ID: 1128236223

View in Genome Browser
Species Human (GRCh38)
Location 15:66069202-66069224
Sequence CAGGACCAAACAGACTTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128236223_1128236225 -8 Left 1128236223 15:66069202-66069224 CCGTCCAAGTCTGTTTGGTCCTG 0: 1
1: 0
2: 2
3: 9
4: 131
Right 1128236225 15:66069217-66069239 TGGTCCTGAGCTCAGAAAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 209
1128236223_1128236227 -4 Left 1128236223 15:66069202-66069224 CCGTCCAAGTCTGTTTGGTCCTG 0: 1
1: 0
2: 2
3: 9
4: 131
Right 1128236227 15:66069221-66069243 CCTGAGCTCAGAAAGAAGGAAGG 0: 1
1: 0
2: 6
3: 44
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128236223 Original CRISPR CAGGACCAAACAGACTTGGA CGG (reversed) Intronic
903229368 1:21912568-21912590 GGGAACCAACCAGACTTGGAGGG + Intronic
903310083 1:22448625-22448647 CAGGAGGAAACAGACTTAGAGGG - Intergenic
906935329 1:50209521-50209543 AAGGATAGAACAGACTTGGACGG + Intergenic
911057936 1:93723655-93723677 CAGGAACAACAAGACTTGGGAGG + Intronic
912913820 1:113791051-113791073 GAGGAACAAACAGAATTGGGAGG + Intronic
914419611 1:147517381-147517403 CGGGAAAAAAAAGACTTGGAAGG - Intergenic
917593699 1:176505233-176505255 GAGGACAAAATAGCCTTGGAAGG - Intronic
918127528 1:181597435-181597457 CAGGACAAAACACACTTCGTTGG + Intronic
922085225 1:222340169-222340191 CAGGAGCAAACAGGCTAGAAAGG - Intergenic
922372139 1:224922305-224922327 CAGGAAAAAACAAACTTGGAAGG + Intronic
923694549 1:236234697-236234719 GAGAACCAAATAGACTTGGAAGG - Intronic
924726181 1:246673239-246673261 CAGCACAAAACAGACTAAGATGG + Intergenic
1066291978 10:34022629-34022651 CCCGATCAAACAGAGTTGGATGG + Intergenic
1072968495 10:99995589-99995611 CATGACCAAACAGGCTTGTTGGG + Intronic
1073015300 10:100394247-100394269 CAGGACAGAAAAAACTTGGAGGG - Intergenic
1075276295 10:121095907-121095929 CAGGACCACACAGGCAAGGAAGG + Intergenic
1076751515 10:132545763-132545785 CAGCACCAACCAGACCTGGTGGG - Intronic
1078794656 11:14580252-14580274 CAGGAGCAGACAGTCTTTGAGGG - Intronic
1080554334 11:33402308-33402330 CAGGACCAATCAGATATGCAGGG - Intergenic
1080729637 11:34936273-34936295 TATGCCCAAACAGACTTGGTTGG - Intronic
1089119440 11:116123453-116123475 CAGGAGCAGACAGACTTGCAAGG + Intergenic
1089394745 11:118129251-118129273 CAGGACCAGAGAACCTTGGAGGG - Intergenic
1094053240 12:26243221-26243243 CAGGACCAAACAATCTTGCTGGG + Intronic
1096594805 12:52688124-52688146 CAGGAGCACACGGACTAGGAAGG - Intergenic
1097713910 12:62944857-62944879 CTGGAGGAGACAGACTTGGAAGG - Intergenic
1098817646 12:75188135-75188157 CAGAACAAAACAGACATGGCTGG - Intronic
1102581074 12:113888321-113888343 CAGAACCAAATAGTCTTTGACGG - Intronic
