ID: 1128223759

View in Genome Browser
Species Human (GRCh38)
Location 15:65987296-65987318
Sequence GTGGCTGTTTAAGCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 319}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128223759_1128223762 -2 Left 1128223759 15:65987296-65987318 CCAGCCTGGGCTTAAACAGCCAC 0: 1
1: 0
2: 2
3: 21
4: 319
Right 1128223762 15:65987317-65987339 ACCCTTGAAAATCCATAAAGAGG 0: 1
1: 0
2: 1
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128223759 Original CRISPR GTGGCTGTTTAAGCCCAGGC TGG (reversed) Intronic
900016325 1:152846-152868 TTGGCTCTTGTAGCCCAGGCTGG + Intergenic
900019084 1:174767-174789 TTCGCTGTTTTTGCCCAGGCTGG - Intergenic
900046589 1:511438-511460 TTGGCTCTTGTAGCCCAGGCTGG + Intergenic
900049341 1:533362-533384 TTCGCTGTTTTTGCCCAGGCTGG - Intergenic
900068793 1:753155-753177 TTGGCTCTTGTAGCCCAGGCTGG + Intergenic
900071573 1:775176-775198 TTCGCTGTTTTTGCCCAGGCTGG - Intergenic
900395280 1:2450816-2450838 GTGGGGATTTGAGCCCAGGCTGG - Intronic
900476734 1:2879618-2879640 GTGGCTGATGACGTCCAGGCAGG - Intergenic
903963028 1:27069137-27069159 CTGGCAGTTTGAGACCAGGCTGG + Intergenic
904437737 1:30509661-30509683 GGGGCTGCTTCATCCCAGGCTGG + Intergenic
905033053 1:34900361-34900383 GTGCCTGTTCAAGCCAGGGCAGG - Intronic
905442248 1:38003126-38003148 TTTGCTGTTGTAGCCCAGGCTGG - Intronic
907391250 1:54159998-54160020 GTGGCTGCTGGAGCCCAGCCAGG - Intronic
913483004 1:119307262-119307284 GTGGCACTGGAAGCCCAGGCAGG - Intergenic
915118814 1:153616070-153616092 TTGGCTCCTGAAGCCCAGGCGGG - Intronic
916540621 1:165750509-165750531 TTTGCTCTTTATGCCCAGGCTGG - Intronic
920053301 1:203176008-203176030 CTGGCTGTTGAAGGCCAGTCGGG - Intergenic
920302311 1:204996641-204996663 GTGGCTGTTTGGGCTCATGCAGG + Intronic
922104150 1:222498545-222498567 TTGGCTCTTGTAGCCCAGGCTGG + Intergenic
922264468 1:223971066-223971088 TTGGCTCTTGTAGCCCAGGCTGG + Intergenic
922266488 1:223989059-223989081 TTCGCTGTTTTTGCCCAGGCTGG - Intergenic
922688439 1:227666772-227666794 TTTGCTGTTTTTGCCCAGGCTGG + Intronic
923674449 1:236067321-236067343 CTGGCTGTATAAGCACGGGCAGG + Intergenic
1063510311 10:6638300-6638322 GTGTCTCTTTCAGCCCAAGCTGG + Intergenic
1064983618 10:21188628-21188650 CTCGCTGTTTTCGCCCAGGCTGG + Intergenic
1066124889 10:32331320-32331342 TTTGCTGTTTTTGCCCAGGCTGG - Intronic
1067064987 10:43099103-43099125 GTGGCTGAGTGAGCCCAAGCAGG - Intronic
1067535783 10:47108944-47108966 GTTGTTGTTTAAGACCAGGTGGG + Intergenic
1069750319 10:70741211-70741233 GGGGCTGTGTGTGCCCAGGCAGG + Intronic
1069827176 10:71261440-71261462 GAGGCTGACAAAGCCCAGGCTGG + Intronic
1069995393 10:72339062-72339084 TTTGCTGTTTGAGCACAGGCTGG - Intronic
1070038845 10:72754798-72754820 GTGTCTAGCTAAGCCCAGGCTGG - Intronic
1071051009 10:81449462-81449484 GTTGCTCTTTTTGCCCAGGCTGG + Intergenic
1071527455 10:86366626-86366648 CTGGCAGCTTGAGCCCAGGCCGG + Intergenic
1075116176 10:119628866-119628888 GGGGGTATATAAGCCCAGGCAGG - Intergenic
1075741152 10:124697380-124697402 CTGGCTCTTTAAGGCCTGGCAGG + Intronic
