGGGGCTTGG + Intergenic
1163834724 19:19566221-19566243 TTGGTGGCACTGCTGATGCTTGG + Intronic
1165327997 19:35125323-35125345 CTGGAGCCACTGCAGGAGCTGGG - Exonic
1166061870 19:40330899-40330921 CTGGAGACAATGTGGTGGCTGGG + Intronic
1166229960 19:41420974-41420996 CTGGGCACAGTGCTGAGGCCTGG - Intronic
1166732715 19:45067929-45067951 CTGAGGGCAGTGCTGAGGCTGGG + Intronic
1168412958 19:56151282-56151304 CTGGAGGCGCTGCTGTGGATTGG + Intronic
1202635938 1_KI270706v1_random:44415-44437 CTGGAAACAAGGCTCAGGCTGGG + Intergenic
925659091 2:6183651-6183673 GAGGGGACACTGCAGAGGCTGGG - Intergenic
926086423 2:10023101-10023123 CTGGAGCCACGGCTGAGGGCAGG - Intergenic
926226366 2:10969885-10969907 CTGGAAAGACTGCTGGGTCTAGG - Intergenic
926685072 2:15691900-15691922 CTGTGGACACTGCTCAGGCTGGG - Intronic
927012449 2:18919240-18919262 CAGGAGACACAGCTGACACTGGG + Intergenic
927916930 2:26943088-26943110 CTGGAGATGCTGCTTTGGCTCGG + Intronic
928127534 2:28626757-28626779 CTGTAGGCACTGCTGAGGTGAGG + Intronic
930054843 2:47244052-47244074 CTGGAAACACTGAGCAGGCTTGG - Intergenic
930415985 2:51092349-51092371 CTGGAGACATGGCTGAATCTAGG - Intergenic
931789213 2:65648482-65648504 CTGGGGACAGAGCTCAGGCTGGG + Intergenic
932726336 2:74182893-74182915 CTGTAGTCCCAGCTGAGGCTGGG + Intergenic
932764430 2:74460991-74461013 CAGCAGACAGTGCTGAGGCCTGG + Intergenic
933153346 2:78941256-78941278 CTGGTGACACTCTTCAGGCTTGG + Intergenic
935712914 2:105914952-105914974 TAGTAGACACTGCTGGGGCTGGG - Intergenic
937033106 2:118757337-118757359 CTTTAAAGACTGCTGAGGCTGGG + Intergenic
937315644 2:120930602-120930624 CAGGGGACACTGCTGCTGCTTGG - Intronic
937378805 2:121356946-121356968 CTGGAGATGCTGCAGAGGCTGGG + Intronic
937643682 2:124242227-124242249 CTGGAGCCACTGTTGAGCATTGG - Exonic
940295820 2:152122957-152122979 CTGGAGAGGCTGATGAGGGTGGG + Intronic
940984209 2:160036641-160036663 CAGGTGCCTCTGCTGAGGCTGGG + Intronic
943349314 2:186778996-186779018 CTGGAGTCACAGCTGATCCTAGG - Intergenic
944098778 2:195998973-195998995 CTGGGGACCCTGCTGATCCTTGG + Intronic
946239176 2:218343541-218343563 CTGGACACTGTGCTGGGGCTAGG + Exonic
1168950829 20:1800640-1800662 CTGGAGAAACGGCTGATTCTAGG + Intergenic
1169159467 20:3364443-3364465 CTGGAGCCACTGCTCAGTCTAGG + Intronic
1169202660 20:3720348-3720370 CTGGACACACAACTGAGGCAAGG - Intergenic
1170828680 20:19820614-19820636 GTGGAAACACACCTGAGGCTGGG - Intergenic
1171230836 20:23483321-23483343 CTGGGGACTCATCTGAGGCTTGG + Intergenic
1171359430 20:24576727-24576749 CCTGAGGCACTGCTGAGGGTGGG - Intronic
