ID: 1128240177

View in Genome Browser
Species Human (GRCh38)
Location 15:66096274-66096296
Sequence CGCCCTCGGCAGAGACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128240177_1128240181 17 Left 1128240177 15:66096274-66096296 CCCTGGGGTCTCTGCCGAGGGCG 0: 1
1: 0
2: 0
3: 14
4: 152
Right 1128240181 15:66096314-66096336 CTTGCAACCTGCCGAGTGTCAGG 0: 1
1: 0
2: 2
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128240177 Original CRISPR CGCCCTCGGCAGAGACCCCA GGG (reversed) Intronic
900245847 1:1635787-1635809 GGCCCGCGGCAGAGGCCCCCTGG + Exonic
900257072 1:1702930-1702952 GGCCCGCGGCAGAGGCCCCCTGG + Exonic
900340272 1:2185252-2185274 CCCCCTCGGCAGGGTCCCCGCGG - Exonic
900546290 1:3231057-3231079 GGCCCACGGCAGAGACACCACGG - Intronic
901439957 1:9271925-9271947 AGCTCTGGGCAGGGACCCCATGG + Intergenic
902189779 1:14754193-14754215 CACCCTGGGCAGAAAGCCCAGGG - Intronic
902458548 1:16553964-16553986 TGCCATCCACAGAGACCCCAAGG - Intergenic
902976228 1:20090498-20090520 CAGTCTCAGCAGAGACCCCATGG - Intronic
903734373 1:25520939-25520961 AGCCCTCGGCTCAGGCCCCAAGG + Intergenic
905883052 1:41476902-41476924 CGCCCTTGGCACAGGCCCCGGGG - Intergenic
907714885 1:56917295-56917317 CTCCCTGGACAGAGCCCCCAGGG + Intronic
907918649 1:58893484-58893506 CGCCTTGAGCAGAGGCCCCATGG + Intergenic
913607096 1:120476400-120476422 TGCCGTCCACAGAGACCCCAAGG + Intergenic
914584098 1:149045438-149045460 TGCCGTCCACAGAGACCCCAAGG - Intronic
914678965 1:149925903-149925925 CCCCATCGGCAGGAACCCCAGGG - Exonic
915299983 1:154946305-154946327 AGGCATTGGCAGAGACCCCAGGG + Exonic
918041904 1:180918688-180918710 TGCCCTCCGCAGAAACCACAAGG - Intronic
1062764286 10:49065-49087 CGTCCCCGGCAGGGAGCCCAGGG + Intronic
1066649195 10:37639340-37639362 CACCCTCTGCAGAGTCCCCAGGG - Intergenic
1067032060 10:42884746-42884768 CACCCTCCGCAGAGTCCCCAGGG - Intergenic
1077144367 11:1037977-1037999 TGCCCCCGGAAGAGGCCCCAGGG + Intergenic
1077221571 11:1420337-1420359 CGCCCTTGGCAGATGCTCCAGGG + Intronic
1077252153 11:1565464-1565486 CGCCCCTGGCTGTGACCCCAAGG + Intronic
1077268189 11:1662389-1662411 CCTCCTCAGCAGTGACCCCAGGG + Intergenic
1077272693 11:1689229-1689251 CCTCCTCAGCAGTGACCCCAGGG - Intergenic
1080668708 11:34357580-34357602 CGCCCTCGGCAGGCTCCCCATGG - Exonic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1082785379 11:57313607-57313629 CCCCCTCGGCAGGGAGCCCCGGG + Exonic
1083047385 11:59749076-59749098 CCCCAACAGCAGAGACCCCAGGG - Intronic
1083654074 11:64220591-64220613 GGCCCTCGGCAGAGGCATCAGGG - Exonic
1083684937 11:64370254-64370276 CGCCCTGGCCAGAGGCCCCCTGG - Exonic
1085276658 11:75304566-75304588 CGCCCCCGGCTGAGAACCAACGG - Intronic
1085454953 11:76660420-76660442 CAGCGTCCGCAGAGACCCCAGGG + Exonic