1075813685 10:125247541-125247563 AGGGCTGTGTAAGCCCAGGAGGG + Intergenic
1076972917 11:147915-147937 TTGGCTCTTGTAGCCCAGGCTGG + Intergenic
1076975685 11:169957-169979 TTCGCTGTTTTTGCCCAGGCTGG - Intronic
1077115145 11:880709-880731 GTGCGTGTGTCAGCCCAGGCAGG - Intronic
1078903882 11:15666520-15666542 TGGGCTGGTTAAGCCCAGGCAGG + Intergenic
1079132211 11:17753659-17753681 GTGCTTTTTTAAGCCCAGGCTGG + Intronic
1081739086 11:45425622-45425644 GAGGCTGTTTGAGCCCAGCTGGG + Intergenic
1083486712 11:62987654-62987676 GTGGCTGGGTGGGCCCAGGCGGG - Intergenic
1084955050 11:72686712-72686734 GTGGCTGTGGTAGCCCAGGCAGG - Intronic
1085449847 11:76625200-76625222 GTGGCTGGGCAGGCCCAGGCAGG - Intergenic
1085483956 11:76846076-76846098 GTGCCTGTTTAATTCCAGCCAGG - Intergenic
1086690718 11:89786836-89786858 GAGGCTGTTCAGGCCCAGTCAGG + Intergenic
1087297999 11:96399762-96399784 GTGGCTGCTTAAGCCAAACCTGG - Intronic
1088051888 11:105526524-105526546 GTGAATGTCTAAGCCCAGACGGG - Intergenic
1088693345 11:112346067-112346089 GTTGCTGTTGAATTCCAGGCAGG - Intergenic
1089011268 11:115133731-115133753 GTGGCTGTCTACGCTCAAGCAGG - Intergenic
1089356132 11:117855290-117855312 GTGGTTGATGTAGCCCAGGCTGG - Intronic
1089764051 11:120750146-120750168 GTGGCTCTTGACTCCCAGGCTGG + Intronic
1090615683 11:128512571-128512593 GTGGCTGGGGAAGCCAAGGCAGG + Intronic
1091182773 11:133621773-133621795 GGGGCTATTTCAGCCCAGGCTGG - Intergenic
1091677124 12:2499622-2499644 GAGGCTGTTTCAGCCAAGGCAGG + Intronic
1092341375 12:7679267-7679289 GTGGCTGTGCACGCCCAGGCTGG - Intergenic
1094153564 12:27313216-27313238 CTCGCTGTTTTCGCCCAGGCCGG - Intronic
1094181393 12:27595822-27595844 GTCGCTGTTGTTGCCCAGGCTGG - Intronic
1095397323 12:41775911-41775933 GTTGCTGTTTGAGACAAGGCAGG - Intergenic
1095532956 12:43211608-43211630 GTGGCTGTTAGAGCCCAGAATGG - Intergenic
1096100820 12:48969707-48969729 TTGGCTGGACAAGCCCAGGCTGG - Intronic
1096724857 12:53553294-53553316 ATGGCTGATGGAGCCCAGGCGGG - Intronic
1097281656 12:57848205-57848227 GTAGCTGTTCAAGTCAAGGCCGG + Intergenic
1097332851 12:58351165-58351187 GTTGCATTCTAAGCCCAGGCTGG - Intergenic
1098111104 12:67122817-67122839 GTGGCAATTTGAGGCCAGGCAGG + Intergenic
1100622698 12:96294551-96294573 TTTGCTGTTAAAGCCCAGGCTGG - Intronic
1101983735 12:109429666-109429688 GTGACTGCATAAGGCCAGGCAGG + Intronic
1103770659 12:123320967-123320989 TTCGCTGTTGTAGCCCAGGCTGG + Intronic
1103819831 12:123688783-123688805 TTCGCTGTTTTTGCCCAGGCTGG + Intronic
1105025219 12:132843917-132843939 TTCGCTGTTTTTGCCCAGGCTGG - Intronic
1105038975 12:132947040-132947062 TTCGCTGTTGTAGCCCAGGCTGG + Intronic
1105356087 13:19661060-19661082 GTTGCTATGTCAGCCCAGGCTGG - Intronic
1105808600 13:23973884-23973906 AGGACTGTTTAAGCCCAGGGAGG - Intergenic
1106244157 13:27932975-27932997 GTGGCTCTTGTTGCCCAGGCTGG - Intergenic
1107143301 13:37028815-37028837 GTGCCTGTTTATGCTCAGGAGGG + Intronic
1108940290 13:55944588-55944610 TTTGCTGTTTTTGCCCAGGCTGG - Intergenic
1110321513 13:74165506-74165528 GTGGGAGTTTAAGACCAGCCTGG - Intergenic
