ID: 1128231544

View in Genome Browser
Species Human (GRCh38)
Location 15:66038957-66038979
Sequence TGCCAGTGCAGTCTAGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128231536_1128231544 25 Left 1128231536 15:66038909-66038931 CCCTTGGGCACCTGTAGGGCTTA 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1128231544 15:66038957-66038979 TGCCAGTGCAGTCTAGGGAATGG 0: 1
1: 0
2: 2
3: 12
4: 164
1128231537_1128231544 24 Left 1128231537 15:66038910-66038932 CCTTGGGCACCTGTAGGGCTTAA 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1128231544 15:66038957-66038979 TGCCAGTGCAGTCTAGGGAATGG 0: 1
1: 0
2: 2
3: 12
4: 164
1128231538_1128231544 15 Left 1128231538 15:66038919-66038941 CCTGTAGGGCTTAACAGTTCACT 0: 1
1: 0
2: 1
3: 2
4: 57
Right 1128231544 15:66038957-66038979 TGCCAGTGCAGTCTAGGGAATGG 0: 1
1: 0
2: 2
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128231544 Original CRISPR TGCCAGTGCAGTCTAGGGAA TGG Intronic
900420485 1:2554022-2554044 TGCCAGTGCAGGCCAGGCAGGGG - Intergenic
900423940 1:2567639-2567661 TGCCAGTGCAGGCCAGGCAGGGG + Intergenic
900594910 1:3476310-3476332 TGCCGGTGCAGTCCTGGGGATGG - Intronic
901142159 1:7042271-7042293 TGCCAGGGCAGCCCAGGGAAGGG - Intronic
903349548 1:22709999-22710021 TCCCAGTGCAGTTTGGGGATGGG - Intergenic
904609702 1:31718714-31718736 TGCCTGTGCAGGCCTGGGAAGGG - Intergenic
905033766 1:34904432-34904454 TGCCAGTGCAGGCAAGGCAGCGG + Exonic
905230234 1:36510596-36510618 TGTCAGTGTAGGCTCGGGAATGG + Intergenic
905521315 1:38602818-38602840 AGCAAGTGCATTCTAGGCAAAGG + Intergenic
905695039 1:39967793-39967815 TGGCACTGCTGACTAGGGAAGGG - Exonic
909606981 1:77517438-77517460 TAGCAGTGCAGCCTAGGCAATGG + Intronic
911060810 1:93746258-93746280 TGCCAGTCCTGTCTAGGAGATGG + Intronic
913476887 1:119246315-119246337 GGCCAGGGCAGTCTAGGACAAGG - Intergenic
914457908 1:147853965-147853987 TGCCTGTGCAGTCTTGGGTGAGG + Intergenic
916172683 1:162012452-162012474 TGCCAGTACATTCTGGGGAGCGG + Intronic
916852154 1:168714398-168714420 TGGCAGTGGGGTCTTGGGAAGGG - Intronic
917902756 1:179559496-179559518 TGCAAAGGCAATCTAGGGAATGG - Intronic
918128577 1:181605399-181605421 TGCCAGTGCTGCCTTGGGCATGG - Intronic
921849691 1:219921828-219921850 TGCCAGTGCACTGTAGTTAATGG - Intronic
922082813 1:222314109-222314131 TGGCTGGACAGTCTAGGGAAAGG - Intergenic
922108227 1:222531262-222531284 TGCCGGTGCTGTCTGGGAAAGGG - Intronic
922763962 1:228148214-228148236 GGCCTGTGCAGGGTAGGGAAGGG - Intronic
923314852 1:232770369-232770391 TGGCAGTGCATTCTCGGAAAGGG - Intergenic
1063356144 10:5400224-5400246 TGCCAGTGCCTTCTAGCAAATGG + Intronic
1063446052 10:6118084-6118106 TGGCAGAGCAGTCTATGGAGGGG + Intergenic
