ID: 1128235863

View in Genome Browser
Species Human (GRCh38)
Location 15:66066669-66066691
Sequence TGCCACACCCCTAGGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128235854_1128235863 -9 Left 1128235854 15:66066655-66066677 CCCTGCCATCTCCTTGCCACACC 0: 1
1: 0
2: 0
3: 32
4: 387
Right 1128235863 15:66066669-66066691 TGCCACACCCCTAGGGGGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 133
1128235855_1128235863 -10 Left 1128235855 15:66066656-66066678 CCTGCCATCTCCTTGCCACACCC 0: 1
1: 1
2: 2
3: 37
4: 440
Right 1128235863 15:66066669-66066691 TGCCACACCCCTAGGGGGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 133
1128235853_1128235863 5 Left 1128235853 15:66066641-66066663 CCACGGCTGCGAGTCCCTGCCAT 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1128235863 15:66066669-66066691 TGCCACACCCCTAGGGGGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 133
1128235852_1128235863 12 Left 1128235852 15:66066634-66066656 CCAAGCTCCACGGCTGCGAGTCC 0: 1
1: 0
2: 0
3: 24
4: 583
Right 1128235863 15:66066669-66066691 TGCCACACCCCTAGGGGGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128235863 Original CRISPR TGCCACACCCCTAGGGGGGC TGG Intronic
900659278 1:3774714-3774736 ACCCACACCTCTAGGAGGGCTGG - Intronic
900923597 1:5689395-5689417 TCCCACACACATAGGGAGGCAGG + Intergenic
901019523 1:6248864-6248886 CGCCACACCCTTCGGGGGGGGGG - Exonic
903185643 1:21627330-21627352 TGCCACACCCCAAGAGGGGAAGG + Intronic
903568514 1:24286700-24286722 TGCCACAGCCCTTGGGGTGCAGG + Intergenic
903736909 1:25535608-25535630 AGCCACACCCGGAGGGGTGCGGG + Intergenic
904825140 1:33269379-33269401 AGCCACACCCAGAGGGAGGCTGG - Intronic
904961280 1:34335067-34335089 TCCCAGACCCTTAGGGGTGCTGG - Intergenic
905168914 1:36098700-36098722 TGCCAGGCCCCAAGGGGGACAGG - Exonic
910323461 1:85976454-85976476 TGCCACACTCCTGTGGGGGAGGG - Intronic
911795612 1:102071924-102071946 TCCCACACCACTGTGGGGGCTGG - Intergenic
914195711 1:145446961-145446983 TCCCTCACCCCTAGTGTGGCTGG - Intergenic
918174361 1:182029970-182029992 CACCACACCCCCCGGGGGGCGGG + Intergenic
919851745 1:201677481-201677503 TCCCACACCCTGAGGGGGACGGG - Intronic
920380967 1:205534355-205534377 TTCCACACCCCCAGGCTGGCCGG - Intergenic
920386807 1:205575431-205575453 TTCCCCACCCCTGGGGTGGCAGG + Intronic
1066483678 10:35823103-35823125 TGCCACACCCCAAGCAGGGGTGG - Intergenic
1067085429 10:43235609-43235631 TCCCACACACCAATGGGGGCAGG - Intronic
1067479218 10:46584491-46584513 CGCCAAACTCCGAGGGGGGCTGG - Exonic
1067544705 10:47184532-47184554 GCCCACACCCCTACTGGGGCTGG + Intergenic
1067615521 10:47757310-47757332 CGCCAAACTCCGAGGGGGGCTGG + Intergenic
1068117481 10:52750819-52750841 TCCCACACCCCTAGGAGACCTGG + Intergenic
1068192402 10:53668211-53668233 AGTCACACTCCTAGGGGGGAGGG + Intergenic
1069995811 10:72341431-72341453 GGCCACACTCCTAGGAGGCCTGG - Intronic
