ID: 1128231821

View in Genome Browser
Species Human (GRCh38)
Location 15:66040569-66040591
Sequence CTGTCTACAGTGGTGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 259}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128231811_1128231821 5 Left 1128231811 15:66040541-66040563 CCCCTCCAAGTCCTACAAGGTGA 0: 1
1: 0
2: 1
3: 6
4: 111
Right 1128231821 15:66040569-66040591 CTGTCTACAGTGGTGGTGGGAGG 0: 1
1: 0
2: 2
3: 30
4: 259
1128231815_1128231821 0 Left 1128231815 15:66040546-66040568 CCAAGTCCTACAAGGTGAGGAAG 0: 1
1: 0
2: 2
3: 45
4: 162
Right 1128231821 15:66040569-66040591 CTGTCTACAGTGGTGGTGGGAGG 0: 1
1: 0
2: 2
3: 30
4: 259
1128231816_1128231821 -6 Left 1128231816 15:66040552-66040574 CCTACAAGGTGAGGAAGCTGTCT 0: 1
1: 0
2: 2
3: 35
4: 347
Right 1128231821 15:66040569-66040591 CTGTCTACAGTGGTGGTGGGAGG 0: 1
1: 0
2: 2
3: 30
4: 259
1128231808_1128231821 19 Left 1128231808 15:66040527-66040549 CCTTCAGGTAGGGCCCCCTCCAA 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1128231821 15:66040569-66040591 CTGTCTACAGTGGTGGTGGGAGG 0: 1
1: 0
2: 2
3: 30
4: 259
1128231813_1128231821 3 Left 1128231813 15:66040543-66040565 CCTCCAAGTCCTACAAGGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 154
Right 1128231821 15:66040569-66040591 CTGTCTACAGTGGTGGTGGGAGG 0: 1
1: 0
2: 2
3: 30
4: 259
1128231810_1128231821 6 Left 1128231810 15:66040540-66040562 CCCCCTCCAAGTCCTACAAGGTG 0: 1
1: 0
2: 3
3: 13
4: 145
Right 1128231821 15:66040569-66040591 CTGTCTACAGTGGTGGTGGGAGG 0: 1
1: 0
2: 2
3: 30
4: 259
1128231812_1128231821 4 Left 1128231812 15:66040542-66040564 CCCTCCAAGTCCTACAAGGTGAG 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1128231821 15:66040569-66040591 CTGTCTACAGTGGTGGTGGGAGG 0: 1
1: 0
2: 2
3: 30
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128231821 Original CRISPR CTGTCTACAGTGGTGGTGGG AGG Intronic
900477132 1:2881361-2881383 CTGTCTAGAGGGGTGGGGGCAGG + Intergenic
900484161 1:2913644-2913666 ATGCCTCCAGGGGTGGTGGGAGG - Intergenic
901121718 1:6900201-6900223 CAGTCTGCAGTGCTGGTGGCAGG - Intronic
902628821 1:17692671-17692693 CTAGCTACAGTTGTGGAGGGTGG - Intronic
904457753 1:30657639-30657661 CTGCCTTCAGAGGGGGTGGGAGG - Intergenic
905468197 1:38171812-38171834 CTGTATGGAGTGGGGGTGGGAGG - Intergenic
906684680 1:47755820-47755842 CTTTCCTCAGTGATGGTGGGTGG - Intergenic
907046194 1:51301800-51301822 CGGTCTGCTGTGGTGTTGGGAGG - Intronic
907114662 1:51958393-51958415 GTGTCCACAGTGGTGCTGAGAGG + Intronic
907251693 1:53143770-53143792 CAGTCTGCAGTGAGGGTGGGAGG + Intergenic
907334485 1:53691349-53691371 GTGTCTCATGTGGTGGTGGGAGG - Intronic
907870701 1:58440103-58440125 CTGTCTGCAGTAGGAGTGGGAGG + Intronic
908070667 1:60455791-60455813 GTGACTACAGTAGTGGTGGCAGG - Intergenic
