ID: 1128235824

View in Genome Browser
Species Human (GRCh38)
Location 15:66066408-66066430
Sequence AAATTCCTATAGATTCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128235824_1128235825 -8 Left 1128235824 15:66066408-66066430 CCAGGGGGAATCTATAGGAATTT 0: 1
1: 0
2: 1
3: 11
4: 100
Right 1128235825 15:66066423-66066445 AGGAATTTAAAATTTTTATGTGG 0: 2
1: 0
2: 12
3: 93
4: 907

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128235824 Original CRISPR AAATTCCTATAGATTCCCCC TGG (reversed) Intronic
906109404 1:43312966-43312988 GAATTCCTCTCCATTCCCCCAGG - Intronic
907528889 1:55073022-55073044 AAATTACAATTGCTTCCCCCAGG + Intronic
909256550 1:73430495-73430517 AAATACCTATAAATTACCCAAGG - Intergenic
910633010 1:89376087-89376109 AACATCCTCTAGATTCCTCCAGG + Intronic
913050922 1:115115988-115116010 ACACTCCTGTAGATTGCCCCTGG + Intergenic
914198342 1:145462410-145462432 AAATTCTTATAGTTTTGCCCAGG - Intergenic
914477447 1:148035538-148035560 AAATTCTTATAGTTTTGCCCAGG - Intergenic
920965076 1:210694588-210694610 AAATTCCCAGGGAATCCCCCTGG + Intronic
924165672 1:241279850-241279872 AACTTTCTAGAGATTCACCCAGG + Intronic
924432975 1:244013088-244013110 AAATTCTTCTTGATTCACCCTGG + Intergenic
1065778766 10:29146865-29146887 AAATTCCTAGAATTTCACCCTGG - Intergenic
1069934787 10:71907716-71907738 AAATGCCTATTGATAACCCCTGG + Intergenic
1073968668 10:109021228-109021250 AAATTCCCATAGAATCCCCAAGG - Intergenic
1075839600 10:125489080-125489102 AAATTCTTCTAGATTGCCACTGG + Intergenic
1079336199 11:19572877-19572899 ATATTCATATAGGTTTCCCCAGG - Intronic
1081640824 11:44752920-44752942 ACATTCCTCTAGAATCCCCTGGG + Intronic
1087190167 11:95245725-95245747 AAAATCCCATAACTTCCCCCTGG - Intergenic
1088080136 11:105902127-105902149 GCTTTCCTATATATTCCCCCAGG - Intronic
1088379096 11:109173601-109173623 AAAATGCCATAGTTTCCCCCTGG + Intergenic
1091218383 11:133917323-133917345 AAGTTCCTTTAGCTTCCACCTGG + Intronic
1091757652 12:3065368-3065390 AAATTCCAATAGAAGCCCGCTGG - Intergenic
1096629723 12:52918401-52918423 AAATTCATAAAGATCCCACCAGG + Intronic
1102937000 12:116906001-116906023 AAATGCCTACAGATGACCCCAGG - Intergenic
1105834751 13:24199705-24199727 AAATTCCAATACATTGCCGCAGG - Intronic
1106869974 13:34008659-34008681 AAATTCCAATAGATTCTTCATGG + Intergenic
1107271382 13:38621654-38621676 AAATTCCTCTAAATGCCCACAGG + Intergenic
1107610372 13:42107083-42107105 AAATTGCAATAGATTCACACAGG - Intronic
1107824845 13:44319351-44319373 AATTTACTATATATTCCCCCAGG + Intergenic
1108134781 13:47344008-47344030 AAATTCATATAGAATCCACAGGG + Intergenic
1108205825 13:48089096-48089118 AAATTCCTATTTAATCCCACGGG + Intronic
1109054697 13:57532662-57532684 AAACTCCTTTAGATTCCTTCTGG - Intergenic
1109245809 13:59953511-59953533 AAATTCCTATTGGTTCCTTCTGG - Intronic
1109516311 13:63446838-63446860 AAATTTCTATAGTTTCTACCTGG - Intergenic