1108841285 13:54619038-54619060 CACGACCAAGCAGAATTGGGTGG - Intergenic
1113613816 13:111666861-111666883 CAGGACAAAACTGACCTGGCAGG + Intronic
1118150082 14:63179719-63179741 CAATACCCAGCAGACTTGGAAGG + Intergenic
1121333662 14:93063604-93063626 CAGGACTGCACAGCCTTGGAGGG + Intronic
1121813367 14:96910924-96910946 CAGGACCTTACAGTCTGGGAAGG - Intronic
1125425018 15:39539935-39539957 CAGGAACCAACAGACATAGATGG + Intergenic
1126624879 15:50677055-50677077 CAATACCACACAGACTTGGTGGG + Intronic
1128236223 15:66069202-66069224 CAGGACCAAACAGACTTGGACGG - Intronic
1129667135 15:77585480-77585502 CAGGATAGAACAGACTGGGAGGG - Intergenic
1131097949 15:89667657-89667679 GAGGACCAGACAGACACGGAGGG - Exonic
1131207702 15:90465389-90465411 GAGGCCCAGACAGACTGGGAAGG - Intronic
1132026786 15:98410667-98410689 CAGGAGGAAACAGATCTGGAGGG + Intergenic
1134194027 16:12144691-12144713 CAGCACAAAACAGACTGAGACGG + Intronic
1135901259 16:26462082-26462104 TGGGACTGAACAGACTTGGAGGG - Intergenic
1135904996 16:26503564-26503586 GAGGAACAAAGAGCCTTGGATGG - Intergenic
1137571960 16:49572324-49572346 CAGGACCACAGAGAGTGGGAAGG + Intronic
1137932090 16:52598577-52598599 TAGGACGATGCAGACTTGGAAGG + Intergenic
1144711973 17:17407145-17407167 CAGGAAGAAACAGACTGGGAGGG + Intergenic
1144848346 17:18231553-18231575 GATGAGCACACAGACTTGGAGGG - Intronic
1145127592 17:20314947-20314969 CAGGAGCACACAGACTTTGGTGG - Intronic
1146634263 17:34492487-34492509 CAGAACAAAACAGACATGCAGGG + Intergenic
1146798728 17:35801607-35801629 CAGGACCCAGCAGACTTGCAAGG + Intronic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1149333955 17:55615730-55615752 AAGGAAAAAACAGAGTTGGAAGG - Intergenic
1149564614 17:57632180-57632202 CATGACCAAACAGGCTTGTTGGG + Intronic
1150469021 17:65420124-65420146 TAGAACCAAACAGAGTTAGAAGG + Intergenic
1157460585 18:47889304-47889326 GAGGACCACACAGGCCTGGAAGG + Intronic
1160749643 19:727819-727841 CAGGACCCAACATGCTTTGAGGG + Intronic
1161839389 19:6669893-6669915 CAGGAGGAACCAGCCTTGGACGG + Exonic
1162574286 19:11489836-11489858 AAGAACCAAATAAACTTGGAAGG - Intronic
1162867299 19:13557943-13557965 CATGACCACACAGAATTGCAAGG - Intronic
1163113761 19:15177463-15177485 CACGGACAAACAGACTGGGATGG + Intronic
1163540396 19:17905713-17905735 CAAAACAAAACAGACTTTGACGG - Intergenic
1164786622 19:30936129-30936151 CAATACAAAACAGAATTGGAGGG - Intergenic
926284035 2:11473188-11473210 CCGGAACAAACACACTTGGCAGG + Intergenic
928291014 2:30037425-30037447 AAGGACCAAACAGCCATGGCTGG - Intergenic
932755776 2:74408305-74408327 CACTACCCAACAGACTTGGTAGG - Intergenic
932946526 2:76238912-76238934 CAGCACCAAACAGACCTCCATGG - Intergenic
937633812 2:124133274-124133296 AAGGACCAAAGGGCCTTGGAAGG - Intronic