909101873 1:71358202-71358224 ATGTCTACAGTGGGAGTGTGGGG + Intergenic
909248904 1:73327202-73327224 CTGTGTACTGTGGTGGGTGGGGG + Intergenic
909736448 1:78968480-78968502 CTCTCTACTGGGGTGGAGGGCGG + Intronic
911316813 1:96365785-96365807 CTGTTTACAGTTTGGGTGGGAGG + Intergenic
918337326 1:183530845-183530867 CTCTCTAAATTGGTGGTGGTGGG + Intronic
918558729 1:185838235-185838257 CTGTCAAGAGTTGTGGTGGCTGG - Intronic
919860540 1:201736985-201737007 TTGACTACAGTGGAGGTGGAGGG - Intronic
920459414 1:206127815-206127837 GTGTGTACAGTGGTTTTGGGAGG + Intergenic
920769338 1:208865831-208865853 TTGTGTATATTGGTGGTGGGGGG + Intergenic
923162201 1:231324170-231324192 ATCTCTTCTGTGGTGGTGGGGGG + Intergenic
924298368 1:242611935-242611957 CTGTCTGCAGTTGTGCTTGGTGG + Intergenic
924700214 1:246443964-246443986 CTGTCTGTGGTGGTGATGGGTGG - Intronic
924703035 1:246473599-246473621 CTGTCTGCTATGGTGGTGGGGGG - Intronic
1063851691 10:10199588-10199610 CTGTCTGCAGTGGAGCTGAGTGG + Intergenic
1064152215 10:12874566-12874588 CTGTCTACAGAGGTGAAGAGGGG + Intergenic
1068314215 10:55320372-55320394 GTGTTTGCAGTGGTGGTGGTGGG - Intronic
1068853485 10:61771727-61771749 CTGTGTGCAGTGGTGGAGTGGGG + Intergenic
1069079886 10:64077417-64077439 GTGGGGACAGTGGTGGTGGGGGG + Intergenic
1069079912 10:64077489-64077511 GTGGGGACAGTGGTGGTGGGGGG + Intergenic
1069079926 10:64077527-64077549 GTGGGGACAGTGGTGGTGGGGGG + Intergenic
1070567196 10:77612920-77612942 CTGTGCTCAGTGGGGGTGGGGGG - Intronic
1070670106 10:78371882-78371904 CAGGCCACAGTGTTGGTGGGAGG + Intergenic
1074473085 10:113744814-113744836 CTGTCTGCAGAGGTGGAGGCAGG - Intergenic
1074493629 10:113960088-113960110 CATTCTACACTGGTGGAGGGGGG - Intergenic
1075275208 10:121086766-121086788 ATGGCTACCGAGGTGGTGGGGGG - Intergenic
1076105595 10:127820327-127820349 ATGTTTACAGTGGTGGTGTGTGG - Intergenic
1076765845 10:132632596-132632618 CGGGGTGCAGTGGTGGTGGGTGG - Intronic
1077019713 11:411994-412016 CTGGATACAGTGGGGGGGGGGGG + Intronic
1077020374 11:414531-414553 CTGTGTGCAGTGGTAATGGGAGG - Intronic
1077044539 11:538575-538597 CTGTTGACAGAGGTGGTGGGTGG - Intronic
1080124450 11:28715924-28715946 CTGTCAAGAGTGCTGGTGGACGG - Intergenic
1080682048 11:34486297-34486319 ATTTCTGCAGTGGAGGTGGGTGG + Intronic
1081051124 11:38342881-38342903 CTGTCTACTCTGGGGGCGGGGGG + Intergenic
1082811074 11:57479372-57479394 CTGTCTGGGCTGGTGGTGGGAGG - Intergenic
1084871421 11:72101046-72101068 CTGTCTGAAGTGGAGCTGGGAGG - Intronic
1085807791 11:79652122-79652144 GTGTGTGCAGTGGTGGTGGTAGG + Intergenic
1086877367 11:92112591-92112613 GTGTCTACAGTGGTGGATGAAGG - Intergenic
1087390687 11:97528603-97528625 CATTCCACAGTGGTGGTGTGAGG - Intergenic
1087539570 11:99498572-99498594 CTGAATACTGTGGAGGTGGGTGG - Intronic