1064294141 10:14062842-14062864 TGCCATTGCACTCCAGTGAAAGG + Intronic
1066768015 10:38820417-38820439 TTCCATTGCAGTCCATGGAAAGG + Intergenic
1069775331 10:70923889-70923911 TGCCAGTCCAGGCCAGGGCAGGG + Intergenic
1070322068 10:75362018-75362040 AGCCACTGCAGCCTTGGGAAGGG - Intergenic
1070585818 10:77765219-77765241 TGCCACTGCAGTCTAGTCTAGGG + Intergenic
1072217149 10:93297076-93297098 TGCCAGAGGAGGCTAGGGGAAGG - Intergenic
1074611380 10:115025329-115025351 GGGCAATGAAGTCTAGGGAATGG + Intergenic
1075813250 10:125244313-125244335 TGCCATTTCAGACTTGGGAATGG - Intergenic
1076330550 10:129661905-129661927 TGACAGTGAAGCCTATGGAAAGG - Intronic
1076435337 10:130437391-130437413 TGCAAGGGCAGTCTAGGGGCAGG - Intergenic
1077923540 11:6658806-6658828 TGCCACTGAAGCCCAGGGAATGG + Intergenic
1078661167 11:13287236-13287258 CCCCAGTGCATTCTAGGGTAAGG + Intronic
1078841083 11:15075982-15076004 GGCCAGGGCAGTGTAGAGAAGGG - Intronic
1079129308 11:17738214-17738236 TCCCAGTCCACTCTGGGGAAAGG - Intronic
1081080499 11:38733861-38733883 TCCCTGTGCAGCCTAGGGACTGG - Intergenic
1083952599 11:65965231-65965253 GGCCAGGGCAGGCAAGGGAAGGG + Intronic
1084191402 11:67500553-67500575 GGCCAGTGCAGTCCAGGAATGGG + Intronic
1084814269 11:71636950-71636972 TGCAAGGACAGACTAGGGAAGGG - Intergenic
1085137176 11:74102073-74102095 TGGCAGTGCAGTGAAGGTAAAGG + Intronic
1088793290 11:113245571-113245593 GGCCAGTGCAGACTAGGGAATGG - Intronic
1089005245 11:115085337-115085359 TTCCAGTGCAGTGCTGGGAAAGG + Intergenic
1095628957 12:44351893-44351915 TGCCAATGCTGTGTAGAGAATGG - Intronic
1096110006 12:49023001-49023023 TGGAAGTGCAGCCTTGGGAAAGG + Intronic
1096264074 12:50110151-50110173 TGCCAGGGCAGCCTGGGGGAGGG - Exonic
1096717837 12:53501651-53501673 TTCCAGTGCAGTCTGGGAACCGG - Intronic
1100140553 12:91613524-91613546 TCCCAGTGGAGTCCAGAGAAGGG + Intergenic
1101646484 12:106635246-106635268 TGCCAGTGCAAGCTAGGTAGAGG + Intronic
1104302338 12:127575769-127575791 AGACAGTTCAGTCTATGGAATGG - Intergenic
1105944988 13:25181514-25181536 TACCAGGTCAGTCTAGGGCAGGG - Intergenic
1110471147 13:75861662-75861684 TGCTAGTACATTATAGGGAAGGG - Intergenic
1112728961 13:102338034-102338056 TGCCTGTACATTCAAGGGAAAGG + Intronic
1113354220 13:109562695-109562717 TGCCAGGTCAGTCAGGGGAATGG + Intergenic
1114143280 14:19941994-19942016 TGGCAGTGAAGCCTAGGGTATGG - Intergenic
1118793542 14:69118025-69118047 TGCAAGTGATGTCAAGGGAAAGG - Intronic
1119754636 14:77106871-77106893 GGCCAGGACAGTCCAGGGAAGGG + Intronic
1121426356 14:93854900-93854922 AGCCAGAGCAGTCTAGGCAGAGG + Intergenic
1122466656 14:101938344-101938366 TGTCACTGCAGACTAGGGAAGGG - Intergenic
1122780344 14:104140820-104140842 TGCCAGCGCCAGCTAGGGAAGGG - Intronic