1110635827 13:77766222-77766244 GTGGCCCTTTGAGCCGAGGCTGG + Intergenic
1110775712 13:79405994-79406016 GTTGCTGTTTCAGCCCGGGCTGG - Exonic
1111529077 13:89513233-89513255 GAGGGTTTTTAAGCCCAGGATGG + Intergenic
1115222991 14:31075767-31075789 GTCGCTGTTGTTGCCCAGGCTGG + Intronic
1115559451 14:34570096-34570118 TTCGCTGTTTTTGCCCAGGCTGG + Intronic
1115621136 14:35141906-35141928 GTTGCTGTTGTTGCCCAGGCTGG + Intronic
1116274245 14:42810604-42810626 TTCGCTGTTTTCGCCCAGGCTGG + Intergenic
1116607059 14:47013817-47013839 GTTGCTCTTTTTGCCCAGGCTGG + Intronic
1117380911 14:55161842-55161864 TTGGCTCTTTTTGCCCAGGCTGG - Intronic
1118633214 14:67724902-67724924 CTGTCAGTTTAATCCCAGGCTGG - Intronic
1121672551 14:95723979-95724001 GGGGCTGTTTGAGCCAAGGCTGG - Intergenic
1122685108 14:103500433-103500455 AAGGCTGTTAACGCCCAGGCAGG - Intronic
1124096805 15:26656194-26656216 GTGGAGGCTGAAGCCCAGGCAGG - Intronic
1125749167 15:42017098-42017120 GTGGAGGCTTCAGCCCAGGCAGG + Intronic
1125934627 15:43624456-43624478 TTTGCTGTTGATGCCCAGGCTGG + Intergenic
1126173021 15:45709900-45709922 TTCGCTGTTTTTGCCCAGGCTGG + Intergenic
1128115078 15:65100212-65100234 TTGGCTGTTATTGCCCAGGCTGG - Intronic
1128223759 15:65987296-65987318 GTGGCTGTTTAAGCCCAGGCTGG - Intronic
1129483349 15:75844222-75844244 GCTGTTGTTTGAGCCCAGGCCGG + Intronic
1129866584 15:78913635-78913657 GTGGGTGTTGAAGACCAGCCTGG + Intergenic
1130332219 15:82931301-82931323 ATGGCAGTGTCAGCCCAGGCTGG - Intronic
1131035962 15:89222100-89222122 GTGGCTGGTTAAGGCCAAGCAGG + Intergenic
1131290214 15:91100445-91100467 GTGTATATTTCAGCCCAGGCAGG - Intronic
1132243472 15:100277393-100277415 GTGGCTGTTTGATCCCAGGCAGG - Intronic
1132532433 16:459154-459176 TTCGCTGTTTTTGCCCAGGCTGG + Intronic
1132593067 16:734889-734911 GTGCCTGGTTAACCCCATGCGGG + Intronic
1132796410 16:1725725-1725747 TTCGCTGTTTTTGCCCAGGCTGG + Intronic
1134012026 16:10860978-10861000 TTGGCTCTTTTTGCCCAGGCTGG - Intergenic
1134450562 16:14360818-14360840 CTAGCTGTGTGAGCCCAGGCAGG - Intergenic
1135758221 16:25115705-25115727 TTGGCTGTTGTTGCCCAGGCTGG + Intronic
1137320187 16:47372660-47372682 TTGGGAGTTTAAGACCAGGCTGG - Intronic
1138210746 16:55161332-55161354 GTGGCTGTGTATGCTAAGGCTGG - Intergenic
1138265854 16:55658930-55658952 ATGGCTGTTTGGGCCCAGGAAGG + Intronic
1138565138 16:57827645-57827667 GTGGTTGCTTAAGCCCAAGGGGG - Intronic
1138773765 16:59695622-59695644 GTTGCTCTTTTTGCCCAGGCTGG - Intergenic
1138778641 16:59755697-59755719 GTTGCTCTTTTTGCCCAGGCTGG + Intergenic
1139445353 16:66994807-66994829 TTCGCTGTTTTTGCCCAGGCTGG - Intronic
1139776149 16:69318267-69318289 GTGGCTCTCACAGCCCAGGCTGG - Intronic
1140439684 16:74978010-74978032 CTGGCTGTTGATGCCCAGGCTGG - Intronic
1140460306 16:75134410-75134432 CTGGCTATTGATGCCCAGGCTGG - Intergenic
1140485131 16:75287687-75287709 GGGACTGCTTAAGCCCAGGGAGG + Intergenic
1141686687 16:85574339-85574361 CTGGCTGTGTGACCCCAGGCAGG - Intergenic
1141940469 16:87272722-87272744 TTCGCTGTTATAGCCCAGGCTGG - Intronic
1142444574 16:90127696-90127718 TTCGCTGTTTTTGCCCAGGCTGG + Intergenic
