ID: 1128231498

View in Genome Browser
Species Human (GRCh38)
Location 15:66038690-66038712
Sequence CCTATTATGAAACAGATACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128231492_1128231498 18 Left 1128231492 15:66038649-66038671 CCCATTGCTTCAGTTACAACTAC 0: 1
1: 0
2: 2
3: 11
4: 174
Right 1128231498 15:66038690-66038712 CCTATTATGAAACAGATACCAGG 0: 1
1: 0
2: 0
3: 11
4: 108
1128231493_1128231498 17 Left 1128231493 15:66038650-66038672 CCATTGCTTCAGTTACAACTACT 0: 1
1: 0
2: 2
3: 23
4: 195
Right 1128231498 15:66038690-66038712 CCTATTATGAAACAGATACCAGG 0: 1
1: 0
2: 0
3: 11
4: 108
1128231491_1128231498 19 Left 1128231491 15:66038648-66038670 CCCCATTGCTTCAGTTACAACTA 0: 1
1: 0
2: 1
3: 21
4: 173
Right 1128231498 15:66038690-66038712 CCTATTATGAAACAGATACCAGG 0: 1
1: 0
2: 0
3: 11
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128231498 Original CRISPR CCTATTATGAAACAGATACC AGG Intronic
904375337 1:30077904-30077926 CCTACTATGAAGCAGAGGCCTGG - Intergenic
906982015 1:50641802-50641824 CGTATTTTGAAACTGTTACCAGG + Intronic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
911069182 1:93818638-93818660 CATATAATGAAACAAATGCCTGG - Intronic
911233235 1:95382450-95382472 CCCTTTATGAAATAAATACCTGG - Intergenic
923242974 1:232103728-232103750 TCTAATATGAAACAGAGGCCTGG + Intergenic
924207834 1:241732517-241732539 CCCATCAAAAAACAGATACCTGG + Intronic
1063144333 10:3283263-3283285 GCTATTATAAAACAAATCCCAGG - Intergenic
1063555198 10:7072223-7072245 CTTATTAGGAAACAGCTACTAGG + Intergenic
1069628456 10:69882498-69882520 CCTATTATGTGACAGGTGCCTGG - Intronic
1071259530 10:83907429-83907451 CCCTTTATGAAAGAAATACCTGG - Intergenic
1077717044 11:4591902-4591924 CCTATAATGGAACAGATAGTGGG + Intergenic
1078209445 11:9258579-9258601 CTTACCATGAAACAGAAACCTGG + Intronic
1078236462 11:9489553-9489575 TCTGGTATGAAACATATACCAGG - Intronic
1079294977 11:19225151-19225173 TCTCTTATGACACAGATACTTGG + Intronic
1085662961 11:78386453-78386475 TCTACAAAGAAACAGATACCTGG - Intronic
1085866592 11:80302231-80302253 CCTATTGTGGACCAGATACATGG + Intergenic
1088711937 11:112516207-112516229 CCTATTTTTAAACAGAATCCAGG - Intergenic
1095600542 12:44008120-44008142 CCTACAAAGAAACAGATACCTGG + Intronic
1096402852 12:51321718-51321740 CCTATTATGGACCAGAGACAGGG - Intronic
1096407186 12:51352391-51352413 CATATTATGAAACTGAGTCCAGG - Exonic
1099182213 12:79481958-79481980 CATATTATGAATCATATTCCAGG - Intergenic
1099218920 12:79889079-79889101 ACTAATATGAAACAAATTCCTGG + Intronic
1106177239 13:27341866-27341888 CATATGAGGAAACAGAGACCAGG + Intergenic
1109835918 13:67857653-67857675 ACTATTATTAAAGAGAGACCTGG - Intergenic
1110325500 13:74210071-74210093 AATATTATAAAACAGATACCTGG + Intergenic
1110443306 13:75549371-75549393 CCTATTCTGAGACAGACGCCAGG - Intronic
1111768226 13:92561966-92561988 CATATAAAGAAACAGATATCAGG - Intronic
1112990431 13:105506771-105506793 CTTATGATGAAACAGATAGAAGG - Intergenic
1114334041 14:21669311-21669333 CTTATTATGTACCAGATACTAGG - Intergenic
1117648152 14:57874237-57874259 GCTATTATGGAGCAAATACCTGG - Intronic