1070126457 10:73625909-73625931 TGCGACACCCTCAGGGGGGCGGG - Intronic
1077245195 11:1533545-1533567 AGGCAGACCCCTAGGGTGGCTGG + Intergenic
1079023228 11:16925550-16925572 TGCCAGACCCCCAGCGTGGCGGG + Intronic
1079330637 11:19529934-19529956 TCCCACACCCCTAGAGGAGGAGG - Intronic
1083293075 11:61700477-61700499 GGCCACACCCTCAGGAGGGCAGG - Intronic
1084967658 11:72752758-72752780 GGCCACACCCCCAGGGGGATAGG + Intronic
1088653631 11:111978540-111978562 TGCCACTCCCCCAGCGGGGATGG + Intronic
1089605676 11:119639984-119640006 TCCCAGACCCCTCTGGGGGCGGG + Intronic
1090068659 11:123525417-123525439 TGCCCCACCCCTGCGGGGGAGGG - Intergenic
1090665902 11:128914797-128914819 TGCCACACCCCATGAGGAGCAGG + Intronic
1090853221 11:130588786-130588808 TGTCACATCCCTGGGGGGGATGG - Intergenic
1092753057 12:11737016-11737038 TCCCACACACCCAGGGGGGAAGG - Intronic
1095803860 12:46296806-46296828 TGCCACTCCTCTGGAGGGGCTGG + Intergenic
1096694322 12:53339031-53339053 TGCCCCACCCCCTGGGAGGCTGG - Intronic
1097237049 12:57547251-57547273 TGCCACACCCCTGGAGAGGCCGG + Intronic
1105567459 13:21564650-21564672 TTCCATCCCCCTAGGGTGGCTGG + Intronic
1105878312 13:24580407-24580429 AGCCACACCCCTAGGGAGGAGGG - Intergenic
1108999358 13:56778387-56778409 TGCCAGACTGCTAGTGGGGCAGG - Intergenic
1113788762 13:113016412-113016434 TGCCAAGCCCCTGGGGGAGCTGG + Intronic
1115694414 14:35881255-35881277 TGCCACACCCCTGGACAGGCTGG - Intronic
1119031082 14:71193162-71193184 TGTGACACCCCAAGGAGGGCAGG + Intergenic
1121928431 14:97949654-97949676 TGCCACATCCCAAGGGGTTCAGG + Intronic
1125972043 15:43919718-43919740 AGCCACACCCCTGGGGAGGGTGG - Intronic
1126920239 15:53513392-53513414 CCCCACACCCCTTGTGGGGCTGG + Intergenic
1128235863 15:66066669-66066691 TGCCACACCCCTAGGGGGGCTGG + Intronic
1132799745 16:1746144-1746166 TCCCACACCTCAAGGAGGGCCGG + Intronic
1132909314 16:2300130-2300152 TCCCACACCAATAGGAGGGCTGG + Exonic
1133454823 16:5932856-5932878 TGCCACAACCATATGGGAGCAGG - Intergenic
1137538137 16:49342835-49342857 AGCCACTCCCCTAGGCTGGCCGG - Intergenic
1140223016 16:73057953-73057975 TGCCCCACCCCGAGAGGCGCCGG - Intronic
1140396000 16:74627410-74627432 TACCCCACCCCTAAGGGAGCAGG + Intronic
1141963703 16:87426668-87426690 AGCCACACCCCTAAGGGGACAGG + Intronic
1142266329 16:89065519-89065541 GGCTACACCCTTAGGGGTGCGGG + Intergenic
1142671144 17:1487974-1487996 TTCCCCACCCCTGGGCGGGCTGG - Intronic
1142685060 17:1572776-1572798 TGCCACACCCTGAGGGTGGGTGG + Intronic
1142687853 17:1588002-1588024 TGCCACACCCTGAGGGTGGGTGG + Intronic
1143165199 17:4894054-4894076 TGCCGCCCCCGTATGGGGGCTGG - Exonic
1143523812 17:7461423-7461445 AGCCACACTCCCAGGTGGGCGGG + Exonic
1146259179 17:31410638-31410660 TGTCACACCCTTGGAGGGGCTGG + Intronic
1148464308 17:47855834-47855856 TACCACTCCCCTAGGAGAGCTGG - Intronic
1148851078 17:50555667-50555689 TGCCCCACCCCAAGGGGGTTGGG - Exonic