1142447334 16:90149611-90149633 TTGGCTCTTGTAGCCCAGGCTGG - Intergenic
1142460160 17:85720-85742 TTGGCTCTTGTAGCCCAGGCTGG + Intergenic
1142462937 17:107769-107791 TTCGCTGTTTTTGCCCAGGCTGG - Intergenic
1143089229 17:4439151-4439173 GTGGCTCTTGTTGCCCAGGCTGG + Intronic
1143548955 17:7616904-7616926 GTCGCTCTTTTTGCCCAGGCTGG - Intronic
1143558588 17:7677992-7678014 TTGGCTCTTTTCGCCCAGGCTGG + Intronic
1145973725 17:28972214-28972236 CTTGCTGTTAAAGCCCAGGGTGG + Intronic
1146583087 17:34057396-34057418 GTGGGTGTTAAAGCCCAAGGAGG + Intronic
1146978991 17:37141719-37141741 TTTGCTGTTTTTGCCCAGGCTGG + Intronic
1147117694 17:38314132-38314154 TTTGCTCTTGAAGCCCAGGCTGG + Intronic
1147402652 17:40190473-40190495 GTGGCTGTTGATGCCCAGTGCGG - Exonic
1148255921 17:46132095-46132117 TTTGCTGTTTTGGCCCAGGCAGG - Intronic
1149788562 17:59457200-59457222 GTGGCTACTTAAGACCAGGATGG + Intergenic
1149995836 17:61405547-61405569 GTGGCTGGAAAAGGCCAGGCCGG - Exonic
1150913439 17:69412471-69412493 GTGGCTGTTCAGGCCCTGCCTGG + Intergenic
1151723700 17:75872944-75872966 CTGGCTGCTAGAGCCCAGGCAGG + Intergenic
1152016278 17:77752856-77752878 GAGACTGTTTAAGCCCAAGATGG - Intergenic
1152463261 17:80452184-80452206 GTGGCTGCTTAAGCTGAGGGAGG - Intergenic
1152519997 17:80849928-80849950 GTGGCTCAGGAAGCCCAGGCAGG + Intronic
1157666108 18:49488280-49488302 CTGACTGCTTAAGCCCAGCCAGG - Intronic
1160010190 18:75101340-75101362 GGGGCTCTTTGAGCCCTGGCTGG + Intergenic
1160649874 19:218220-218242 TTGGCTCTTGTAGCCCAGGCTGG + Intergenic
1160652639 19:240144-240166 TTCGCTGTTTTTGCCCAGGCTGG - Intergenic
1160805127 19:989311-989333 GTGGCAGCTTAAGCTCCGGCAGG - Intronic
1160963860 19:1737027-1737049 TTGGCCGCTGAAGCCCAGGCAGG + Intergenic
1161010137 19:1955914-1955936 TTGGCTGTTGTGGCCCAGGCAGG - Intronic
1161361411 19:3852141-3852163 GTGGCTCTTCTGGCCCAGGCGGG + Intronic
1162135911 19:8555150-8555172 GTGGCTCTTGTTGCCCAGGCTGG - Intronic
1162283201 19:9717034-9717056 GTGACTGTTTGAGCTCAGGCAGG - Intergenic
1162956535 19:14101829-14101851 TTGGCTGTTGTTGCCCAGGCTGG - Intronic
1163538518 19:17892605-17892627 CTGGCTGTTGTTGCCCAGGCTGG - Intronic
1163757431 19:19114663-19114685 GTTGCTCTTTTTGCCCAGGCTGG + Intergenic
1164662654 19:29990691-29990713 GTGGCTGCTTAGGGCCAGGAAGG + Intronic
1164824480 19:31274411-31274433 GTGGCTGTTTTAACACAGGAGGG + Intergenic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1165490392 19:36120045-36120067 GGGGATGTTTCAGCCAAGGCTGG - Intronic
1165770205 19:38375526-38375548 GTGTGTGGTTAAGACCAGGCTGG + Intronic
1166378938 19:42344493-42344515 GGGGCTGCTGAAGGCCAGGCAGG - Exonic
1167531922 19:50023213-50023235 TTGGCTCTTTTCGCCCAGGCTGG + Intronic
1168470270 19:56634544-56634566 TTTGCTGTTGATGCCCAGGCTGG + Intergenic
925777405 2:7348445-7348467 GTTGCAATTTAACCCCAGGCTGG - Intergenic
925823286 2:7822144-7822166 GTGACTGATTGAGCCCAGGAGGG + Intergenic
926009506 2:9397034-9397056 GTAGCTGTTTAAGACTAGGAGGG - Intronic
926633530 2:15158403-15158425 CTGGCTGTGTAACCCCAGGCAGG - Intergenic
928600379 2:32898540-32898562 GTGTATGTTTAAGCTCAGGCTGG + Intergenic