1125590335 15:40850717-40850739 TGCCAGAGCAGCCAAGGGAATGG - Intronic
1128228995 15:66021940-66021962 GGACAGGGCAGTCCAGGGAAGGG + Intronic
1128231544 15:66038957-66038979 TGCCAGTGCAGTCTAGGGAATGG + Intronic
1130005591 15:80093852-80093874 TTCCAGTGTAGTTTCGGGAAGGG + Intronic
1130118738 15:81028385-81028407 CACCAGTGCAGTCTAGAGAAAGG + Intronic
1130306386 15:82714695-82714717 TGGCAGTTGAGTCTGGGGAAGGG - Intergenic
1132110527 15:99099348-99099370 TTCTGGTGCAATCTAGGGAAGGG - Intronic
1137479843 16:48843074-48843096 TGGCAGTGCAGACAAGGGGAGGG + Intergenic
1138071490 16:53997069-53997091 TGCCATTGCACTCCAGGCAATGG + Intronic
1138932851 16:61682445-61682467 ATCCACAGCAGTCTAGGGAATGG + Intronic
1140800121 16:78479588-78479610 TGACAGTCTATTCTAGGGAATGG - Intronic
1142541996 17:666991-667013 TCTCAATGCAGTCAAGGGAATGG + Intronic
1143186142 17:5011621-5011643 TGACACTGCAGTGTAGGGAGGGG + Intronic
1143344909 17:6242320-6242342 TACCATTGCAGTCTAGGCGAGGG - Intergenic
1143993865 17:10990075-10990097 TGCCAGTGGATTGCAGGGAAGGG + Intergenic
1145777607 17:27540344-27540366 TCCCAGTGGAGCATAGGGAAGGG + Intronic
1149507178 17:57204134-57204156 CTCCAGTGCAGGTTAGGGAAAGG - Intergenic
1149654713 17:58304218-58304240 TCCCACTGTAGTCCAGGGAATGG - Intronic
1150784016 17:68148350-68148372 TGGGAGTACAGTCTAGGCAAAGG - Intergenic
1153562602 18:6386309-6386331 TGCCATTGATGTCTGGGGAAGGG + Intronic
1153567967 18:6439231-6439253 GACCAGAGCAGGCTAGGGAAGGG - Intergenic
1160527019 18:79544167-79544189 AGCCAGTGCTGTCTTGGGAAGGG - Intergenic
1162819854 19:13216101-13216123 TGGCAGTGGAGACTTGGGAAAGG - Intronic
1162975976 19:14207092-14207114 TTCCAGTGAAGTATAAGGAAAGG + Intergenic
1164500943 19:28819688-28819710 TGCCAGTGCAGGTGAGGGCATGG + Intergenic
1164586429 19:29478921-29478943 AGCCAGTGGGGTCTGGGGAAGGG - Intergenic
1165662838 19:37597319-37597341 TTCCAGTTCAGGCTAGGAAAAGG + Intronic
1165804407 19:38571929-38571951 TCCCAGTCCAATCTCGGGAATGG + Intronic
925618528 2:5767490-5767512 AGCCATTGCAATGTAGGGAAAGG - Intergenic
926510645 2:13773601-13773623 CGCCACTTCAGTCAAGGGAAAGG + Intergenic
927054250 2:19355321-19355343 GGCCAGTGCATCCCAGGGAAGGG - Intronic
927138062 2:20111745-20111767 TGCCTGTGCAGTCAGGGGCAGGG + Intergenic
927430259 2:23021372-23021394 TACCAATGCAGGTTAGGGAAGGG - Intergenic
928902937 2:36341015-36341037 TGCCACTGCACTCTAGGTCAAGG - Intergenic
934604300 2:95682574-95682596 AGCCAGGGGAGTCCAGGGAAAGG - Intergenic
935808263 2:106770253-106770275 TGACAGTGCAATCTAGGTGATGG - Intergenic
936516037 2:113182309-113182331 AGCAAGTGCAGGTTAGGGAAGGG - Intronic
937857152 2:126680683-126680705 TGCAATTGCAGCCCAGGGAAAGG + Intronic