1088739490 11:112755521-112755543 ATGTCTTCGTTGGTGGTGGGAGG - Intergenic
1090074469 11:123571332-123571354 GTGTCTGCAGTGGGCGTGGGGGG + Intronic
1091626116 12:2122163-2122185 CTGTGTACAGATGAGGTGGGAGG + Intronic
1092138677 12:6167687-6167709 ATGTCTACACTGGGGATGGGTGG - Intergenic
1096033496 12:48442514-48442536 CTGTGTTCAGGGCTGGTGGGGGG - Intergenic
1097155255 12:57007293-57007315 ATGTCTTTGGTGGTGGTGGGTGG - Intergenic
1097191630 12:57222206-57222228 CTGTCTACAGTAGTGGGTGGGGG + Intronic
1098010015 12:66040946-66040968 CTGAGTTCAGTGGAGGTGGGGGG + Intergenic
1098243261 12:68489076-68489098 TTGGCTGCAGTGCTGGTGGGAGG - Intergenic
1100411980 12:94328224-94328246 CTCTCTTCAATGGGGGTGGGGGG + Intronic
1102041427 12:109803315-109803337 CTGCCTCCAGTGGTGCTGAGAGG + Intronic
1103006339 12:117423308-117423330 CTGGCTATAGTGGTGGCTGGGGG + Intronic
1105836647 13:24217890-24217912 CAGTGGGCAGTGGTGGTGGGAGG - Intronic
1106766346 13:32917718-32917740 CTGTCTACAATGGTGTTTGTTGG + Intergenic
1107153311 13:37137799-37137821 ATGTAAACAGTGGTGCTGGGAGG - Intergenic
1111686125 13:91502687-91502709 CTGTCGTGAGTGGTGCTGGGTGG - Intronic
1113485873 13:110652055-110652077 CTGTCTTCTGAGGTGGTGGCAGG - Intronic
1114549807 14:23526211-23526233 GTGGCAGCAGTGGTGGTGGGTGG + Exonic
1115435244 14:33364778-33364800 TTGTCTTCAGTGGGGGTGTGGGG - Intronic
1117250761 14:53935216-53935238 CTGCCTACTGTGGTGGGAGGGGG - Intergenic
1117351840 14:54888968-54888990 CTGTTTACTGTGGTGGAGGAGGG + Intronic
1118751087 14:68808334-68808356 CTGTCTGGAGTGGTGGGGTGGGG - Intergenic
1119234592 14:73008944-73008966 ATGTTAACAGAGGTGGTGGGTGG - Intronic
1119333000 14:73809479-73809501 GTGTCTTGGGTGGTGGTGGGAGG - Intergenic
1119796963 14:77407379-77407401 GGGGCTACAGTGGAGGTGGGAGG + Intronic
1120368272 14:83598666-83598688 CTGTGTATAGTGGGGTTGGGAGG - Intergenic
1121602138 14:95213297-95213319 CTCTCTGCAGTGGGTGTGGGTGG + Exonic
1121718993 14:96096193-96096215 CTGTCTTGTGTGGTGGGGGGTGG + Intergenic
1121812204 14:96901075-96901097 CTGTTTAAAGTGAGGGTGGGTGG + Intronic
1122288141 14:100664909-100664931 TTGTCTACAGTGGCCGAGGGGGG - Intergenic
1122642032 14:103165537-103165559 CTGCCGACAGTAGTGGGGGGTGG + Intergenic
1123028460 14:105439548-105439570 CTGTCCTCAGGGGTGGTGGGTGG + Intronic
1123821018 15:24030677-24030699 TTGTCTACAGTGGAATTGGGTGG + Intergenic
1124640626 15:31393880-31393902 CTGTCTGCGAGGGTGGTGGGTGG + Intronic
1126468146 15:48979461-48979483 TTATATACAGTGGGGGTGGGTGG - Intergenic
1127551416 15:60042678-60042700 CTCTATACAGTGGTTGTGGTGGG + Intronic
1127739863 15:61892364-61892386 CTGTCTCCAGTGGTGGGGAAGGG - Intronic
1128231821 15:66040569-66040591 CTGTCTACAGTGGTGGTGGGAGG + Intronic
1128236417 15:66070556-66070578 CTGGCTCTGGTGGTGGTGGGGGG + Intronic
1128604716 15:69028116-69028138 GTGTCTGGGGTGGTGGTGGGGGG - Intronic