931303061 2:61000092-61000114 TAGGGTGTTTAAGCCAAGGCTGG - Intronic
932436280 2:71704159-71704181 GTGGCTGTGCGGGCCCAGGCAGG - Intergenic
933126006 2:78606989-78607011 GTGCCTGTTTAAGCTCAGATTGG - Intergenic
933596005 2:84284084-84284106 GTTGCTGTTGTTGCCCAGGCTGG + Intergenic
933773155 2:85756205-85756227 GTGGCTGTCACAGACCAGGCTGG + Intronic
934751834 2:96798835-96798857 GCCACTGTTCAAGCCCAGGCAGG + Intronic
935098326 2:99968449-99968471 AAGGATGTTTAACCCCAGGCTGG + Intronic
935678077 2:105613383-105613405 TTTGCTGTTTCTGCCCAGGCTGG + Intergenic
936511435 2:113150627-113150649 TTGGCTGTTGTCGCCCAGGCTGG + Intergenic
937427080 2:121809073-121809095 TTGGCTCTTTTTGCCCAGGCTGG + Intergenic
939677137 2:145086501-145086523 GTGGCTCTTGTTGCCCAGGCTGG + Intergenic
940592619 2:155748733-155748755 CTGGGGGTTTAAGCCCAGGGAGG - Intergenic
940611228 2:155994398-155994420 GAGGCTTTTTAAGTACAGGCTGG - Intergenic
941807568 2:169724204-169724226 GTCGCTCTTGTAGCCCAGGCTGG - Intronic
943185654 2:184604198-184604220 CTGGCTCTTTTTGCCCAGGCTGG + Intronic
943240862 2:185382394-185382416 GTTGCTCTTTTTGCCCAGGCTGG + Intergenic
944432447 2:199647739-199647761 GTGGCTGTTTGTGACCTGGCTGG + Intergenic
945857586 2:215086970-215086992 GTGGCTCTTGTTGCCCAGGCTGG + Intronic
946853354 2:223929215-223929237 TTTGCTCTTTATGCCCAGGCTGG + Intronic
948313477 2:237008496-237008518 TTCGCTGTTTTTGCCCAGGCTGG + Intergenic
1168783945 20:520929-520951 ATGACTGTATAATCCCAGGCTGG + Intronic
1171869877 20:30516134-30516156 GAGGCTATTTAAACCCAGCCTGG - Intergenic
1172259526 20:33550650-33550672 TTCGCTGTTTTCGCCCAGGCTGG + Intronic
1172979550 20:38930675-38930697 GTTGCTCTTTTGGCCCAGGCTGG + Intronic
1173235279 20:41239597-41239619 TTGATTGTTTAAGCCCAGTCAGG - Intronic
1173401019 20:42726107-42726129 TTTGCTGTTTTTGCCCAGGCTGG + Intronic
1174113543 20:48212341-48212363 CTGGCTGTGTGACCCCAGGCCGG - Intergenic
1174168306 20:48600183-48600205 CTGGCTGTGTGACCCCAGGCCGG + Intergenic
1174192507 20:48750256-48750278 ATGGCTGTGTTAGTCCAGGCAGG - Intronic
1174231945 20:49052784-49052806 CTTGCTGTGTTAGCCCAGGCTGG + Intronic
1175248341 20:57594501-57594523 GTGGCCGCTTCAGCCCAGGCCGG + Intergenic
1175746237 20:61459333-61459355 GTGGCTGTTGGATCCCAGCCAGG + Intronic
1175926819 20:62475316-62475338 GTGGCTGTCTGCGCCCAGCCGGG + Exonic
1177104815 21:16942882-16942904 GTGGCACCTTAAGCCCAGGTTGG + Intergenic
1179055516 21:37928465-37928487 GTGGCTGTTTATGCCAAGCAGGG - Intergenic
1179664254 21:42899297-42899319 TTTGCTCTTTATGCCCAGGCTGG + Intronic
1181324305 22:22032912-22032934 GTGGCTGGGTCAGCACAGGCTGG - Intergenic
1181361814 22:22343417-22343439 GTGGCTGAGTCAGCACAGGCTGG - Intergenic
1181372234 22:22427723-22427745 GTGGCTGAGTCAGCACAGGCTGG - Intergenic
1181992827 22:26850559-26850581 TTGGCTCTTTTTGCCCAGGCTGG + Intergenic
1182317635 22:29458524-29458546 CTTGCTCTGTAAGCCCAGGCTGG - Intergenic
1183410249 22:37650694-37650716 GTAGCTGCTGAAGCCAAGGCTGG - Exonic
1183689548 22:39381008-39381030 GTGCATATTTTAGCCCAGGCTGG + Intronic