1111008478 13:82281378-82281400 AAATTCCTGGAGATTCCCTTGGG - Intergenic
1113514410 13:110881636-110881658 AAATTCATATGAATTTCCCCTGG - Intronic
1116798110 14:49413384-49413406 AAATTGCTACAGAATCCCACTGG - Intergenic
1117269244 14:54124746-54124768 GAATACCTATAGATACCCCATGG - Intergenic
1120369120 14:83609223-83609245 AAATTGCTATAGTTTCCATCAGG + Intergenic
1120605204 14:86567546-86567568 ATATTCTTATATATTCCACCAGG + Intergenic
1123797084 15:23782917-23782939 AATTTCCAATAGATTCCCGGTGG - Intergenic
1124187747 15:27544700-27544722 AAATTCCCATGCATGCCCCCAGG - Intergenic
1125835723 15:42748882-42748904 AAAATCCTATAGATTTCCCTAGG - Intronic
1127845675 15:62868462-62868484 AAACTCCTACAGAGTGCCCCAGG + Intergenic
1128235824 15:66066408-66066430 AAATTCCTATAGATTCCCCCTGG - Intronic
1132111814 15:99107034-99107056 AAATACCTGTTGATTCTCCCTGG + Intronic
1137028393 16:35500507-35500529 AAATTCCTATAGAATCTTCCTGG + Intergenic
1137518338 16:49170032-49170054 AAATCCTTACAGATTCCTCCTGG + Intergenic
1139540527 16:67612197-67612219 AACTTCCTTTAAATTCCCGCTGG - Intronic
1141330854 16:83109251-83109273 CAAGTCCTACAGATTCCACCTGG - Intronic
1141836352 16:86542316-86542338 AAATTTCTATAGATTAGCTCGGG - Intronic
1153995252 18:10434613-10434635 AAAGTCCTAGAAAGTCCCCCAGG - Intergenic
1166631583 19:44411836-44411858 AAACTTCTCTAGATTCCCGCTGG + Intergenic
1167877329 19:52425186-52425208 AAAGACATAAAGATTCCCCCAGG - Intergenic
1202652079 1_KI270707v1_random:15178-15200 AAATTCATATGGAATCCCCAGGG + Intergenic
926948100 2:18210764-18210786 AAATTACTTTAAATTCCCCCAGG - Intronic
929977733 2:46651733-46651755 AACTTCCTATAGATTTCCAGAGG - Intergenic
931571130 2:63670367-63670389 AGATTCATATAGATTCTCCATGG - Intronic
936980992 2:118265204-118265226 AAATTCCCATAGAGTCCAACCGG + Intergenic
942152617 2:173092227-173092249 AAAAACCTATAGATTCCCCAAGG - Intronic
942275469 2:174319301-174319323 AATTTCTTATAAATTTCCCCTGG + Intergenic
945858766 2:215096834-215096856 ATATTCCTATATCTTCACCCTGG + Intronic
1171306613 20:24112477-24112499 GAATTCATCTAGAATCCCCCCGG - Intergenic
1171870325 20:30519861-30519883 AAATTTCTCTAGATTCCAGCTGG - Intergenic
1172227899 20:33317372-33317394 GAATTCCTCTCGATTTCCCCAGG + Intergenic
1174389219 20:50207416-50207438 AAATTCCTATGTTTTACCCCAGG + Intergenic
949333202 3:2945287-2945309 AAATTCAGACAGATTCCTCCGGG - Intronic
951393259 3:22133012-22133034 AAATTTCTATAGTTTCCCCAAGG + Intronic
956465308 3:69514868-69514890 AAATTCCTATGGATTCTCAAGGG + Intronic
956802825 3:72778119-72778141 AATTTCCTAGAGATTCCCTATGG - Intronic
957266651 3:77974923-77974945 AAATCCCTATAGATTCTCCTCGG - Intergenic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
962346324 3:134621227-134621249 AAATTCCTATAAATTCCAAGGGG + Intronic
965431040 3:168589124-168589146 AAATTCATATATATGCCCCAAGG + Intergenic