1129681237 15:77659633-77659655 CTGCCTACAGGGGTAGTGGATGG + Intronic
1129685084 15:77681381-77681403 CTGGCTACAGTGGAGTTGGCTGG + Intronic
1130997740 15:88913152-88913174 TTGTCAACAGTGGAGGTGGAGGG + Intronic
1131116858 15:89801322-89801344 CTGTCTACAGTGGCTGGGGCTGG + Intronic
1132631059 16:917685-917707 CTGTTTGCAGGGGTGCTGGGAGG + Intronic
1134319607 16:13150710-13150732 CTGCTTGCAGGGGTGGTGGGAGG - Intronic
1136383082 16:29905974-29905996 CTCTCTACTGCGGGGGTGGGCGG + Exonic
1137661460 16:50210388-50210410 CTGACTATCATGGTGGTGGGGGG - Intronic
1138266648 16:55664507-55664529 CTGTCTTGTGTGGTGGAGGGTGG - Intronic
1138494954 16:57402464-57402486 CTGCCTGCAGTCGGGGTGGGGGG - Intergenic
1139116061 16:63954569-63954591 GTTTCTAAAGTGGTGGTGGATGG - Intergenic
1139646577 16:68335612-68335634 CTGTCTCATGTGGTGGTGGTCGG - Intronic
1140480224 16:75258326-75258348 CTGCCTCCAGTGTTGGCGGGTGG - Intronic
1142352409 16:89586304-89586326 CTGGGCACAGGGGTGGTGGGAGG + Intronic
1142567567 17:850578-850600 CTGTCTCCAGTGGGGCTGGGGGG + Intronic
1144143371 17:12371833-12371855 GTCTCTACATTTGTGGTGGGTGG - Intergenic
1145058242 17:19716865-19716887 CTGCCTGCAGTGGCTGTGGGAGG + Intronic
1145249866 17:21291453-21291475 CTGTCGACAGTGCAGGTGGCTGG + Intronic
1145369126 17:22294248-22294270 CTGGCTACAGGGTGGGTGGGAGG - Intergenic
1147703701 17:42411850-42411872 ATGTATACAGTGGGGATGGGAGG - Intronic
1147719200 17:42528050-42528072 CTGTAAACAGTGGTTGTGGGAGG - Intergenic
1147719616 17:42530941-42530963 CTGTAAACAGTGGTTGTGGGAGG - Intergenic
1148162108 17:45456157-45456179 CTGTCTACAGAGGTAGAGAGTGG - Intronic
1148685624 17:49499268-49499290 CTGTCTACAGTGGTCTTGGGTGG - Intronic
1149492577 17:57095821-57095843 ATGTCTTCTGTGGTCGTGGGCGG + Intronic
1150179575 17:63102627-63102649 CTGTGTCCAGAGGTGGGGGGAGG - Intronic
1150393341 17:64802805-64802827 CTGTCTACAGAGGTAGAGAGTGG - Intergenic
1150718168 17:67590045-67590067 CTACCTACAGTGGGGGTGTGTGG + Intronic
1152855766 17:82663975-82663997 GTGCCGACGGTGGTGGTGGGAGG + Intronic
1152855899 17:82664337-82664359 GTGCCGACGGTGGTGGTGGGAGG + Intronic
1154344665 18:13531989-13532011 CTGCCTACATTGGGGGTGGTGGG - Intronic
1157137560 18:45071625-45071647 CTGACTATAATGGTGGTGGTAGG - Intergenic
1157260106 18:46170008-46170030 CTGGCTATGGTGGGGGTGGGTGG + Intergenic
1157460391 18:47887105-47887127 ATGACTAGAGTGGTGGTGGAAGG - Intronic
1158017161 18:52797746-52797768 CTGGCAGCAGTGGTGATGGGTGG + Intronic
1158125314 18:54094215-54094237 CTGTCTGGAGTGGTGATGGTTGG + Intergenic
1160027570 18:75231096-75231118 TTCTCTCCAGTGGTGGAGGGTGG + Intronic
1160841170 19:1147615-1147637 CTGTGTCCAGTGGGGGTGGGAGG - Intronic
1162003140 19:7760733-7760755 GTGGCTGCAGTGGTGGTGGATGG + Intergenic
1162110784 19:8398526-8398548 CTGGGGACAGGGGTGGTGGGAGG + Intronic