1149499277 17:57139155-57139177 TTCCCCACCCCTAGAGGGCCTGG + Intergenic
1152794923 17:82302068-82302090 TCCCACACCCTCAGCGGGGCAGG - Intergenic
1156372561 18:36484741-36484763 CACCACACCCCCTGGGGGGCTGG - Intronic
1158441110 18:57475018-57475040 CACCACACCCCTAGGGGAGCTGG + Intronic
1162031995 19:7921528-7921550 TGCCTCACCTCTATGGGGGCTGG - Exonic
1162156948 19:8684661-8684683 TCCCACAGCCCTCGGGGGGTAGG - Intergenic
1162968124 19:14165350-14165372 TGCCACACACCTGGTGGGGGTGG - Intronic
1163398057 19:17075690-17075712 TGCCCCGCCCCTAGGAGCGCTGG + Intergenic
1166065932 19:40358930-40358952 TGTCATACTCCAAGGGGGGCAGG + Intronic
1166948967 19:46413703-46413725 GGCCACACCCCTGTGGGGGAGGG - Intergenic
1168500051 19:56885479-56885501 TGGCACACCCCCACGGGGGATGG + Intergenic
925990359 2:9249763-9249785 TGCCACCCCCAGAGGAGGGCAGG + Intronic
933968905 2:87454051-87454073 TGCCACACCCCTGGGGCCTCAGG + Intergenic
934965924 2:98722513-98722535 TGCCTAACCCCTAGGAGGGGAGG + Intronic
935177678 2:100663990-100664012 TGCCTCAGCCCCAGTGGGGCAGG + Intergenic
938094115 2:128450574-128450596 TGCCCCAGGCCCAGGGGGGCAGG - Intergenic
938697218 2:133845126-133845148 ATTCACACCCCTAGAGGGGCAGG - Intergenic
948159645 2:235813551-235813573 GCTCAGACCCCTAGGGGGGCGGG + Intronic
1169117088 20:3072674-3072696 TGCCACCACCCTGGAGGGGCTGG + Intergenic
1171370774 20:24660882-24660904 GGCCCCACCCCTGAGGGGGCCGG + Intronic
1172222716 20:33284782-33284804 TGCCACACCCCTGTGGAGGGAGG + Intronic
1184093664 22:42305300-42305322 TGCCATGCCCTGAGGGGGGCAGG - Intronic
1184341453 22:43888241-43888263 CCCCACACCCCTGGGCGGGCAGG - Intronic
1185067611 22:48639949-48639971 TGCCACAGGCCTTGGGCGGCGGG - Intronic
1185320568 22:50198612-50198634 TGCCACCCCCCATGGGGGTCTGG + Exonic
950424800 3:12919352-12919374 TGCCACCTCCCTTGGGAGGCAGG - Intronic
953543619 3:43843847-43843869 TGCCACACCCCCAGGGATGCGGG + Intergenic
953928281 3:46993359-46993381 TGCCCCACCCTGAGGGGGTCAGG - Intronic
954198095 3:49007967-49007989 GGCCACACCCCCTGAGGGGCCGG - Intronic
954754259 3:52830715-52830737 TGCCCCACCCACATGGGGGCAGG + Exonic
954982960 3:54762502-54762524 TGCCAGGCCCCAGGGGGGGCAGG + Intronic
955538245 3:59947636-59947658 TGCTGCAACCCTGGGGGGGCTGG + Intronic
959464876 3:106673250-106673272 TGGCACATACCTAAGGGGGCAGG + Intergenic
961391644 3:126555807-126555829 TGGCACAGCCCTGGAGGGGCAGG - Intronic
961734466 3:128992921-128992943 TGCCCCACCCCAAAGCGGGCTGG - Intronic
968726806 4:2251638-2251660 GGCCACAGCCCGATGGGGGCGGG - Intronic
968758043 4:2426940-2426962 TGCCACAGCCCTGGGGCGCCTGG - Intronic
969966928 4:11006134-11006156 TGCCACATGTCTAGGGTGGCTGG + Intergenic
971732723 4:30406702-30406724 TGCCTCAGCCCCAGTGGGGCAGG - Intergenic
972097246 4:35363964-35363986 TGCCACATCCCTAGGGGAAGTGG - Intergenic
974615331 4:64272430-64272452 TGCAGAACCCCAAGGGGGGCGGG - Intergenic