1184000790 22:41671871-41671893 CTGGCTCTTGTAGCCCAGGCTGG - Intergenic
1184274210 22:43400839-43400861 GTGGTTGTGTGAGCCCAGGCAGG + Intergenic
1184400044 22:44268497-44268519 CTCGCTGTTTAACCTCAGGCAGG - Intronic
1184570098 22:45317635-45317657 GTGGCTGTTTAAACCCTGGCGGG - Intronic
1185044419 22:48522090-48522112 CTTGCTGTTTAAGCCAATGCTGG - Intronic
949721734 3:6998087-6998109 TTTGCTGTTTTTGCCCAGGCTGG - Intronic
952402861 3:32979004-32979026 TTCGCTCTTGAAGCCCAGGCTGG + Intergenic
953303454 3:41803139-41803161 CTTGCTCTGTAAGCCCAGGCTGG - Intronic
955384525 3:58468856-58468878 TTGGCTGTTGTTGCCCAGGCTGG - Intergenic
958047084 3:88298431-88298453 CTGGTTGGTTAAGCTCAGGCTGG - Intergenic
958840697 3:99200935-99200957 TTTGCTGTTTTCGCCCAGGCTGG - Intergenic
960141334 3:114154442-114154464 GGGGCTCATTAAACCCAGGCGGG - Intronic
961469877 3:127105025-127105047 ATAGCTGGTTATGCCCAGGCTGG + Intergenic
961536518 3:127573979-127574001 CTGGCTGTGTGAGCTCAGGCGGG + Intronic
961647980 3:128402752-128402774 GCAGCTGTTTAAGCACTGGCTGG - Intronic
961856635 3:129877986-129878008 TTCGCTCTTTTAGCCCAGGCTGG + Intronic
962656623 3:137551863-137551885 GAGGCTGTGTAGGCCTAGGCTGG - Intergenic
963082915 3:141410924-141410946 GTGGCTGTTTAAGTCCTGGAAGG + Intronic
967117456 3:186354849-186354871 CTGGCTGGGTAACCCCAGGCAGG + Intronic
968365192 3:198179828-198179850 TTCGCTGTTTTTGCCCAGGCTGG + Intergenic
968367974 3:198201909-198201931 TTGGCTCTTGTAGCCCAGGCTGG - Intergenic
968757695 4:2425545-2425567 GTGGCCCTTCAAGCCCAGCCTGG + Intronic
969516252 4:7649675-7649697 GAGGGTGATTAGGCCCAGGCGGG + Intronic
970552870 4:17201169-17201191 CCCGCTGTTTTAGCCCAGGCCGG + Intergenic
971361794 4:25944931-25944953 CTGGCTGTTTAAAAACAGGCAGG + Intergenic
972640504 4:40920839-40920861 TTTGCTGTTTTTGCCCAGGCTGG - Intronic
973131556 4:46654139-46654161 GTGGTCCTTTAAGCCAAGGCTGG + Intergenic
973377105 4:49294194-49294216 GAGGCTATTTAAACCCACGCTGG - Intergenic
973378024 4:49300333-49300355 GAGGCTATTTAAACCCACGCTGG - Intergenic
974046851 4:56905603-56905625 TTGGCTCTTTTTGCCCAGGCTGG - Intergenic
974146921 4:57960363-57960385 TTCGCTGTTTTTGCCCAGGCTGG + Intergenic
974407677 4:61496610-61496632 TTCGCTGTTTTTGCCCAGGCTGG - Intronic
975065975 4:70064058-70064080 GTCGCTCTTTTTGCCCAGGCTGG - Intergenic
978743798 4:112168692-112168714 TTGGCTGTTGTTGCCCAGGCTGG + Intronic
979256400 4:118611624-118611646 TTGGCTCTTGTAGCCCAGGCTGG - Intergenic
979331950 4:119428912-119428934 TTGGCTCTTGTAGCCCAGGCTGG + Intergenic
979837125 4:125385049-125385071 GTTGCTCTTGATGCCCAGGCTGG + Intronic
980669515 4:135986293-135986315 GTGGCTCCTTAAAACCAGGCAGG - Intergenic
986729563 5:10625160-10625182 GAGGCTGTTTAGGCCCAATCAGG + Intronic
987069989 5:14327192-14327214 TTTGCTGTTGTAGCCCAGGCTGG + Intronic
987121636 5:14773391-14773413 GTGGATGCCTCAGCCCAGGCTGG - Intronic
988481518 5:31635402-31635424 GTCGCTCTTTTTGCCCAGGCTGG - Intergenic
990935297 5:61141195-61141217 TTCGCTGTTTTTGCCCAGGCTGG - Intronic
992635795 5:78724951-78724973 GTTGCTCTTTTTGCCCAGGCTGG - Intronic
993034750 5:82744632-82744654 GTGGTACTTTAAGCCCAGGTTGG - Intergenic