1171950893 20:31420729-31420751 CTGTAGTCACTGCTGTGGTTTGG - Intergenic
1172444358 20:34985297-34985319 CTGGAGACCAGGCAGAGGCTGGG - Intronic
1172941459 20:38657318-38657340 ATGGAGACACTTCTCAGGGTTGG + Intergenic
1173061560 20:39666696-39666718 CTGGAGATGGGGCTGAGGCTGGG - Intergenic
1173639049 20:44586437-44586459 CAGGAAATAATGCTGAGGCTTGG - Intronic
1173833775 20:46111589-46111611 CTGGAGACAGTGCAGGGGGTGGG + Intergenic
1175459838 20:59144327-59144349 CTGGAGGGGTTGCTGAGGCTGGG + Intergenic
1176064489 20:63187607-63187629 CTGGAGAGACTGCAGAGGCTGGG - Intergenic
1177854681 21:26387466-26387488 CTGTAGCCACTGCAGAGGATGGG + Intergenic
1179021229 21:37642764-37642786 CTGGAGAGATGGGTGAGGCTGGG + Intronic
1179490873 21:41740920-41740942 GTGGAGACTCTGCTCAGGCATGG - Exonic
1180180529 21:46116862-46116884 CTGGGGGCCCTGCAGAGGCTGGG - Intronic
1180879710 22:19195256-19195278 CTGCAGACTCTGCTCAGGGTGGG + Intronic
1180970647 22:19813301-19813323 CTGGAGAAATGGCTGAGTCTAGG + Intronic
1181109184 22:20591408-20591430 CTGGAGCCTCTGCTGAAGCAGGG + Intergenic
1181369047 22:22401850-22401872 TGGGAGACACTGCTCAGCCTGGG + Intergenic
1181911421 22:26241329-26241351 CTGGAGGCAGAGCTGAGGGTAGG - Intronic
1182854504 22:33505269-33505291 CTGTAGCCTCTGCAGAGGCTGGG + Intronic
1183059743 22:35328768-35328790 CTGGAGGCAACGCTGAGGCTCGG - Intronic
1183499180 22:38168226-38168248 CTGGAGACACTGGAGGTGCTTGG + Intronic
1183734145 22:39634591-39634613 CTGGACACACTGCCCATGCTGGG + Exonic
1184322032 22:43749287-43749309 CTGTGGACACTGGTGAGTCTGGG + Intronic
1184455568 22:44607883-44607905 CGGGAGAGGCTGCTGTGGCTGGG - Intergenic
1184493729 22:44825460-44825482 CTGTAGACACAACAGAGGCTGGG - Intronic
1184692880 22:46125308-46125330 ATGGGGACCCTGCTGAGGCTGGG - Intergenic
1185146025 22:49137174-49137196 CTGGGGAGACTGCTGAGGGCTGG - Intergenic
949762530 3:7487332-7487354 CTGAAGAGAATGCTGAGGGTGGG + Intronic
950114806 3:10443948-10443970 TTAGTGACACAGCTGAGGCTGGG + Intronic
950525322 3:13519608-13519630 TTGGAGAGACTGCTGGGGCTGGG + Intergenic
951971723 3:28453107-28453129 CTGGAGACACTGCTGATATTGGG - Intronic
952910709 3:38182349-38182371 GTGGAGACCCTGCTGATGCTGGG + Intronic
952952187 3:38533845-38533867 CTGCAGTGACTGCTGATGCTGGG + Intronic
953690534 3:45114137-45114159 CTGCTGACAGAGCTGAGGCTGGG - Intronic
953787494 3:45922032-45922054 CTGTGGACTCTCCTGAGGCTTGG + Intronic
955391718 3:58526887-58526909 CTGGAGACACTGGCCAGGCCAGG - Intronic
956642579 3:71428883-71428905 CAGGAGGCACTGCTGAAGCCGGG + Intronic
957447665 3:80336137-80336159 GTGTAGATACTGCTGAGACTGGG + Intergenic