1121556916 14:94845092-94845114 CCTATGAGGAAACAGAGGCCAGG - Intergenic
1126364198 15:47877087-47877109 CATATTATGTAGCAGATTCCTGG - Intergenic
1126439004 15:48666839-48666861 GTTATTCTGAAGCAGATACCAGG - Intergenic
1128210612 15:65898489-65898511 ACTAATATGAAACAAATACTGGG - Intronic
1128231498 15:66038690-66038712 CCTATTATGAAACAGATACCAGG + Intronic
1128556212 15:68633617-68633639 CCCATAAAGAAATAGATACCAGG - Intronic
1131809807 15:96161125-96161147 CCTTTTCTGAAAGAGTTACCAGG - Intergenic
1132182378 15:99767463-99767485 CATATAAAGAAACAGATATCAGG + Intergenic
1132261442 15:100428534-100428556 ACTAGTATGATACAGATAACTGG - Intronic
1135190739 16:20352431-20352453 CCTATTATGTGCCAGGTACCAGG - Intronic
1139063371 16:63282970-63282992 GCTTTTTTGAAACAGGTACCTGG - Intergenic
1139415321 16:66803398-66803420 TTTATTATAAAACAGATACAAGG - Intronic
1140299722 16:73745251-73745273 CATATTATGAAACAACTACTAGG - Intergenic
1140834110 16:78777712-78777734 CCTATTATGTGCCAGATACTAGG + Intronic
1150302944 17:64061323-64061345 CCTAATCTGAAACAGTGACCTGG - Intronic
1159040133 18:63317682-63317704 CTGCTTATGAACCAGATACCAGG - Intronic
1164054745 19:21613027-21613049 CCTATTATGTATCAGATATTTGG - Intergenic
1164371865 19:27650404-27650426 ACTATAATGATACAGACACCTGG - Intergenic
924968676 2:102331-102353 CCTACTATGATACAGAAACCTGG - Intergenic
930370252 2:50492493-50492515 CCTATAATGAAACAGAGCCACGG + Intronic
933627602 2:84619304-84619326 CCTAGTATGTCACACATACCTGG - Intronic
933881472 2:86674103-86674125 CCTATTAGCACACAGAGACCTGG + Intronic
934311989 2:91875864-91875886 ACCATTATGATACAGATATCTGG + Intergenic
938882688 2:135607347-135607369 CCTATTATGTACCAGACACCAGG + Intronic
939532151 2:143376780-143376802 CCTATAATAAAACATAAACCTGG + Intronic
940026636 2:149215297-149215319 CCTCTGGTGAAACAGTTACCAGG + Intergenic
942513901 2:176731299-176731321 CCTCTTATGCAATAGATACATGG - Intergenic
944066381 2:195623517-195623539 CTTACTATGAAACAAATAACTGG + Intronic
946691175 2:222309433-222309455 CCCATTATGACAGAGGTACCTGG - Intergenic
1170358979 20:15523730-15523752 CACAATATGAAACAGAGACCTGG - Intronic
1170823168 20:19771374-19771396 TATATTATGAAACATATACCTGG - Intergenic
1172575335 20:36003778-36003800 CCTCTTATGAACCAGCTACTTGG + Intronic
1173154324 20:40595123-40595145 CCTACTATGCACCAGATACTGGG + Intergenic
1175951750 20:62587373-62587395 CCTCTTGTAAAACAGATCCCTGG + Intergenic
1177220898 21:18191392-18191414 CCTCATATGAAACAGTTGCCAGG + Intronic
1177641734 21:23852420-23852442 GCAATAATGAAACAGATACTGGG + Intergenic
1178098062 21:29236759-29236781 CCTATTCTGAAATAAATACAAGG - Intronic
1180261580 21:46673640-46673662 CCTACTATGATACAGAAACCTGG + Intergenic
1182038509 22:27218287-27218309 CCGATGAAGAAACAGATACGAGG + Intergenic
949768127 3:7549628-7549650 CCTATTTTGAAAAAGATACGGGG - Intronic
950195804 3:11008337-11008359 CCAATGGTGAAACAGATTCCAGG - Intronic
957586324 3:82137124-82137146 CCTATTATTAAACAAATAATAGG + Intergenic
958890804 3:99780727-99780749 AGTATTATGTAACAGATGCCAGG - Intronic
958995669 3:100902345-100902367 CCTATTATGCAGCAGAATCCAGG + Intronic
961165672 3:124762073-124762095 AATATGATGAAACAGAGACCTGG - Exonic