942495548 2:176536168-176536190 TGGCTGTGCAGTCAGGGGAAGGG + Intergenic
945296028 2:208172293-208172315 TGACAGGGCATTCTAGGAAATGG - Intronic
946364413 2:219239882-219239904 TGGGAGTGGAGTCTGGGGAAAGG - Intronic
947132222 2:226940472-226940494 TGCCATTTAAGTCTTGGGAAGGG + Intronic
948427418 2:237896497-237896519 CGGCAGTGCAGACTGGGGAACGG - Intronic
1169074738 20:2753681-2753703 AGACAGTGCAGTCTCGGCAATGG - Intronic
1169437883 20:5610121-5610143 AGCCAGTGGAGTCTGGGGAGAGG + Intronic
1169657275 20:7939172-7939194 TGCCAGGGAAGTCATGGGAAGGG - Intronic
1172508129 20:35479308-35479330 TGCCAGGGCAGTCCAGGAGAAGG + Exonic
1180188717 21:46152804-46152826 TGCAAGAGCAGTCAAGGGCAGGG + Intronic
1182799748 22:33022305-33022327 AGGCAGTGAAGTCTAGGGACAGG + Intronic
1183405319 22:37627684-37627706 TGCCAGTGCAGTGCGGGGACAGG - Intronic
1183598997 22:38829241-38829263 TGCAATTGCTGTCTAGGGCAGGG + Intronic
1184820841 22:46908229-46908251 TGGCAGTGGAGTCGGGGGAAGGG + Intronic
949836492 3:8275482-8275504 TGTCAGAGCAGCCCAGGGAAGGG + Intergenic
950962115 3:17118211-17118233 TGCCAGTGCTGTGGAGGGAGGGG - Intergenic
951689327 3:25379224-25379246 TGCCAGAGCATACTAGGGCATGG + Intronic
953787559 3:45922416-45922438 TGCCACTGCAGAGTAGGAAATGG + Intronic
954962081 3:54575643-54575665 GGCCAGTGCAGTCTTGGAGAGGG + Intronic
960134280 3:114089961-114089983 TGACAGTGCTGTGTAGGGCAGGG + Intergenic
960541406 3:118865966-118865988 TGGAAGTGCAGCCTAGGGTAAGG + Intergenic
960873985 3:122278422-122278444 TGGCAGCACAGTGTAGGGAATGG - Intronic
961642318 3:128372350-128372372 TGCCATGGCAGTCCAGGGCATGG - Intronic
963445058 3:145395296-145395318 TGGCAGTGCAGAGAAGGGAAGGG + Intergenic
963480703 3:145869885-145869907 TGGCAGGGCAGCCTAGGAAAAGG + Intergenic
967370850 3:188744406-188744428 TGGCAGTGCAGTTGCGGGAAGGG - Intronic
967830275 3:193912708-193912730 AGCCAGTGCAGGCTATGGCAAGG - Intergenic
968082032 3:195853159-195853181 TGCCTGTGCCGTCGAGGGATGGG - Intergenic
969965406 4:10988987-10989009 TGACTTTGCAGTCTAGAGAATGG - Intergenic
970200634 4:13601004-13601026 GACCAGTGCAGTCTCAGGAAAGG - Exonic
973011550 4:45081643-45081665 TGCCAGAGGATTCCAGGGAATGG - Intergenic
975717717 4:77221153-77221175 TGCCAGTGCTGTCTTGGGACTGG - Intronic
986485398 5:8231074-8231096 TTCCAAGGCAGTTTAGGGAAGGG + Intergenic
987048542 5:14129790-14129812 TACCAGTGCAGCCTGGGGCAGGG - Intergenic
989162724 5:38407104-38407126 TGCCAGTGCACCCTGGGCAAAGG + Exonic
992242262 5:74784466-74784488 TGCCACTGCAGTCCAGCCAAGGG + Intronic
994306051 5:98205598-98205620 TGGAAGTGCAGTCTGGGAAATGG + Intergenic
997826584 5:137112040-137112062 TGCCAGTGCAGTGGAAGGAAGGG - Intronic
998132906 5:139660154-139660176 TGCCAGTGCAGTGAGGGGAGCGG + Intronic