958855199 3:99376610-99376632 CTGGACACTCTACTGTGGCTAGG - Intergenic
959682264 3:109109045-109109067 CAGGGAACAATGCTGAGGCTCGG - Intronic
960334723 3:116402342-116402364 CTTGTGAAACTGCTGAGGATAGG + Intronic
960683638 3:120274803-120274825 CTGGAGGCACTGTTGATTCTGGG - Intronic
960785638 3:121370532-121370554 ATAGAGACACACCTGAGGCTGGG - Intronic
961490558 3:127254210-127254232 CTGGAGACACTGCTGAAAAGGGG + Intergenic
962398401 3:135037132-135037154 CTAGAGTAACTGCTCAGGCTTGG + Intronic
963063374 3:141242566-141242588 CTGGAGACAGTGCTGGGGGGTGG + Intronic
963125890 3:141815848-141815870 CTGAAGGCTCAGCTGAGGCTGGG - Intronic
963420517 3:145055640-145055662 CTGCAGAGAATGGTGAGGCTTGG - Intergenic
963969727 3:151416331-151416353 CTGGGGAGGCTGCTGGGGCTGGG - Exonic
965697689 3:171426665-171426687 CTGGAGACTCTGGAGAGGATGGG - Intronic
965746908 3:171935581-171935603 CTGGAGGCCATACTGAGGCTAGG + Intronic
966432498 3:179846888-179846910 CTGGAGACTCTGGTGAGTTTGGG - Intronic
967336774 3:188352769-188352791 CTGGTGACACTGCCGTGCCTAGG + Intronic
967652962 3:192008993-192009015 CTGTGGACTCTTCTGAGGCTGGG - Intergenic
968455665 4:698046-698068 CTGGAGACACTGCATGGACTTGG - Intergenic
969530416 4:7727259-7727281 CATGAGACAATGCTCAGGCTTGG - Intronic
969637426 4:8377500-8377522 CAGGAGACAACGCTGAGGCTTGG - Intronic
970601473 4:17643806-17643828 GTGGAGACCCTGCTGAGGGCTGG + Intronic
973786065 4:54333799-54333821 ATTCAGACATTGCTGAGGCTGGG - Intergenic
976022502 4:80646134-80646156 CTGGAGGCACTGTTGTGGCTTGG - Intronic
978625376 4:110679538-110679560 CTGGTGACATTGTTGAAGCTGGG - Intergenic
979106318 4:116692942-116692964 TTGTAGCCACTGCTGAGGCATGG + Intergenic
979573565 4:122259051-122259073 CTGGAGACAGCTCTAAGGCTTGG - Intronic
979698321 4:123639367-123639389 CTGGAGACACATCTGACCCTGGG + Intergenic
980623663 4:135344285-135344307 CTGGACCCAGTGGTGAGGCTGGG + Intergenic
980905941 4:138949005-138949027 CAGGAGACATCACTGAGGCTAGG + Intergenic
981240540 4:142471654-142471676 CTGCCTACACTGCTGATGCTGGG - Intronic
983827763 4:172285671-172285693 GTGTAGAAACTGCGGAGGCTGGG - Intronic
985786527 5:1898244-1898266 CTGGAGCACCTGCTTAGGCTGGG - Intergenic
986055808 5:4135782-4135804 CTGGAGACAGTGTTGTGGCAGGG + Intergenic
989734341 5:44685552-44685574 CTGGAAACTCTGCTGAGACATGG - Intergenic
992760532 5:79947620-79947642 CAGGAGACAGTGCTGAAGATTGG - Intergenic
993386413 5:87268003-87268025 CCGGTGCCGCTGCTGAGGCTGGG - Exonic
994030588 5:95137319-95137341 TTGACGACAATGCTGAGGCTTGG - Intronic
998261098 5:140632477-140632499 CTTGAGCCACTGCTGCAGCTCGG + Exonic