1087841461 11:102924985-102925007 CGCCCTCAGCTGAGATCCCCTGG + Intergenic
1089613142 11:119680843-119680865 CTCCCTGGGCAGAGGCCCCATGG + Intronic
1089754690 11:120678087-120678109 TCCCCTCTGCAGAGACCCCGAGG + Intronic
1095948366 12:47766752-47766774 TGCCCTCTGCAGAGACCTCTAGG + Intronic
1101777330 12:107806492-107806514 CTCCCTGAGCAGGGACCCCAAGG + Intergenic
1102022376 12:109692807-109692829 TGCCATGTGCAGAGACCCCAGGG + Intergenic
1103614331 12:122142557-122142579 GGCCCTGGGCTGAGTCCCCATGG - Exonic
1103786369 12:123436240-123436262 GGCCCTGGGCAGCGACCCCCGGG - Exonic
1103952512 12:124558715-124558737 GGCCCACGGCACTGACCCCAGGG - Intronic
1111013664 13:82347689-82347711 CGCCATGAGCAGAGACCACATGG + Intergenic
1113614445 13:111670819-111670841 CCCCCTCCACACAGACCCCAGGG - Intronic
1113619913 13:111755733-111755755 CCCCCTCCACACAGACCCCAGGG - Intergenic
1113874927 13:113588274-113588296 GGCCCTCTACAGAGGCCCCAGGG - Intronic
1114615827 14:24067906-24067928 CAGCCTTGGCAGAGCCCCCAGGG + Intronic
1118571533 14:67199883-67199905 CCCCATCGGCAGGAACCCCAGGG + Intronic
1120295393 14:82633874-82633896 GGCCCTCTGCAGCGCCCCCAGGG + Intergenic
1121660742 14:95633158-95633180 GGACCTTGGCAGAGTCCCCAGGG + Intergenic
1122794786 14:104200771-104200793 CACCCTTGGGAGAGACCCCTGGG + Intergenic
1123034054 14:105464662-105464684 CCCCTTCCGCAGAGTCCCCACGG + Exonic
1123106957 14:105846147-105846169 GGCCCTCCACAGGGACCCCATGG - Intergenic
1123110558 14:105865068-105865090 AGCCCATGGCGGAGACCCCAGGG + Intergenic
1123762985 15:23446892-23446914 GGCCCTTGCCAGTGACCCCAGGG - Intronic
1127386966 15:58474723-58474745 CACCCTGGGCAGAGAGGCCAGGG - Intronic
1128214009 15:65921993-65922015 GGCACTCGGCACAGACCACATGG + Intronic
1128240177 15:66096274-66096296 CGCCCTCGGCAGAGACCCCAGGG - Intronic
1128607388 15:69047145-69047167 CACCCACGGCACACACCCCAGGG + Intronic
1129184030 15:73894768-73894790 CCCCCATGGCAGAGACCCCCTGG + Intergenic
1132400352 15:101501457-101501479 CTCCCCCAGCAGAGACCCCCAGG + Intronic
1134442432 16:14307258-14307280 TGCCCTCGCCAGAGCCCACAGGG - Intergenic
1141095436 16:81159701-81159723 AGCCCCCGGCAGGGACCTCACGG - Intergenic
1141644817 16:85361732-85361754 GGCCCTGGGCAGAGTCCCCCAGG + Intergenic
1142274005 16:89106126-89106148 ATCCCCAGGCAGAGACCCCAGGG - Intronic
1142440364 16:90094174-90094196 CGTCCCCGGCAGGGAGCCCAGGG - Intergenic
1142768027 17:2076582-2076604 CCACCTCGGCACAGACTCCAGGG + Intronic
1143053109 17:4142892-4142914 CGCCCAAGACGGAGACCCCATGG - Exonic
1143346160 17:6250707-6250729 CGCCATGGACAGAGAACCCACGG + Intergenic
1143962183 17:10729973-10729995 CGGCCACGGCAGTGTCCCCAAGG - Exonic
1144955988 17:19019155-19019177 CTGGCTCCGCAGAGACCCCAGGG + Intronic
1146658030 17:34646468-34646490 TCCCCTCTGCAGAGACCCCATGG - Intergenic