1163126339 19:15246265-15246287 CTGACTGCTGTGGTGGTGGGGGG + Intronic
1163130178 19:15267590-15267612 CTGTCTACAGAGGTGGGGAGGGG - Intronic
1163598090 19:18232022-18232044 CTGCCTCCAGTGTTGGGGGGAGG - Intronic
1163641005 19:18461942-18461964 CTATAGACAGTGCTGGTGGGAGG + Intronic
1163699811 19:18781526-18781548 CTGTGGCCAGTGGGGGTGGGTGG - Exonic
1164700154 19:30279333-30279355 CTGACTGCAGGGGTGCTGGGTGG + Intronic
924977506 2:191678-191700 CTGTGCACAGTGCTGGTGGGAGG - Intergenic
925410443 2:3636904-3636926 GTGTATGCAGTGGTGGTGTGGGG - Intronic
925481120 2:4275784-4275806 CTGTCTACAGTGGTGGGATGAGG + Intergenic
926047126 2:9717909-9717931 CTGTCTGGAATGGAGGTGGGTGG + Intergenic
926311135 2:11677147-11677169 CTGTCTCCAGAGGAGGTTGGTGG - Intergenic
926990640 2:18676458-18676480 CTGTCTGCAGTGGTGGGTGAGGG + Intergenic
927186856 2:20488194-20488216 CTCCCTACAGTTGTGGGGGGTGG + Intergenic
928448657 2:31357082-31357104 CTGTCTAAAGTAGTGCTGAGGGG + Intronic
928480115 2:31675053-31675075 ATGTCTGCAGTGGTGGATGGGGG + Intergenic
930012909 2:46951257-46951279 ATGCCTACACTGCTGGTGGGTGG - Intronic
931916262 2:66960310-66960332 CTGCCTGCATTGGTGGTGGAAGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933513005 2:83264704-83264726 CTGTCCACATTGGTGCTGGAGGG + Intergenic
935585390 2:104796219-104796241 CTGTTTACAGAGGTGGAGTGAGG + Intergenic
938745217 2:134271394-134271416 CTGTCTATACTTTTGGTGGGTGG + Intronic
941015883 2:160355688-160355710 CTGTCTTCAGTGCTGGGGTGGGG + Intronic
943601037 2:189921348-189921370 CTGTGTACAGTGCTGCTGAGAGG + Intronic
946066944 2:216996070-216996092 GTTTTTAAAGTGGTGGTGGGGGG + Intergenic
946974808 2:225136625-225136647 CCCTGTAGAGTGGTGGTGGGGGG + Intergenic
947839192 2:233196845-233196867 CTGTGTACAGCGGGGGTGGCTGG - Intronic
947875895 2:233468133-233468155 CTTTCTGCACTGCTGGTGGGTGG + Intronic
948005399 2:234603955-234603977 GTGGCCACAGTGGTGGTGGGAGG + Intergenic
1168981235 20:2005746-2005768 ATGTCTACAATGGGGGTGGGTGG - Intergenic
1172240580 20:33410122-33410144 GTGTCTACAGGTGTGCTGGGAGG - Exonic
1172640938 20:36440084-36440106 GTGTTTACAGTGGTGGTGTGGGG - Intronic
1173438548 20:43054782-43054804 TTGCCTCCAGTGGGGGTGGGGGG + Intronic
1176687744 21:9866149-9866171 CCATCTGCAGTGGTGGTTGGTGG + Intergenic
1177195526 21:17900575-17900597 CTGTTTCCAGTGGAGGTGGCAGG + Intergenic
1178615195 21:34126940-34126962 CTGTGTGCAGTGGTGGGGGTTGG + Intronic
1180197771 21:46207840-46207862 CTGTTTACAATGGGGGTGGGGGG - Intronic
1180236202 21:46460249-46460271 CTGGCTTCAGAGGTGGTGGGTGG + Intronic
1180723538 22:17927572-17927594 CTGAGTACAGGGGTGTTGGGAGG - Intronic
1180864334 22:19107243-19107265 CTGTCTCCAGTGGTGGTGATGGG - Intronic
1182150822 22:28026070-28026092 TGGCCTACAGTGGAGGTGGGAGG - Intronic
