ID: 1128231128

View in Genome Browser
Species Human (GRCh38)
Location 15:66036144-66036166
Sequence GGATCAGTGATAACCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128231119_1128231128 23 Left 1128231119 15:66036098-66036120 CCAGGAGCTGGCATCCCTGGGGA 0: 1
1: 0
2: 8
3: 45
4: 307
Right 1128231128 15:66036144-66036166 GGATCAGTGATAACCACCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 76
1128231126_1128231128 -3 Left 1128231126 15:66036124-66036146 CCTTCAACCAACGGGAACAGGGA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1128231128 15:66036144-66036166 GGATCAGTGATAACCACCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 76
1128231127_1128231128 -10 Left 1128231127 15:66036131-66036153 CCAACGGGAACAGGGATCAGTGA 0: 1
1: 0
2: 0
3: 11
4: 87
Right 1128231128 15:66036144-66036166 GGATCAGTGATAACCACCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 76
1128231120_1128231128 9 Left 1128231120 15:66036112-66036134 CCCTGGGGACAACCTTCAACCAA 0: 1
1: 0
2: 2
3: 28
4: 208
Right 1128231128 15:66036144-66036166 GGATCAGTGATAACCACCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 76
1128231121_1128231128 8 Left 1128231121 15:66036113-66036135 CCTGGGGACAACCTTCAACCAAC 0: 1
1: 0
2: 3
3: 10
4: 111
Right 1128231128 15:66036144-66036166 GGATCAGTGATAACCACCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128231128 Original CRISPR GGATCAGTGATAACCACCCC AGG Intronic
906992487 1:50754085-50754107 TGATCAATCATAACCAACCCAGG - Intronic
908383968 1:63622986-63623008 GGAGCAGTGAGAGCCACACCAGG + Intronic
910683923 1:89896587-89896609 AGATCAGGGTTTACCACCCCTGG + Intronic
919269198 1:195316945-195316967 GGAACAGTAATAACTACTCCTGG - Intergenic
1067067538 10:43112302-43112324 GGAGCAGGGAGAGCCACCCCAGG - Intronic
1069795956 10:71051812-71051834 ATATCAGTGATAACCTCCCAAGG - Intergenic
1073286305 10:102391309-102391331 TGATCAGTGGTAACCAGCACGGG + Intergenic
1078184065 11:9036711-9036733 GGCTCAGTGAGAACCAGGCCTGG - Intronic
1078590086 11:12633048-12633070 TGAACAGTGCTAACCAGCCCTGG + Intergenic
1083254762 11:61489323-61489345 GAATCAGTGATGACAATCCCGGG - Intronic
1089398144 11:118149249-118149271 GGATCACTCACAGCCACCCCAGG + Intronic
1095344087 12:41128705-41128727 GGCCCAGTGCTAACCATCCCAGG + Intergenic
1101413169 12:104485868-104485890 GCATCAGTGATTACAACCCAAGG - Intronic
1101989732 12:109475128-109475150 GGATCAGTGGTTCCCAACCCTGG + Intronic
1104965810 12:132508387-132508409 GGGTCAGTGCTCACCGCCCCAGG + Intronic
1115366535 14:32563667-32563689 GGACCTGTGATGGCCACCCCAGG + Intronic
1116930850 14:50689031-50689053 GGATCAGTGATTCCCTCCTCTGG + Intergenic
1119187438 14:72652651-72652673 TGCTCTGTGATAAACACCCCAGG - Intronic
1126307344 15:47275077-47275099 GAATCATTGATATCCAACCCTGG + Intronic
1128231128 15:66036144-66036166 GGATCAGTGATAACCACCCCAGG + Intronic
1128741133 15:70084421-70084443 GGATCAGGGATTGCCACCCTGGG - Intronic
1130882737 15:88069190-88069212 AGATCAATCATAACCACCTCTGG + Intronic
1131456703 15:92587442-92587464 GTCTCAGGGATAACCACCCCAGG + Intergenic
1136024699 16:27462059-27462081 GCATCAGAGACAAGCACCCCGGG + Intronic
1137529167 16:49266179-49266201 GGATCAGGGATGCCCAGCCCAGG + Intergenic
1139118130 16:63981963-63981985 GGCTATGTAATAACCACCCCTGG - Intergenic
1140842547 16:78853763-78853785 GGTTCAGTGAAAACCTCCCTGGG - Intronic
1141627728 16:85270158-85270180 CGCTCAGTGGTAACCTCCCCGGG + Intergenic
1149017460 17:51924788-51924810 GGACCGTTTATAACCACCCCAGG - Intronic
1149682521 17:58516021-58516043 GGATCATTGTAAACCACCTCTGG + Intronic
1152863637 17:82709773-82709795 GGATCAGCGCTACCCTCCCCAGG - Intergenic