1000050382 5:157557921-157557943 ATGGAGACCCTGCTTATGCTGGG + Intronic
1000226104 5:159263395-159263417 TTGGAGACGCTGTTGGGGCTCGG + Intronic
1001191157 5:169632560-169632582 ATGGAGACATTGATGGGGCTGGG + Intergenic
1005593450 6:27352567-27352589 CTGGACACATTCCAGAGGCTAGG - Intergenic
1007302745 6:40880353-40880375 GTGCAGACACTCCTCAGGCTAGG - Intergenic
1007598347 6:43065816-43065838 CTGGAGACAGGGCAGGGGCTGGG + Intronic
1009981773 6:70734594-70734616 GTGGGGACTCTGATGAGGCTGGG + Intronic
1010211182 6:73363736-73363758 CTGGAGAGACTGCTGGGTCCCGG - Exonic
1012475558 6:99612838-99612860 ATGGAGACACTGATAAGGATTGG + Intronic
1014471376 6:121819136-121819158 CTGAAGACACACCTGAGACTGGG - Intergenic
1016780253 6:147950353-147950375 CAGGAGGCCATGCTGAGGCTGGG - Intergenic
1016948832 6:149560935-149560957 CTGGAGACACTGCTGCTCCGAGG - Intergenic
1017925085 6:158904127-158904149 CTGAAGCCACTGCTGTGCCTAGG + Intronic
1018368943 6:163149753-163149775 CTGGAGTCCCTGCTGCGGATCGG + Intronic
1019191973 6:170256763-170256785 CTGGGAAAACTGCTCAGGCTGGG - Intergenic
1019484244 7:1281574-1281596 CTGGAGACTGTTTTGAGGCTGGG - Intergenic
1019709465 7:2511681-2511703 CTGAAGACAAGGCTGGGGCTGGG - Intergenic
1022507372 7:30915437-30915459 GTGGAGACACTGCAGAGGGAAGG + Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1024011276 7:45269018-45269040 CAGGAGACACTCCTGAGGAGAGG - Intergenic
1024049544 7:45610134-45610156 CTGGACACACTCCTGAGTCTCGG - Intronic
1024611074 7:51064870-51064892 CTGGAGACTGTGCTCAGGCCTGG - Intronic
1024819885 7:53316091-53316113 CTGGGGACACTGCCAAGCCTAGG + Intergenic
1026285454 7:68958762-68958784 CTGGAGAGATTACTGAGCCTGGG - Intergenic
1026939160 7:74276902-74276924 CTGGAGCCCCTGCTGTGACTGGG + Intergenic
1027327602 7:77060414-77060436 CTGGAGACTCTGCTCATTCTGGG + Intergenic
1027532480 7:79353623-79353645 CTGGAGATACAGCTGAGATTGGG + Intronic
1029815917 7:103094845-103094867 CAGTGGACACTGCTGAGGATTGG + Intronic
1031483162 7:122301957-122301979 GTGGGGGCACGGCTGAGGCTGGG + Exonic
1033959851 7:146901235-146901257 CAGCAGAAACTGTTGAGGCTCGG - Intronic
1035563472 8:626388-626410 CTGCAGACCCGGCAGAGGCTAGG - Intronic
1036061459 8:5326052-5326074 CTAGGGACAATGCTGAGTCTTGG + Intergenic
1038019304 8:23539467-23539489 TTTGAGACACTGCTGTGGGTGGG + Intronic
1038417018 8:27404524-27404546 CTGGAGTCCCTGCTGCGGGTGGG - Intronic
1040573604 8:48630986-48631008 CTGGAGAAATGGCTGAGTCTAGG - Intergenic
1041717375 8:60944363-60944385 TTGGAGGGACAGCTGAGGCTTGG + Intergenic
1042096848 8:65225507-65225529 GAGGAGGCACTGCTGAGCCTAGG - Intergenic