1182866694 22:33610626-33610648 CTTTATAGGGTGGTGGTGGGTGG + Intronic
1182941354 22:34280525-34280547 CTGCCTCCAGTGGGGGTGGATGG - Intergenic
1183361766 22:37386563-37386585 CTTTCTCCAGAGGAGGTGGGAGG + Intronic
1183601945 22:38844798-38844820 CAGACTGCAGTGGGGGTGGGGGG - Intergenic
1184820563 22:46906430-46906452 CTGTCTACAGTGGGAATGGTGGG + Intronic
1185017150 22:48351507-48351529 CTGTCCACAGTGGGGGTGTGGGG + Intergenic
1185311994 22:50161358-50161380 CTGTCTACAGCTGTGGCGAGGGG + Exonic
949782794 3:7709037-7709059 TTGACTACAGAGGTGGTGGAAGG - Intronic
950923078 3:16715204-16715226 CTGTCTACAATGGTGGTCAGTGG + Intergenic
953447780 3:42982191-42982213 TTCTTTGCAGTGGTGGTGGGAGG + Intronic
953632286 3:44629273-44629295 TTGTCTAAAGTGTAGGTGGGAGG - Exonic
953980380 3:47410433-47410455 CTATCTACTGTGGTGGTGGCTGG - Exonic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
954408482 3:50358807-50358829 CTGACAACGGTGGTGGTGGCCGG - Exonic
954467284 3:50663411-50663433 CTTGCCACAGTGCTGGTGGGAGG + Intergenic
955134564 3:56203737-56203759 CTATTTACAGTGGACGTGGGAGG + Intronic
955580809 3:60419440-60419462 GGGCTTACAGTGGTGGTGGGAGG - Intronic
955768225 3:62367078-62367100 ATCTCTGCAGTGGTGGGGGGAGG - Intergenic
956593206 3:70938492-70938514 CTTTTTGCAGTGGGGGTGGGGGG - Intergenic
957426836 3:80051021-80051043 CTCCCCACAGTGGTGGTGGGCGG - Intergenic
958580048 3:96007103-96007125 CTGGCTCCAGTGCTGGTGGCTGG - Intergenic
959574436 3:107919257-107919279 CTTTCTGGGGTGGTGGTGGGAGG - Intergenic
961474378 3:127137565-127137587 GTGTGGACAGTGGGGGTGGGGGG - Intergenic
962335588 3:134527462-134527484 CTGTCTGCAGTGGTGGTCAGTGG + Intronic
962559737 3:136592845-136592867 CTGTCTACAGTGGTTATTGCTGG - Intronic
963202216 3:142597364-142597386 CTGATTACAAAGGTGGTGGGGGG - Intronic
963278890 3:143361381-143361403 ATCTCTACACTGGTGGTGGCTGG + Intronic
967054337 3:185815761-185815783 CTGTTTATGGTGCTGGTGGGAGG - Intronic
967699130 3:192571063-192571085 ATTTCTACATTGGTGTTGGGGGG + Intronic
968682227 4:1929102-1929124 TTGTCTAGAGAGGTGGTGGGTGG + Intronic
969271826 4:6108277-6108299 CTGGATGGAGTGGTGGTGGGAGG - Intronic
969443938 4:7233537-7233559 CTGGCAGCTGTGGTGGTGGGTGG + Intronic
970344905 4:15143968-15143990 CTTTCTACAGTTTTGGTGGTAGG - Intergenic
971397873 4:26246862-26246884 CTGAGTACAGTAGTGGTGCGCGG - Intronic
971582361 4:28358211-28358233 CTGTCAAGAGTGCTGGTGGTGGG - Intergenic
972830541 4:42809641-42809663 CTGTCTGCAATGGCGGTTGGCGG + Intergenic
973618876 4:52707845-52707867 ATGTCTGCTGTGGGGGTGGGAGG + Intergenic
974622878 4:64384416-64384438 CTGTTAACTGTGGTGGTGGCAGG + Intronic
975850507 4:78567032-78567054 ATGCCTGCGGTGGTGGTGGGAGG + Intronic
976124286 4:81817038-81817060 CTCTCTAAAGTGGTGTTTGGAGG + Intronic
977151203 4:93514406-93514428 GTGTGTACTGTGGAGGTGGGGGG - Intronic