961792158 3:129384053-129384075 CCGACTATGAACCAGATGCCTGG - Intergenic
964889351 3:161518156-161518178 CATATTACGAATCAGATAACGGG + Intergenic
967361385 3:188636003-188636025 CAGATTAAGAAACAGATCCCTGG + Intronic
970051473 4:11919339-11919361 TCTTCTATGAAACAGATCCCTGG + Intergenic
970063997 4:12070210-12070232 CCTATTATTAACCAAATGCCTGG + Intergenic
971761953 4:30777780-30777802 CCTATTATTAAAGAGGTATCTGG + Intronic
974744686 4:66057014-66057036 GCAATTATGAGACAGATACAGGG + Intergenic
976892098 4:90062123-90062145 TCTTTTATGAAACAGAAAGCTGG - Intergenic
979556735 4:122056270-122056292 CATGTGATTAAACAGATACCTGG - Intergenic
979799092 4:124884803-124884825 CCTATTATGAAACAGTTAAAGGG + Intergenic
979866079 4:125755010-125755032 CCAATTAGCAAACAGATACTTGG + Intergenic
980872890 4:138630326-138630348 TCTATTATGGAACTGATACGAGG + Intergenic
983486588 4:168338971-168338993 CCTCTTTTGAAACGGATACCAGG + Intergenic
983878119 4:172900790-172900812 CCTATTAAGCAAGAGATACCTGG + Intronic
983954349 4:173679640-173679662 CTTAAGATGATACAGATACCTGG - Intergenic
986943578 5:12987315-12987337 TCCATTGTGAAACAGATACCTGG + Intergenic
988897655 5:35695145-35695167 TCTCTTAAGAAACAGATAACAGG - Intronic
989204945 5:38800961-38800983 ACTATTAAGAAACAGATAAAGGG + Intergenic
990843939 5:60115496-60115518 CCTACTATGTACCAGATACAGGG + Intronic
993993932 5:94696834-94696856 TCTATCATGACAAAGATACCTGG - Exonic
995382381 5:111549523-111549545 CCTGTTATGTGACAGATAACAGG + Intergenic
996312089 5:122118118-122118140 CCTAATATTAAACAAATACAAGG - Intergenic
1000756379 5:165165810-165165832 CCTATGAAGAAAGAGATATCAGG - Intergenic
1008376675 6:50799921-50799943 CCTATTAAGAAAATGATGCCAGG + Intergenic
1008935913 6:56992156-56992178 CCTCTTGAGAAACAGAAACCAGG - Intronic
1009367180 6:62864666-62864688 GCTATTATGAACCATATCCCAGG + Intergenic
1018080692 6:160257274-160257296 CCTTTTATTAAACAGACAGCAGG - Intronic
1022435817 7:30383866-30383888 CCTATAATAAAACAGCTATCAGG + Intronic
1025652636 7:63484933-63484955 TCTATTTTGAAACAGCTACTGGG + Intergenic
1026413629 7:70155047-70155069 CCTATAATGAAACATCCACCTGG - Intronic
1026831476 7:73612841-73612863 CCTATGCTGAGACAGATACTGGG + Intronic
1028282506 7:88948454-88948476 CCCTTTATGAAAGAAATACCTGG + Intronic
1037399668 8:18482428-18482450 GCCATTGTGAAACAGATATCAGG - Intergenic
1038925249 8:32131886-32131908 CCTCTTATTAAAAAGATTCCTGG + Intronic
1040609266 8:48966495-48966517 CTTATTATGAGCCAGATTCCGGG + Intergenic
1045269349 8:100649132-100649154 CCTATTGTGAAACAGGGTCCTGG - Intronic
1049318884 8:141985310-141985332 CCTATGTTGAAAAAGATACTTGG - Intergenic
1051422048 9:16898330-16898352 CCTATTCAGTAATAGATACCTGG + Intergenic
1187431873 X:19232468-19232490 CCTACTATGTACCAGATACTGGG - Intergenic
1188720827 X:33521177-33521199 CCTTTTATAAAAGAAATACCTGG + Intergenic
1188948999 X:36345280-36345302 CCTTTCATGAAACCGATCCCTGG - Intronic
1194590420 X:95793742-95793764 CTTATTAAGACAAAGATACCTGG - Intergenic
1195651772 X:107292280-107292302 CTTATTAAGACACAGATTCCTGG + Intergenic
1198033450 X:132777992-132778014 CCGATTATGCAGCAGACACCGGG + Intronic