1155990219 18:32272334-32272356 GGAGCAGTGATCCCCAGCCCCGG - Intronic
1157312541 18:46562859-46562881 AGATCAGTGATTCCCACCCCTGG - Intronic
1166370307 19:42296614-42296636 GGATCAGTGATACCTGCCCTGGG + Intergenic
1168530003 19:57119825-57119847 GGTTCAGAGAAAACCAGCCCAGG - Intronic
934557107 2:95293314-95293336 GGATGAGTGTGGACCACCCCAGG - Intergenic
935281378 2:101520839-101520861 GGATCAGAGATTTCCACCACAGG - Intergenic
942110675 2:172679604-172679626 GGATCAGTGATGACCATCATAGG + Intergenic
944659032 2:201905030-201905052 GGAGCAGTGATTATCAGCCCTGG - Intergenic
946537802 2:220650338-220650360 GGATGATTGATTACCAACCCTGG - Intergenic
1172253280 20:33495016-33495038 AGATCAATGATCTCCACCCCAGG - Intronic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1175964460 20:62653523-62653545 GCCTCAGTGAGAACCAGCCCCGG - Intronic
1178688226 21:34728415-34728437 GGATCTGTGATAACCCTTCCAGG + Intergenic
1181983362 22:26782073-26782095 GGATCTGTGCTGGCCACCCCAGG - Intergenic
1184106197 22:42368811-42368833 GGATCCGTCTTGACCACCCCCGG + Intergenic
952215288 3:31272139-31272161 GAGGCAGTGATAACCACTCCTGG - Intergenic
955199970 3:56842747-56842769 GGATCAGCTATGACCACCCTAGG - Intronic
962739396 3:138351894-138351916 GGATCTCTGAAAACCAGCCCTGG + Intronic
969321539 4:6415987-6416009 GGATCAGTGACCAGCACCCCAGG + Intronic
969457434 4:7308213-7308235 GGATCAGTGTTTTCCACTCCAGG + Intronic
971120978 4:23704712-23704734 GGATCTGTGATATCGAACCCAGG + Intergenic
972279291 4:37587003-37587025 TGATCCCTGATACCCACCCCTGG - Intronic
979822071 4:125187792-125187814 GGAGCAGTGATAATAACCTCTGG - Intergenic
988738417 5:34045427-34045449 GGATCAGTGATTCCTAACCCTGG - Intronic
988834019 5:35013986-35014008 GCAGCAGTCATAACCACTCCAGG - Exonic
991758192 5:69899255-69899277 GGATCTGGGGTAGCCACCCCTGG + Intergenic
991758366 5:69900071-69900093 GGATCTGGGGTAGCCACCCCTGG + Intergenic
991837595 5:70775137-70775159 GGATCTGGGGTAGCCACCCCTGG + Intergenic
993421914 5:87713686-87713708 GGTTCAGTTGTAACCACCCAAGG + Intergenic
1004073700 6:12326012-12326034 GGAACACTGATAACTCCCCCTGG + Intergenic
1005734467 6:28732596-28732618 GGATCAGTCATGACCTCCCACGG - Intergenic
1006698834 6:35955253-35955275 GGATGAGTGATCTCCTCCCCTGG + Exonic
1007288482 6:40765709-40765731 GGATCAGTGATGCCCAGCCCTGG + Intergenic
1015042903 6:128742980-128743002 GGCTCAGTGTTAACCAGCTCAGG - Intergenic
1015531026 6:134221387-134221409 GGCTCAGTGAGTACAACCCCAGG - Intronic
1018641356 6:165907302-165907324 GGAACAGTGTTACCCACCTCTGG - Intronic
1018932726 6:168252474-168252496 GTACCAGTGAGAACCACCACAGG + Intergenic
1022550665 7:31236390-31236412 GGATCAGTGAGAAAAAGCCCGGG + Intergenic
1026666601 7:72345670-72345692 GGGGCACTGATAAACACCCCAGG + Intronic
1028501788 7:91527361-91527383 GGAACTGTGATAACCACTACAGG + Intergenic
1029322136 7:99772648-99772670 GGATCTGTGATAGCCAGCACAGG + Exonic
1030113425 7:106045420-106045442 GGACCATTGAGAACTACCCCTGG + Intergenic
1031156005 7:118113204-118113226 GAATCAGTGATAACCATTCTGGG - Intergenic
1033195877 7:139326875-139326897 GGTTCAGTGAAAACAATCCCAGG - Intergenic
1036392723 8:8338397-8338419 GGATCAGAGCTAACCAGCACAGG + Intronic
1037226003 8:16590719-16590741 GGATCAGTAATAACAACCAACGG + Intergenic
1041540564 8:58980362-58980384 AGATCACTGATAGCCACCACAGG - Intronic
1059485604 9:114624301-114624323 GGCTGAGTGATAACCATACCAGG - Intronic
1062731972 9:138115094-138115116 GGATTAGTGATGTCTACCCCAGG - Intronic
1189856456 X:45229421-45229443 GGGTCAGAGAGAGCCACCCCGGG + Intergenic
1190302438 X:49064604-49064626 GGGTCAGTGATCACCACCCAGGG + Exonic