ID: 1128232102

View in Genome Browser
Species Human (GRCh38)
Location 15:66042658-66042680
Sequence CTGCCCTAACAGGTTTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128232102_1128232117 21 Left 1128232102 15:66042658-66042680 CCCCCTGAAACCTGTTAGGGCAG 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1128232117 15:66042702-66042724 TTCTGGTTTGCTGGCATCCTTGG 0: 1
1: 0
2: 3
3: 23
4: 392
1128232102_1128232114 12 Left 1128232102 15:66042658-66042680 CCCCCTGAAACCTGTTAGGGCAG 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1128232114 15:66042693-66042715 CCTCCCAGCTTCTGGTTTGCTGG 0: 1
1: 0
2: 1
3: 15
4: 255
1128232102_1128232109 4 Left 1128232102 15:66042658-66042680 CCCCCTGAAACCTGTTAGGGCAG 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1128232109 15:66042685-66042707 TCCTCGCCCCTCCCAGCTTCTGG 0: 1
1: 3
2: 45
3: 322
4: 1227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128232102 Original CRISPR CTGCCCTAACAGGTTTCAGG GGG (reversed) Intronic
901773791 1:11545242-11545264 CCGCCCCACCAGGTTTCAGAGGG + Intergenic
902623133 1:17661881-17661903 CTGCCCTCTCAGGTTTCTGAAGG - Intronic
907734867 1:57102855-57102877 CTGAGCTGACAGTTTTCAGGAGG - Intronic
907818385 1:57942526-57942548 CTGACCTGCCAGGTTTCAGCTGG + Intronic
908067658 1:60424928-60424950 CTACCCTAACAGGTGTGAGGTGG + Intergenic
915626613 1:157117846-157117868 CTGGCCAAACAGGCTCCAGGGGG - Intergenic
916013199 1:160725371-160725393 CTGCCCTAACAGCTAGCAGGAGG + Intergenic
916262483 1:162856043-162856065 CTGCCCTCACAATTTTCAGAAGG + Intronic
918760582 1:188399975-188399997 CAGCCCTAACAGTTTTTTGGTGG - Intergenic
918967199 1:191366685-191366707 CTATCCTAACAGGTGTGAGGTGG - Intergenic
919911339 1:202112875-202112897 CTGCCTGGACAGCTTTCAGGGGG - Intergenic
920701660 1:208222534-208222556 CTCCCCGATCAGGATTCAGGAGG + Intronic
920850208 1:209623416-209623438 CTGCCCTAATAGGAAGCAGGTGG + Intronic
923402689 1:233630018-233630040 CGGCCCACACAGGTATCAGGAGG - Intronic
924812240 1:247413332-247413354 CCATCCTAACAGGTTTGAGGTGG + Intergenic
1063308478 10:4930285-4930307 CTGCCCTGACAGTTATCAAGAGG + Intronic
1065287184 10:24197430-24197452 CTGCTCTAATAGGTTTCTGTTGG - Intronic
1067777101 10:49171703-49171725 CTGCCCTCCCATGTTTCTGGGGG - Intronic
1068109298 10:52660143-52660165 CTATCCTAACAGGTATAAGGGGG + Intergenic
1070748637 10:78950796-78950818 CTGACCTCACAGGTTTTACGTGG - Intergenic
1071682015 10:87715775-87715797 CTCCCCTCAAAGGTTTCATGCGG + Exonic
1073854591 10:107659898-107659920 CTACCCTAACAGGATTTAAGTGG - Intergenic
1074078651 10:110151169-110151191 CTGTCCTAACAGCTTCCCGGGGG - Intergenic
1074713599 10:116198264-116198286 CTGGCCTAAAAGGTTTCATCAGG + Intronic
1075009274 10:118853828-118853850 CAGCCCTTTCAGGCTTCAGGAGG - Intergenic
1078845412 11:15115016-15115038 CTCCCCTAGCTGGATTCAGGGGG + Intronic
1079454186 11:20622937-20622959 CTGGCCTCACAGCTGTCAGGTGG - Intronic
1080155760 11:29108731-29108753 CTCCCCTTACAGATTTCAGGTGG - Intergenic
1084373777 11:68762563-68762585 CTTCCCTAAAAGGCTTCTGGAGG - Intronic
1085684412 11:78608728-78608750 CAGCCCTAACAGCTTTCATTTGG - Intergenic
1091776068 12:3185704-3185726 CTGCCCCATCAGGCCTCAGGCGG - Intronic
1093873901 12:24326664-24326686 CTGCCCTCACCTTTTTCAGGTGG + Intergenic
1096846305 12:54408944-54408966 CTCCCCTCACAGATTTCAGCTGG - Exonic
1097462891 12:59885589-59885611 CTATCCTAACAGGTGTGAGGTGG + Intergenic
1103011608 12:117462531-117462553 ATTCCCTTACAGATTTCAGGGGG + Exonic