998570430 5:143252016-143252038 TGCTAGTACAGTCAGGGGAAAGG - Intergenic
998896452 5:146805256-146805278 TGCTTCTGCGGTCTAGGGAAAGG - Intronic
1000012490 5:157245808-157245830 TGCCGGTGAAGTCTCAGGAATGG + Intronic
1000892503 5:166816228-166816250 TGCCAGTGCACTCCAGGGTGAGG + Intergenic
1001292480 5:170473735-170473757 AGGAAGTGCAGTCGAGGGAAAGG - Intronic
1003133248 6:3413448-3413470 TCCCAGGGCAGGCTGGGGAAGGG + Intronic
1005940136 6:30554740-30554762 TGACAGTGTACTCTAGGGACAGG - Intronic
1006782897 6:36644089-36644111 TCCTAGTGCAGGCTATGGAAAGG - Intergenic
1007665152 6:43509452-43509474 TGCCAGGGGAGTGTATGGAAGGG + Intronic
1014599620 6:123394135-123394157 TGCCACTGCAGTTTAGGGAAGGG - Intronic
1020139586 7:5605261-5605283 TGCCTGTGGAGTCTGGGGAGGGG - Exonic
1022224809 7:28352247-28352269 TGCCTGAGCAGTGTTGGGAATGG + Intronic
1024598721 7:50961564-50961586 TGCCAGTGCCCTATAGAGAAAGG + Intergenic
1026324371 7:69296063-69296085 TGGCAGAGCAGGCCAGGGAATGG + Intergenic
1028540550 7:91938555-91938577 TGCCACTGCACTCTAGAGTAAGG - Intergenic
1028609108 7:92689095-92689117 TGCCAGTGAATTCTAGGGTATGG + Intronic
1036702624 8:11023191-11023213 GGCCAGCTCAGTCTAGGAAATGG - Intronic
1037285675 8:17296458-17296480 GGCCAGTGCAGTATAAGGAAAGG - Exonic
1038318577 8:26508500-26508522 TCCCAGTGAGGTCCAGGGAAAGG - Exonic
1039359137 8:36856656-36856678 TGCTAGTGTAGTCTAGGAACTGG - Intronic
1039466679 8:37789515-37789537 TGTCAGTGCTGTGAAGGGAAAGG - Intronic
1040886150 8:52266132-52266154 TGCAAGAGCAGTTTTGGGAATGG + Intronic
1040920929 8:52616011-52616033 TTCCAGAGCAGTCTAAGAAAAGG + Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1042372308 8:68005789-68005811 TGAGTGTGCATTCTAGGGAATGG - Intronic
1043796834 8:84553201-84553223 TGCCACTGCACTCCAGGGACTGG - Intronic
1045486639 8:102636669-102636691 TGGCAGGGCAGGCGAGGGAAAGG - Intergenic
1048462638 8:134635189-134635211 GGGCAGTGCAGACTGGGGAACGG + Intronic
1049494500 8:142923429-142923451 CGCCAGTGCAGTCAGGGGAAGGG + Intergenic
1050962759 9:11757604-11757626 TTCCAGTGCACTCTAGGTGATGG + Intergenic
1051283340 9:15466541-15466563 TGCCACTGAATTCAAGGGAATGG - Intronic
1052871765 9:33514485-33514507 TGCCAATGCAATGCAGGGAAGGG - Intergenic
1058211740 9:102177636-102177658 TGCCACTTCAGTTTAGGGACAGG + Intergenic
1062541882 9:137045247-137045269 TGCCAGTGCCCTCGAGGGCAGGG + Intronic
1188885711 X:35546837-35546859 TCCCAGAACAGTCTTGGGAAGGG - Intergenic
1190057750 X:47191477-47191499 TCCCAGCTCAGGCTAGGGAAGGG + Intronic
1199856622 X:151764079-151764101 TCCCAGAGCAGGCTAAGGAAAGG + Intergenic
1201791664 Y:17848081-17848103 TCCCAGTGCAGTGTAGTGAAGGG + Intergenic
1201809890 Y:18057908-18057930 TCCCAGTGCAGTGTAGTGAAGGG - Intergenic