937981381 2:127618111-127618133 CAGGGACAAACAGACCTGAAGGG - Intronic
940143158 2:150517460-150517482 AAGTTCCAAACAAACTTGGATGG - Intronic
942465696 2:176205214-176205236 CAGGAAGAAACAGCCTTTGAAGG + Intergenic
947388878 2:229620102-229620124 CAGAACCAAAGCGACTCGGATGG + Intronic
948601256 2:239108603-239108625 CAGGACCAGGCAGACTTTGAGGG - Intronic
1175636162 20:60586293-60586315 CAGAATTAAACAGACATGGAAGG - Intergenic
1178411377 21:32366319-32366341 CAGGACTAGAAAGGCTTGGAGGG + Intronic
1183372350 22:37440917-37440939 CAGGACGTATCAGACTTGGGTGG + Intergenic
1185015542 22:48340529-48340551 CAGGGCCACACAGCCATGGAGGG + Intergenic
1185209433 22:49561276-49561298 CAGAACAAAACAGACTAAGACGG + Intronic
954177699 3:48857621-48857643 CAGAACTAAGCAGTCTTGGAGGG - Exonic
954935437 3:54322485-54322507 AATGACCAAACAGGCTTGGCAGG + Intronic
959128817 3:102325487-102325509 CAGGATCAGACAGACATGCAAGG - Intronic
959365375 3:105451568-105451590 CAAAACAAAACAGACTTTGAGGG + Intronic
960849842 3:122041523-122041545 CAGCACAAAACAGACTAAGATGG + Intergenic
962268226 3:133958523-133958545 CAGGACCAAATAGGCATGTAGGG + Intronic
963194905 3:142516212-142516234 AAGGACCATACAGACTAAGATGG - Intronic
963726464 3:148927364-148927386 CAGAACCAACAGGACTTGGATGG - Intergenic
965453331 3:168866294-168866316 AAGGAAAAAACAGGCTTGGAAGG - Intergenic
966752043 3:183331379-183331401 CAGGAAGAGACAGGCTTGGAAGG - Intronic
966826140 3:183966629-183966651 GATGACCAACCAGATTTGGAGGG - Intronic
967791590 3:193555165-193555187 CAGGACAATACAGAGTTGGCAGG + Intronic
971517725 4:27509517-27509539 CAGGATGGAACAGACTTGCAGGG + Intergenic
971719976 4:30232790-30232812 CAGAACCAAGCAGCCTTGGCAGG + Intergenic
972407219 4:38758206-38758228 AACCAACAAACAGACTTGGAGGG - Intergenic
972698556 4:41471801-41471823 CAGGAACAAACATACATGGCTGG - Intronic
973615155 4:52670728-52670750 CAGGACCAAAGAGAATTATAGGG - Intergenic
973812443 4:54584675-54584697 CAAGACCAAACAGTCCGGGATGG + Intergenic
981487003 4:145297420-145297442 GAGGACCAGACAGACTGGCATGG - Intergenic
984385321 4:179048386-179048408 CAGGAGTACACAGACTTGGAAGG + Intergenic
993518875 5:88873585-88873607 CAAGATCAAACAGTCTTGGAAGG + Intronic
994662259 5:102668102-102668124 CCGGACCATACAAACGTGGAGGG + Intergenic
996486433 5:124040986-124041008 CAAGAACAACCAGACTTGGCAGG + Intergenic
1000119224 5:158180672-158180694 AAGGACCAAACAGATTGGAAAGG - Intergenic
1002994691 6:2271840-2271862 CAGGAACCACCAGACTTGAATGG - Intergenic
1004353715 6:14913107-14913129 CAGGAACCCACAGACTGGGAGGG - Intergenic
1006375921 6:33671524-33671546 CAAGACCAAGCAGGGTTGGAAGG - Intronic
1008051148 6:46901621-46901643 CAGGATCACACAGACTTTAAAGG + Intronic