979515299 4:121602320-121602342 CTGTATGCAGTGGTGGGGAGTGG - Intergenic
979673547 4:123386053-123386075 CAGACAACATTGGTGGTGGGTGG - Intergenic
979765922 4:124463696-124463718 ATCTCTGCAGTGGTGGTGTGGGG + Intergenic
980351098 4:131683963-131683985 CCATCTGCAGTGGTGGTTGGTGG + Intergenic
987159957 5:15132159-15132181 CTGTCGGCAGTGGTGGTGCGGGG + Intergenic
988155835 5:27448093-27448115 CTAGTGACAGTGGTGGTGGGTGG + Intergenic
988200874 5:28066814-28066836 CTGTCTACAATGGTGGTTGGTGG - Intergenic
988636338 5:32988640-32988662 CTGTCTACTAGGGAGGTGGGGGG - Intergenic
989698391 5:44232015-44232037 GTGTCTACACTGGAGGTGAGTGG + Intergenic
990699076 5:58456124-58456146 CTGGCAACTGTGGTGGTAGGTGG + Exonic
991561603 5:67959278-67959300 CTGTCTGCTGTGTTAGTGGGAGG + Intergenic
994094440 5:95836021-95836043 CTGGCTACAGAGGAGGTGAGTGG + Intergenic
996015932 5:118534161-118534183 CTGGCAACTGTGGTGGGGGGAGG + Intergenic
996757376 5:126948928-126948950 CGGCCTACAGTGGTGGAGGTGGG + Intronic
998550204 5:143070002-143070024 TTGTCTCCAGTGGTGTTTGGTGG + Intronic
999343747 5:150796437-150796459 CTGGCTGCAGAGCTGGTGGGAGG - Exonic
1000365932 5:160491328-160491350 CTATCTACTGTTGTTGTGGGAGG - Intergenic
1000640250 5:163693779-163693801 CTTTTTACACTGTTGGTGGGAGG + Intergenic
1001519609 5:172381695-172381717 CTGTCCACAGAGGTGGAGGTGGG - Intronic
1002159777 5:177308169-177308191 CTGCCTAGATTGGGGGTGGGGGG + Intronic
1003426115 6:5999404-5999426 CTGTCTAAAGCGGGGGTGGGGGG + Intronic
1003605211 6:7553732-7553754 CTGGTTGCATTGGTGGTGGGTGG + Intronic
1004141978 6:13026604-13026626 CTGTTCATGGTGGTGGTGGGTGG + Intronic
1004555248 6:16690769-16690791 CTGACTACATTGGTGCTGGTTGG - Intronic
1005104305 6:22206763-22206785 CCTCCCACAGTGGTGGTGGGAGG - Intergenic
1006020845 6:31116743-31116765 TTGTCTACAGAGGTGATTGGGGG + Exonic
1006978094 6:38122552-38122574 CTTTCTTCAGTGGTGGGGGGAGG + Intronic
1007776623 6:44227614-44227636 CTCCCCACAGTGGTGGCGGGAGG - Intronic
1007899581 6:45398232-45398254 CTGCCTAGAGTTGTAGTGGGAGG + Intronic
1009817543 6:68755313-68755335 CTGTCTCCAGAGGAGGTTGGAGG + Intronic
1012960905 6:105620633-105620655 CTGTCTCCAGTGATGGTGACAGG - Intergenic
1015552647 6:134427991-134428013 CTGTCTGCTGTGGTGGTTGTTGG + Intergenic
1015595626 6:134863837-134863859 CTGTCTATATTGCTGGTGGGTGG - Intergenic
1015920743 6:138264164-138264186 CCGTAAACAGTGGTGCTGGGGGG + Intronic
1017076375 6:150622605-150622627 CTGTCTACACTGGGAGGGGGAGG - Intronic
1017662915 6:156691368-156691390 CTGTCTTCTGTAGTGGTGGAGGG - Intergenic
1022461985 7:30617885-30617907 CTGTCTATATTGGTGGCAGGAGG + Intronic
1024853143 7:53744540-53744562 CTAGCAGCAGTGGTGGTGGGTGG - Intergenic
1026901556 7:74040193-74040215 CTGTCCACAGAGGGGCTGGGAGG - Intronic