1043075821 8:75698229-75698251 CTGGAGACTTGGCTGGGGCTGGG + Intergenic
1047565092 8:126035207-126035229 GTGAAGACACTGATGAAGCTGGG - Intergenic
1049439305 8:142601953-142601975 CTGGTGTCACTGCTGTGCCTTGG - Intergenic
1049539023 8:143198214-143198236 CTGTCGGCACTGCTGAGGATCGG - Intergenic
1049828554 8:144685580-144685602 CTGGAGCCTCCGCCGAGGCTGGG + Intergenic
1051139390 9:13962212-13962234 CTGGAAACTCTGCTGAGTTTGGG - Intergenic
1054903108 9:70389963-70389985 ATAGAGAAACTGCAGAGGCTGGG + Intronic
1055425774 9:76194877-76194899 CTGGAGTCACAGCTGAGGAGAGG + Intronic
1057860516 9:98637152-98637174 TTGGACTCACTGCAGAGGCTGGG - Intronic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1060505100 9:124191830-124191852 CTGGAGAGACTGGCCAGGCTGGG + Intergenic
1060548980 9:124476404-124476426 CCGGAGAGACAGGTGAGGCTGGG + Exonic
1061232079 9:129321025-129321047 CGGGAGAAACTGCTGAGACGAGG + Intergenic
1061515156 9:131085501-131085523 CTGCAAACCCGGCTGAGGCTGGG - Intronic
1061930852 9:133832378-133832400 CTGCAGACTCTGCTGGGGGTTGG + Intronic
1061969959 9:134039623-134039645 CGGGAGCCCCTGCTGTGGCTGGG - Intronic
1062431804 9:136529688-136529710 CTGGAGCCTCTGCGGTGGCTAGG + Intronic
1062547770 9:137071289-137071311 CTGGAAACACAGCAGAGGCAGGG - Intergenic
1062590956 9:137274463-137274485 CTGGGGACCCAGGTGAGGCTGGG + Intergenic
1186318935 X:8403036-8403058 CTGGATAAACTGCTAAGACTTGG + Intergenic
1189248938 X:39585075-39585097 CGGGAGACACTGCTGAGGTGAGG - Intergenic
1189859970 X:45262000-45262022 CTGGAGATCATGCTGAGGCGTGG + Intergenic
1190712397 X:53080149-53080171 CTGGAGGGACTGCTCAGTCTGGG + Exonic
1190888171 X:54547407-54547429 TTGGAAACAATGCTGTGGCTGGG + Intronic
1191749572 X:64527384-64527406 CTGGAGAATCACCTGAGGCTAGG - Intergenic
1192236248 X:69297952-69297974 CTGGAGACATATCTGGGGCTGGG - Intergenic
1193080868 X:77404767-77404789 AGGGAGACACTGCTGGGGCCAGG - Intergenic
1195469641 X:105218341-105218363 CTGAGGCCACTGCTGAGGCTTGG - Intronic
1195621980 X:106966203-106966225 CTAGAGAAAAAGCTGAGGCTGGG + Intronic
1197942113 X:131801428-131801450 CTGAAGGCACTGTGGAGGCTGGG + Intergenic
1198049111 X:132931374-132931396 CTGGAGACATTGTTGAGGAAGGG - Intronic
1198709059 X:139481540-139481562 CTGAATACAGTTCTGAGGCTTGG + Intergenic
1199927375 X:152481113-152481135 CAGAAGACACACCTGAGGCTCGG + Intergenic
1200013616 X:153140709-153140731 CTGGAAACTTAGCTGAGGCTGGG + Intergenic
1200025985 X:153259209-153259231 CTGGAAACTTAGCTGAGGCTGGG - Intergenic
1200461458 Y:3459420-3459442 GTGGAGATACTGCTTTGGCTTGG + Intergenic
1200936441 Y:8742494-8742516 CTGGACACTCTTTTGAGGCTTGG - Intergenic