965517354 3:169635650-169635672 AAAATCCTATAGTTTCTCACAGG + Intronic
966948343 3:184793784-184793806 AAAACCCTAAAGATTCCTCCAGG - Intergenic
968792582 4:2677781-2677803 AAATTCATATAGAATCTCACGGG - Intronic
979675767 4:123408929-123408951 AAAGTCCCATAGATTCCCCATGG - Intergenic
984790286 4:183608859-183608881 AGATTTCTAAAGATTCCCCTAGG + Intergenic
986967589 5:13293844-13293866 AGATTACTATAAATTTCCCCTGG + Intergenic
987644067 5:20647369-20647391 AAAGTCCTATACATGCCCACAGG + Intergenic
990276696 5:54204877-54204899 AAATGACTATACATTCCTCCAGG - Intronic
991177537 5:63707329-63707351 ACATTCCTATAGATTGCCCCAGG + Intergenic
997179402 5:131812825-131812847 AAAATCCTAAAGGTTCACCCTGG - Intronic
997840117 5:137231525-137231547 AATTTCCTGAAGATTCACCCAGG + Intronic
1006402927 6:33828273-33828295 AGCTTCCCATAGATGCCCCCAGG + Intergenic
1017052478 6:150406742-150406764 AAATTCTTAAACATTCCCACAGG - Intergenic
1017998196 6:159553389-159553411 AAATTCCTGTAGGTAGCCCCAGG + Intergenic
1018567896 6:165175914-165175936 TAATTCCTATAGGTTCCCCTGGG - Intergenic
1025848230 7:65219130-65219152 AAACCCCTCTACATTCCCCCAGG + Intergenic
1027167197 7:75843312-75843334 AAATTCCTACACATTCCTTCTGG - Intronic
1028557042 7:92135456-92135478 ATATTCCTACTAATTCCCCCAGG - Intronic
1030465538 7:109898829-109898851 AAATTCAAAGAGATTCCTCCAGG - Intergenic
1030673988 7:112365811-112365833 AAATTCATAAAGATTCTACCGGG + Intergenic
1032588826 7:133173627-133173649 AAATTACTATAGATACCTCTTGG - Intergenic
1033012781 7:137640189-137640211 AATATCCTATAGATTCGTCCTGG - Intronic
1035941632 8:3908019-3908041 AAATACCTATGGAGTCCTCCTGG - Intronic
1037874074 8:22530054-22530076 AATTTCCTCTAGATTCCCAAAGG - Intronic
1041849242 8:62369579-62369601 ACATTCCTATAAATTCTCTCAGG - Intronic
1048200721 8:132371935-132371957 AAATTGCTACAAATCCCCCCTGG - Intronic
1048712733 8:137229994-137230016 ACATTTCCAAAGATTCCCCCAGG - Intergenic
1050720965 9:8589006-8589028 AAATCCCTATAGATTCTTACTGG + Intronic
1051037082 9:12761058-12761080 AAATTCCTGTAGGCTCCTCCAGG - Intergenic
1052070180 9:24072028-24072050 ACATTCTTATACATTCCACCTGG + Intergenic
1052787511 9:32843449-32843471 AAATTTCTAAACTTTCCCCCAGG + Intergenic
1059970573 9:119663673-119663695 AAATTCCTACAGAGTCCTCTTGG + Intergenic
1187731987 X:22264658-22264680 CAATTCCTCTGGATTCTCCCTGG - Intergenic
1192571397 X:72209128-72209150 AGATTCCTATAGATTCCTTCTGG + Intronic
1194557228 X:95375170-95375192 AAAATCCTAAAGACTCCTCCAGG + Intergenic
1195480406 X:105338405-105338427 AAATTCCTTTTGATTTCCTCTGG + Intronic
1196491656 X:116274604-116274626 AAATTCCTTTGGATGCCCCAAGG + Intergenic
1198801137 X:140448900-140448922 TAATTCCTATATATTCCACTGGG + Intergenic
1202360030 Y:24097937-24097959 AAATTCCAACAGATACACCCAGG - Intergenic
1202510747 Y:25572177-25572199 AAATTCCAACAGATACACCCAGG + Intergenic