1113985893 13:114315228-114315250 CCACCCTAACAGGTGTGAGGTGG - Intronic
1115279292 14:31643035-31643057 CTGTCCTAACAGTTTTTTGGTGG + Intronic
1117177146 14:53156311-53156333 CTGCCAGAATAGGTGTCAGGTGG + Intergenic
1122743693 14:103885954-103885976 CTGGCCCATCAGGCTTCAGGAGG - Intergenic
1122931809 14:104936549-104936571 CTGCCCTGAGAGGTTCCAGAGGG - Exonic
1128232102 15:66042658-66042680 CTGCCCTAACAGGTTTCAGGGGG - Intronic
1128247276 15:66141764-66141786 GTGACCTAACATGGTTCAGGAGG - Intronic
1128456510 15:67834487-67834509 CTCCCCAAACAGGCTCCAGGTGG - Exonic
1130960812 15:88657574-88657596 CTGCCCTCGAAGCTTTCAGGAGG - Intergenic
1132270202 15:100517480-100517502 CTGCCCAAGCAAGTTTCATGAGG - Intronic
1133519856 16:6546436-6546458 ATTCCCTTACAGGTTTCAGAGGG - Intronic
1135283942 16:21177150-21177172 CTGCCTTAACAGTTGTCAGCCGG + Intronic
1140055790 16:71524498-71524520 TTGCACTAGCACGTTTCAGGTGG + Intronic
1142235889 16:88922368-88922390 CTGCCTTAGCAGGATTGAGGGGG + Intronic
1142336273 16:89491078-89491100 CTGCCCTAACGGGCGTCACGGGG + Intronic
1142564873 17:833669-833691 TTCCGCTAACAGGCTTCAGGGGG - Intronic
1142897801 17:2993252-2993274 CAGCCCTAAAAGGTTTTGGGGGG + Intronic
1146475614 17:33160303-33160325 ATGCCCTGAGAGGTTCCAGGTGG - Intronic
1151992788 17:77588569-77588591 CTGCTCTAACAGATGTGAGGTGG + Intergenic
1161806576 19:6447043-6447065 CTCCCCTAACAAGTTTGAGAGGG + Intronic
1162795760 19:13086839-13086861 CTGTCCTCACAGATTTCAGCTGG - Intronic
926410540 2:12597742-12597764 CTGCCCTACCAGGATGCAGTTGG - Intergenic
927566673 2:24119482-24119504 CTGCCCTAGCTGGTTTGAGTTGG + Intronic
933423521 2:82082315-82082337 CTGACCTAACAGGTTTAATAAGG + Intergenic
934709072 2:96503470-96503492 CTGCCCTGCCAGGTCCCAGGGGG - Intronic
936022707 2:109006804-109006826 CTGCCCTAAGAAGGTTTAGGAGG - Intergenic
941858201 2:170251649-170251671 CTTCCCTTACAGGTTTTAGAAGG + Intronic
942232431 2:173872913-173872935 CTGGTTTAACAGGTTTGAGGTGG - Intergenic
942339591 2:174929988-174930010 CTGCCCTAACAGGGTTCCAGGGG + Intronic
942379820 2:175377056-175377078 ATTCCCTAACAGGTTTCTGTGGG - Intergenic
942401228 2:175605786-175605808 CTGCCCTAGCAAGTTCCAGTTGG - Intergenic
942669515 2:178359359-178359381 CTATCCTAACAGGTGTGAGGTGG - Intronic
943390788 2:187265758-187265780 CCATCCTAACAGGTTTGAGGTGG - Intergenic
946872353 2:224095809-224095831 CTGCACTAACAGGTTCCTGAGGG + Intergenic
1169744218 20:8927157-8927179 ATTCCCTAACTGGCTTCAGGAGG + Intronic
1170596777 20:17811443-17811465 CTGCGCTCCCTGGTTTCAGGAGG - Intergenic
1170663262 20:18363119-18363141 CTGCCCTCACTGGTCTCAGCTGG - Intergenic
1174442175 20:50564642-50564664 CTGCCCTGAAAGGTTTTTGGGGG + Intronic
1174862922 20:54109282-54109304 CTATCCTAACAGGTGTGAGGTGG - Intergenic
1177775071 21:25558934-25558956 CTTCCCTCACAGCTCTCAGGAGG - Intergenic
1179677821 21:42996370-42996392 CTGACCTAACAGGATTCTTGTGG + Intronic
1180104969 21:45612582-45612604 TTGCCCTAGGAGGTTTTAGGAGG - Intergenic
1182049623 22:27302751-27302773 ATGCCCCACCAGGTTTTAGGAGG - Intergenic
1182431633 22:30302318-30302340 CTGCCCTCACAGAGTTCAGCAGG - Intronic
1183592444 22:38787820-38787842 CTTCCCTCACAGGTGTTAGGAGG - Intronic
951770792 3:26255088-26255110 CTATCCTAACAGGTGTGAGGTGG + Intergenic
952492245 3:33883908-33883930 CTGCTCTACAAGGTTTCAGGGGG - Intergenic
955686679 3:61556289-61556311 CTTCCCTTACAGATTTCAGAGGG - Intergenic
955825408 3:62941101-62941123 AAGCCCTAACTGGATTCAGGAGG + Intergenic