1033300758 7:140182998-140183020 CTGGCTAAAGTTGTGGTAGGAGG + Intergenic
1035755304 8:2026659-2026681 CTGTCAGCAGACGTGGTGGGAGG - Intergenic
1037427980 8:18777797-18777819 CTGTGGATAGTGGTGGTGGTGGG - Intronic
1041748783 8:61236912-61236934 CTGCCTACAATGCTGGTGGATGG + Intronic
1043354934 8:79401107-79401129 CTCTCTGCAGTGGTGGGGAGAGG + Intergenic
1044116560 8:88343169-88343191 CTGTCAAGGGGGGTGGTGGGGGG - Intergenic
1044466457 8:92512511-92512533 CTGTCTACAGAGAAGCTGGGGGG - Intergenic
1044550512 8:93506987-93507009 TTGACTACAGTGTTGGTTGGAGG - Intergenic
1044731209 8:95229908-95229930 TGGTCTACAGTGGTGATGTGAGG + Intergenic
1046223703 8:111248984-111249006 CTGTCTACAGTGGATTTGGCAGG + Intergenic
1049536584 8:143185465-143185487 CTGTCTACACTGGTGGGAGCAGG - Intergenic
1052797652 9:32938423-32938445 GTGTCTAGAATGGTGGTGGTGGG - Intergenic
1052883733 9:33623404-33623426 CTGTCCACACTGCTGGAGGGTGG - Intergenic
1053008843 9:34622176-34622198 CTGTCTACGGGGATGGAGGGGGG - Intronic
1053781612 9:41615750-41615772 CCATCTGCAGTGGTGGTTGGTGG - Intergenic
1054169560 9:61825904-61825926 CCATCTGCAGTGGTGGTTGGTGG - Intergenic
1054667978 9:67754911-67754933 CCATCTGCAGTGGTGGTTGGTGG + Intergenic
1056951285 9:91042657-91042679 TTGCCTACAGTGGTGGGAGGGGG + Intergenic
1056951325 9:91042923-91042945 TTGCCTACAGTGGTGGGAGGGGG - Intergenic
1061149153 9:128819118-128819140 CTGGCTCCAGCGGTGGTTGGCGG - Exonic
1185593742 X:1294850-1294872 CTGTCTACACTGGGTGTAGGTGG - Intronic
1185672607 X:1824701-1824723 CTGTCTCCAGTGTTGGAGGTGGG - Intergenic
1188261922 X:28033275-28033297 CAGTCTAGAGTGCTGGTGTGAGG - Intergenic
1188580780 X:31710318-31710340 CTGTATATGGTGGTGGTTGGGGG + Intronic
1188644892 X:32553775-32553797 CTGTCTTCAGTGTTGGAGGAAGG + Intronic
1188691711 X:33137339-33137361 CTTTTTATAGTGGTGGGGGGAGG + Intronic
1188871915 X:35382897-35382919 GTGGCTGCAGTGGTGGTGGGTGG + Intergenic
1189641867 X:43081523-43081545 CTGTATTGAATGGTGGTGGGGGG - Intergenic
1190291822 X:48998177-48998199 GTGCCTAAAGTGGGGGTGGGTGG + Exonic
1190482379 X:50890013-50890035 GTGCCAACAGTGGTGGTGGCCGG - Intergenic
1191221656 X:57995298-57995320 CTTTTTACACTGTTGGTGGGAGG - Intergenic
1192550926 X:72052832-72052854 ATGTCTACAGAGGGGCTGGGGGG - Intergenic
1192722696 X:73716400-73716422 CTGTCTTGGGAGGTGGTGGGGGG - Intergenic
1194781317 X:98028542-98028564 CTGTCTGCAGTGGTAGTCTGTGG + Intergenic
1197387232 X:125816376-125816398 CTGTGTACAGGGGTTGGGGGTGG - Intergenic
1197446495 X:126556243-126556265 CTGTTTGTAGTGGTGGAGGGTGG + Intergenic
1197636821 X:128924569-128924591 CTGTCTTTTGTGGTGGTGGTGGG - Intergenic
1199670513 X:150143971-150143993 TTGTTTACTGTGGGGGTGGGGGG + Intergenic
1200258624 X:154599686-154599708 CAGTCTAGAGTGGCGGTGGCCGG - Intergenic
1201885097 Y:18873522-18873544 CTTTTTCCAGTGGTGGAGGGAGG - Intergenic