994108379 5:95972170-95972192 GAGGCTGTTTGAGACCAGCCTGG - Intergenic
994659921 5:102641422-102641444 GGTGCTAGTTAAGCCCAGGCTGG - Intergenic
994944909 5:106375146-106375168 GTGGCTCTTTTAGGCCAGGATGG + Intergenic
995881768 5:116851336-116851358 TTTGCTGTTGATGCCCAGGCTGG - Intergenic
997558699 5:134824547-134824569 TTCGCTGTTTTTGCCCAGGCTGG - Intronic
998014127 5:138718737-138718759 CTGGGAGTTTAAGACCAGGCTGG + Intronic
998526541 5:142847946-142847968 GGGGCTGTGTAAGCCCATGAGGG + Intronic
999237444 5:150107564-150107586 TTAGCTGTTTAACTCCAGGCAGG - Intronic
1001594882 5:172891849-172891871 GTGGCTGTTTATCCGCTGGCAGG - Intronic
1001797288 5:174513158-174513180 GTGGCTGTGTGAGCCCAGACAGG - Intergenic
1002425196 5:179170805-179170827 GCTGCTGTTTAATCCCAGGGAGG - Intronic
1002727192 5:181307138-181307160 TTGGCTCTTGTAGCCCAGGCTGG - Intergenic
1003097824 6:3156467-3156489 GAGGCTGTGTCACCCCAGGCAGG + Intronic
1003101553 6:3180021-3180043 GAGGCTGTGTCACCCCAGGCAGG + Intergenic
1003232852 6:4270353-4270375 GAGGCTATTAAAGCCCAGGAAGG - Intergenic
1003611063 6:7615346-7615368 GATGCTATTTAAGACCAGGCCGG + Intergenic
1005808138 6:29494273-29494295 GTGGCTTTATGTGCCCAGGCAGG + Intergenic
1006034894 6:31203419-31203441 TTGCCTGTGTAAGCTCAGGCAGG + Exonic
1006330103 6:33384287-33384309 CTCGCTGTGTTAGCCCAGGCTGG + Intergenic
1006563103 6:34930905-34930927 GTGGCTCTTGTTGCCCAGGCTGG + Intronic
1007113469 6:39327128-39327150 GGGGCTGTTTGATCCAAGGCTGG - Intergenic
1007518785 6:42435099-42435121 TTTGCTGTTTCTGCCCAGGCTGG - Intronic
1011390658 6:86848944-86848966 GTCACTGTTGAAGCCAAGGCAGG + Intergenic
1012916025 6:105171891-105171913 CTGGGAGTTTAAGACCAGGCTGG - Intronic
1013961985 6:115911787-115911809 TTGCATGTTCAAGCCCAGGCAGG - Intergenic
1015217419 6:130766240-130766262 TTGGCTGGTTAAGCCCAACCTGG - Intergenic
1015726137 6:136301535-136301557 GTGGCTCTTGTTGCCCAGGCTGG + Intergenic
1015759384 6:136641956-136641978 TTTGCTGTTTTCGCCCAGGCTGG - Intronic
1017681841 6:156872349-156872371 TTTGCTGTTTTTGCCCAGGCTGG + Intronic
1018232557 6:161689738-161689760 TTTGCTGTTTTTGCCCAGGCTGG + Intronic
1019251000 7:11076-11098 TTCGCTGTTTTTGCCCAGGCTGG - Intergenic
1019972147 7:4549797-4549819 GTTGCTGTTCCAGCCCAGGCTGG - Intergenic
1020093427 7:5354171-5354193 TTTGCTGTTTTTGCCCAGGCTGG - Intronic
1020105647 7:5421163-5421185 GTGGCTGTCCATGGCCAGGCCGG + Exonic
1023440940 7:40184143-40184165 GTGGCTCTTGTTGCCCAGGCTGG - Intronic
1024258047 7:47553816-47553838 CTGGCTCTTTTTGCCCAGGCTGG + Intronic
1025756139 7:64344270-64344292 TTTGCTCTTGAAGCCCAGGCTGG - Intronic
1025846884 7:65207451-65207473 TTTGCTGTTGATGCCCAGGCTGG + Intergenic
1025897129 7:65713341-65713363 TTTGCTGTTGATGCCCAGGCTGG + Intergenic
1025909746 7:65818800-65818822 TTGGCTCTTGCAGCCCAGGCTGG - Intergenic
1026854540 7:73744304-73744326 CTGGCTGTTGTTGCCCAGGCTGG + Intergenic
1029475372 7:100780161-100780183 GTTGCTCTTTTTGCCCAGGCTGG - Intronic
1032048711 7:128632355-128632377 CTGGCTCTTATAGCCCAGGCTGG - Intergenic
1034023518 7:147671126-147671148 CTGGCTGCTTCAGCGCAGGCAGG - Intronic