975811882 4:78178099-78178121 TGCCACAAGCCTAGGAGGCCAGG - Intronic
981678859 4:147371130-147371152 TGCCACACCCCTAGGCCGTATGG + Intergenic
998071123 5:139198518-139198540 TGCCCCTCCCCTTGGGGGGAGGG + Intronic
1005315673 6:24600461-24600483 AGCCACATCCCTAGGAGGTCTGG + Intronic
1006116860 6:31780196-31780218 TGCCAGAACCCCATGGGGGCAGG + Intronic
1007370189 6:41421817-41421839 TGGCAGACCCCTTGGGTGGCGGG + Intergenic
1007698133 6:43746880-43746902 TGCCCCCTCCCTTGGGGGGCTGG + Intergenic
1013988773 6:116229029-116229051 TCCCACAGCCCCAGGGTGGCAGG + Intronic
1016750300 6:147624326-147624348 TGCCACATCCCCTGGGGGGTGGG - Intronic
1017428576 6:154347531-154347553 TGCCACACAGCCAGTGGGGCTGG + Intronic
1018035494 6:159877870-159877892 TGCCACAGCCCTAGGTGATCTGG + Intergenic
1019062613 6:169266871-169266893 TGCCCCACCCCTGGGGGCCCTGG - Intergenic
1022471321 7:30683328-30683350 TTCCACACCAGTAGCGGGGCAGG + Intronic
1023864249 7:44231379-44231401 GGCCACAGCACTAGGGTGGCAGG - Intronic
1025028138 7:55534924-55534946 TGCCACACCACAAAGGAGGCTGG + Intronic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1029521642 7:101066565-101066587 TGCCCCACCCCCAGGGTGTCTGG - Intergenic
1032088711 7:128898424-128898446 TGCCACACCCCTAGCTGTGCTGG + Intronic
1034369464 7:150582368-150582390 TGGCCCACCCCTTGGAGGGCTGG + Intergenic
1034412103 7:150947164-150947186 TGCCACACCTCTAGCGCGGAGGG - Intronic
1034488055 7:151378619-151378641 TGCCGCACGCCAAGCGGGGCTGG + Intronic
1034684264 7:152956198-152956220 TGCCACTCCTCTGGGGGCGCCGG + Intergenic
1035231228 7:157467246-157467268 TGCCCCACCCATAGGGTGGCTGG + Intergenic
1035425319 7:158767585-158767607 TGCCACACCCGCAGGCAGGCAGG + Intronic
1035543161 8:457929-457951 TGCCACACCACTGGGTGGCCTGG - Intronic
1036725422 8:11216428-11216450 TGTCACTCCCCTAGGGGTGCAGG - Intergenic
1037767748 8:21782404-21782426 TGCCACCCTCCTAGGTGGGGCGG + Intronic
1037998418 8:23369814-23369836 AGCCACACTACTAGGGGGTCAGG - Intronic
1039000913 8:32979443-32979465 AGCCACACCCCTAGGGGAACAGG - Intergenic
1044838224 8:96315902-96315924 TTCCTCACCCCCAGGGGTGCTGG - Intronic
1049368606 8:142252881-142252903 GGCCACTGCCCTAGTGGGGCAGG + Intronic
1050191972 9:3035793-3035815 TGCCACAGCACTAGGGTGCCAGG - Intergenic
1059308018 9:113369851-113369873 TGCCAGAACCCTTGCGGGGCAGG - Exonic
1060481533 9:124019024-124019046 TGCCCCACCCCCAGTGGAGCTGG + Intronic
1061678780 9:132232422-132232444 TGGCAGACCCCTGAGGGGGCAGG - Intronic
1061865620 9:133490613-133490635 TGCCACACCCTGAGGGGCACTGG + Intergenic
1061935029 9:133852821-133852843 TGCCACTCGGCTAGGGGTGCAGG + Intronic
1062444570 9:136588204-136588226 TTGCACACCCCCATGGGGGCGGG + Intergenic
1062698955 9:137889389-137889411 TCCCTCACCCCTAGTGTGGCTGG + Intronic
1199777178 X:151022608-151022630 TGCCACACGCCTAGGGTGTATGG - Intergenic
1202044026 Y:20718982-20719004 GGCCACACCCCTAGCTGTGCTGG - Intergenic