957337268 3:78847486-78847508 CTTCCCTTACAGGTTCCTGGAGG - Intronic
959019872 3:101177373-101177395 ATTCCCCTACAGGTTTCAGGAGG - Intergenic
960325693 3:116292940-116292962 CTGACATAGCAGGTTTCAAGAGG - Intronic
961530146 3:127535712-127535734 TTGCCCTCAGAGGCTTCAGGGGG - Intergenic
962299633 3:134227587-134227609 CTGTCCTAACAGGAATGAGGTGG - Intronic
964660431 3:159114607-159114629 CAGCCCTAAAAGGTTTTAAGTGG + Intronic
964777603 3:160295172-160295194 GTAGCCTAACAGGTTTGAGGTGG - Intronic
971007902 4:22396031-22396053 CTGCCATAAAAGGATTCAGCTGG - Intronic
971128431 4:23779467-23779489 CTGAGAGAACAGGTTTCAGGTGG - Intronic
972360326 4:38320368-38320390 CTTCTCTGGCAGGTTTCAGGTGG - Intergenic
974574752 4:63703816-63703838 CTGCCCTAACAGGCCTCAGAAGG - Intergenic
986667046 5:10113355-10113377 CTGACCTTTCAGGTTTCAAGTGG + Intergenic
986970647 5:13332285-13332307 ATGCACTAACATGTTTTAGGTGG + Intergenic
988255453 5:28813910-28813932 CTGTCCTAATAGGTGTGAGGTGG - Intergenic
992619081 5:78574711-78574733 CTGTGCTAACAGGTTGCAGATGG + Intronic
993044515 5:82852406-82852428 CTTCCCTGCCAGATTTCAGGGGG - Intergenic
993173920 5:84457594-84457616 CAGCTCTAACAGTTTTCTGGTGG - Intergenic
993240230 5:85374103-85374125 CTATCCTAACAGGTATGAGGTGG - Intergenic
999105707 5:149069099-149069121 TTCCCCCTACAGGTTTCAGGGGG + Intergenic
1001268220 5:170290615-170290637 CTGTCCTAACAGTTGTCAGTTGG - Intronic
1001876610 5:175207015-175207037 CACCCCTTACAGGTTCCAGGAGG + Intergenic
1002493361 5:179595493-179595515 CTGCCCTAACAGATGTGTGGTGG - Intronic
1004560186 6:16742435-16742457 CTGCCCTGGCAGGTTCCAAGGGG - Intronic
1005810751 6:29513981-29514003 ATTCCCTTACAGGTTTCAGAGGG + Intergenic
1006977735 6:38119309-38119331 CTGCCCTGAAAGGTTTTAGAGGG + Intronic
1014982070 6:127956453-127956475 CTCCCCCTACAGGTTTCAGAGGG + Intergenic
1015824590 6:137298115-137298137 CTTCCCTATCAGGTTTCCTGTGG - Intergenic
1022365228 7:29707584-29707606 CCATCCTAACAGGTTTGAGGTGG + Intergenic
1022932567 7:35134736-35134758 CCATCCTAACAGGTTTGAGGTGG - Intergenic
1023346884 7:39279583-39279605 CTTCCTTTACAGGTTTCAGAGGG - Intronic
1023818973 7:43969851-43969873 CTGACCCCACAGGTTTCAGCGGG - Intergenic
1028232936 7:88327237-88327259 TGGGCCTAAAAGGTTTCAGGAGG + Intergenic
1029744024 7:102506814-102506836 CTGACCCCACAGGTTTCAGCGGG - Exonic
1029762014 7:102605977-102605999 CTGACCCCACAGGTTTCAGCGGG - Exonic
1029828491 7:103227514-103227536 CCATCCTAACAGGTTTGAGGTGG - Intergenic
1048542791 8:135357898-135357920 TTTCCCTTACAGGTTTCAGAGGG + Intergenic
1048857171 8:138695165-138695187 CGGCCATAACAGGGCTCAGGAGG - Intronic
1049016057 8:139920991-139921013 CTGCCGTAACAGGTCTCTGAAGG + Intronic
1049638398 8:143701975-143701997 CTTCCCCTACAGGTTTCAGAGGG - Intronic
1049775979 8:144405249-144405271 CAGCCCCATCAGCTTTCAGGAGG - Intronic
1054823993 9:69552734-69552756 CTACCCTGACAGGTTTCATTGGG + Intronic
1056800499 9:89687476-89687498 CCCTCCTGACAGGTTTCAGGAGG - Intergenic
1058116404 9:101090002-101090024 CTTCCCCTACAGGTTTCAGAGGG - Intronic
1058818270 9:108705439-108705461 CTGCCCTATCTAGTTTCAGGTGG - Intergenic
1059307667 9:113367517-113367539 CTGCCCCAACAGGTCTGAGAGGG + Intronic
1059788298 9:117611273-117611295 CTGCCCTAATTGCTTACAGGGGG - Intergenic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1198885455 X:141330942-141330964 CTATCCTAACAGGTGTGAGGTGG - Intergenic
1199977025 X:152900167-152900189 CTGCCCTGCCAGATCTCAGGAGG - Intergenic