1034133192 7:148740080-148740102 TTTGCTGTTTTTGCCCAGGCCGG + Intronic
1036916593 8:12810158-12810180 ATGCCTGTTTAAGCCAAGGGAGG - Intergenic
1036953366 8:13162350-13162372 GTTGCTCTTGGAGCCCAGGCTGG + Intronic
1037851382 8:22332277-22332299 CTCACTGTGTAAGCCCAGGCTGG - Intronic
1038543374 8:28407470-28407492 GTCGCTCTTTTTGCCCAGGCTGG + Intronic
1043970146 8:86519741-86519763 TTGGCTCTTTTTGCCCAGGCTGG + Intronic
1044040119 8:87356967-87356989 GGGGCTGTTTGAGCCCAGGATGG - Intronic
1045561802 8:103271342-103271364 GGGGCCCTTTAAGCCAAGGCTGG - Intergenic
1047927408 8:129694978-129695000 GTGGGTGTTCAAGACCAGCCTGG + Intergenic
1047980860 8:130180521-130180543 GGGGCTGTTTAAGCCAAAACAGG - Intronic
1052267915 9:26595556-26595578 GAGGCTGTTAAAACCCAGCCTGG - Intergenic
1052736521 9:32347940-32347962 TTTGCTGTTTGTGCCCAGGCTGG - Intergenic
1052945398 9:34164447-34164469 TTTGCTGTTTTTGCCCAGGCTGG + Intergenic
1055095982 9:72414574-72414596 GTGGCAGTCTGAACCCAGGCAGG + Intergenic
1056608173 9:88104576-88104598 GTGGCTCTTGTTGCCCAGGCTGG - Intergenic
1056860043 9:90172685-90172707 ATGGATGTCTAACCCCAGGCAGG - Intergenic
1057137404 9:92702631-92702653 TTCGCTCTTTATGCCCAGGCTGG - Intergenic
1057785996 9:98087719-98087741 CTGGCGGTTGCAGCCCAGGCGGG + Exonic
1058261222 9:102835085-102835107 TTGGCTCTTGTAGCCCAGGCTGG + Intergenic
1060088276 9:120720936-120720958 GTGGCTGTCTTTGCCGAGGCTGG + Intergenic
1060214265 9:121729195-121729217 TTGGCTGTGTGAGCCCAGGGAGG - Intronic
1061053154 9:128207806-128207828 TTGCCTGTCTACGCCCAGGCAGG - Intronic
1061711781 9:132492973-132492995 ATGGCTGTGTCCGCCCAGGCTGG - Intronic
1061838358 9:133343599-133343621 GTGGGGGATGAAGCCCAGGCAGG - Intronic
1062040455 9:134402041-134402063 GTGGGGGTTTGAGCCCAGGTGGG + Intronic
1062686398 9:137815645-137815667 GAGGCTGGAGAAGCCCAGGCTGG + Intronic
1062749561 9:138242693-138242715 TTCGCTGTTTTTGCCCAGGCTGG + Intergenic
1062752315 9:138264614-138264636 TTGGCTCTTGTAGCCCAGGCTGG - Intergenic
1203549862 Un_KI270743v1:157881-157903 GTGGCTGTCAGAGCCCATGCTGG + Intergenic
1187939474 X:24367792-24367814 GTGGCTCTTTCCTCCCAGGCAGG + Intergenic
1189009302 X:37030404-37030426 GTTGCTGTTTGAGTCTAGGCAGG + Intergenic
1189423194 X:40875075-40875097 GTGCCTGTGTAAGCTCAGGCAGG - Intergenic
1190299883 X:49050939-49050961 TTGGCTGTTGTTGCCCAGGCTGG - Intergenic
1190305810 X:49080924-49080946 TTGGCTCTTTTTGCCCAGGCTGG + Intronic
1190711397 X:53073251-53073273 GTGGCTGTGGCAGGCCAGGCTGG + Intronic
1192314371 X:70040454-70040476 CTGGGTGTTGGAGCCCAGGCTGG + Intergenic
1195677435 X:107517729-107517751 TTCGCTGTTGATGCCCAGGCTGG - Intergenic
1196629213 X:117916126-117916148 GTCGCTGTTGTTGCCCAGGCTGG - Intronic
1198910196 X:141605331-141605353 GTCGCTTTTTTTGCCCAGGCTGG + Intronic
1199980870 X:152919757-152919779 GTGGCTGGCTGAGCCCAGGGAGG - Intronic
1201387249 Y:13454904-13454926 GTTGCTTTTGACGCCCAGGCTGG - Intronic
1201784460 Y:17758735-17758757 TTGGCAGTTTAAGACCAGTCTGG - Intergenic
1201817093 Y:18147252-18147274 TTGGCAGTTTAAGACCAGTCTGG + Intergenic