1008064506 6:47033029-47033051 CAGGACCATTCCGGCTTGGAAGG - Intronic
1008861179 6:56151737-56151759 CTGGACCAAGGAAACTTGGAAGG - Intronic
1016935039 6:149443409-149443431 CTGGGCCACACACACTTGGAGGG - Intergenic
1017999666 6:159568139-159568161 CAGGACCCAGCAGGTTTGGAGGG + Intergenic
1019920615 7:4161094-4161116 CAGGACCACACAGATTTGGAGGG + Intronic
1022375755 7:29809484-29809506 CATGACAAAACAAACTTCGAGGG + Intronic
1023256499 7:38317933-38317955 CAGAAGCAAACAAACTGGGATGG - Intergenic
1023279143 7:38552202-38552224 CTGTACCAAATGGACTTGGAGGG + Intronic
1023302795 7:38791861-38791883 CAGCACCAAAAAGACTTGACAGG + Intronic
1023831135 7:44039603-44039625 CAGGGCCAAGGAGGCTTGGATGG - Intergenic
1029741463 7:102493909-102493931 CAGGGCCAAGGAGGCTTGGATGG - Exonic
1029759455 7:102593078-102593100 CAGGGCCAAGGAGGCTTGGATGG - Exonic
1029776822 7:102688988-102689010 CAGGGCCAAGGAGGCTTGGATGG - Intergenic
1030956936 7:115864572-115864594 AAGGACCAAACAGAATTCAATGG - Intergenic
1033059865 7:138095878-138095900 CAGCACAAAACAGACTGAGAAGG - Intronic
1035195995 7:157220967-157220989 CAGGACAAAACAGAAATGGGTGG - Intronic
1037781771 8:21874383-21874405 CAGAATGAAACAGATTTGGATGG - Intergenic
1039247038 8:35620414-35620436 CAGGACCAAAGAACCTTTGATGG - Intronic
1040353386 8:46590912-46590934 CAGCACCAAACAGGCATGGTGGG + Intergenic
1040876712 8:52160375-52160397 CAGTAGTAAACAGACTTGAAAGG - Intronic
1041453270 8:58030697-58030719 CAGGAGCCAACAGACAGGGAAGG - Intronic
1046797317 8:118387081-118387103 CTGGACCAGCCAGACTGGGATGG - Intronic
1049408149 8:142460771-142460793 CAGGACCAGCCAGGCATGGAAGG - Intronic
1050488897 9:6166289-6166311 CAGATCAAAACTGACTTGGAAGG + Intergenic
1050704652 9:8383395-8383417 CAGGGCCAAAGAGACTGGGCTGG - Intronic
1050756667 9:9012632-9012654 GAGAACAAAACAGACTTTGAAGG + Intronic
1051215396 9:14792165-14792187 CAGGTCCAAGGAAACTTGGAGGG - Intronic
1057016549 9:91657531-91657553 CAGGACCAAACAGCCTGAGTTGG - Intronic
1057749615 9:97781266-97781288 CTGGACCAGACAAACTCGGAGGG - Intergenic
1057846858 9:98532557-98532579 CAAGGCCAAGCACACTTGGAGGG - Intronic
1060477306 9:123996547-123996569 CAGGTAGAAACAGACTTGGGAGG + Intergenic
1060680235 9:125556225-125556247 CAGGACCACACACACTAGTAAGG + Intronic
1186428599 X:9485235-9485257 AAGGACCACATAGACTTCGAGGG + Intronic
1187711207 X:22056389-22056411 CATGACCAAACAGACTTAGAAGG - Intronic
1188512853 X:30955613-30955635 CAGAACCAAGCAGAGATGGAAGG + Intronic
1192947660 X:75983512-75983534 CAGGAGCAGACAGATCTGGAAGG - Intergenic
1196267221 X:113664519-113664541 CATGAGCAAACAGACAAGGAAGG + Intergenic
1199804359 X:151283058-151283080 CAGGATAAAACAGAACTGGAAGG + Intergenic
1200216956 X:154372137-154372159 CAGGAGCAAGCAGCCTTCGAAGG + Intronic