1148557062 17:48585054-48585076 CGCCGGCCGCAGAAACCCCAGGG + Intronic
1148561535 17:48609582-48609604 CAGACTCGGCAGGGACCCCATGG + Intronic
1151259952 17:72908493-72908515 TGCCCTTGGCAGAGACGGCACGG - Intronic
1152189568 17:78880161-78880183 AGCCCCAGGCAGAGACGCCACGG + Intronic
1152260650 17:79265080-79265102 CACGCTCGGCAGTGACCACAGGG + Intronic
1152868114 17:82736136-82736158 GGCCCCTGGCAGGGACCCCACGG + Intronic
1152957197 18:49384-49406 CGTCCCCGGCAGGGAGCCCAGGG + Intronic
1154172950 18:12063883-12063905 CTCCCTGAGCAGGGACCCCATGG + Intergenic
1158823606 18:61189300-61189322 TGCCCTCTGCACAGTCCCCATGG - Intergenic
1160869644 19:1271397-1271419 GGCCCCCGGCAGAGCCACCACGG - Exonic
1160880779 19:1319006-1319028 CGAACTGGGCAGAGGCCCCAGGG - Intergenic
1161851378 19:6739669-6739691 CGCCCTCGGCTGAGTCTCCCCGG + Exonic
1163299758 19:16436946-16436968 CGCCCTCTGCAGAGGCCCACTGG - Exonic
1165228205 19:34368855-34368877 AGGCCTCAGCAGAGACTCCAGGG - Intronic
1166947502 19:46405918-46405940 CGGCCTTGACAGAGACCCCAGGG - Intergenic
1168175323 19:54624237-54624259 CACCCCCCGCAGAGACCTCAGGG - Intronic
930092917 2:47544344-47544366 TGCCCTCGGCAGAGATGCCAGGG - Intronic
931470779 2:62536062-62536084 GGTCTTTGGCAGAGACCCCAGGG - Intergenic
931553872 2:63477947-63477969 CTCCCTGGGAAGAGACCACAGGG + Intronic
932481155 2:72040189-72040211 AGCCCTCAGCACAGCCCCCAAGG + Intergenic
935584588 2:104789172-104789194 CGCCCTGCACAGAGAGCCCAGGG - Intergenic
937397188 2:121547227-121547249 CTCCCTGGACAGAGACCACATGG + Intronic
938114727 2:128595374-128595396 AGCTCCAGGCAGAGACCCCATGG + Intergenic
938379236 2:130827334-130827356 CTCCCTCAGCTGAGCCCCCAGGG + Intergenic
944379613 2:199092686-199092708 GGCCCTGGGCAGTGAGCCCATGG + Intergenic
948469565 2:238168298-238168320 GGCCCTCGGCAGCGACCTCCAGG + Intronic
948550811 2:238772119-238772141 CCCCCTCGGCATAGCTCCCAGGG + Intergenic
948764526 2:240212583-240212605 AGCCAAGGGCAGAGACCCCACGG - Intergenic
1170603374 20:17858894-17858916 GGCCCTGGCCAGAGACCCCTTGG + Intergenic
1173159705 20:40643359-40643381 AACCCTCTCCAGAGACCCCAGGG + Intergenic
1175140509 20:56857475-56857497 CGTCCTCTGGAGAGACCCAAGGG + Intergenic
1175914311 20:62418671-62418693 TGCCGGAGGCAGAGACCCCAGGG - Intronic
1177150435 21:17450230-17450252 CTCCCTCAGCAGAGACACCACGG + Intergenic
1185067087 22:48637953-48637975 CTCCCTCTGCAGTGACCCCCGGG - Intronic
1185413641 22:50698321-50698343 AGCTCTCGGCAGTGACCCCTGGG + Intergenic
952816701 3:37452797-37452819 CGCTCTGGGCTGGGACCCCAGGG - Intronic
955330607 3:58044071-58044093 AGCCATAGGCAGAGACCTCAGGG + Intronic
960342924 3:116497264-116497286 CTCCCTGGACAGAGACTCCAGGG + Intronic
961737565 3:129011675-129011697 CCACCTCGACAGAGAGCCCACGG - Intronic
966000534 3:174943901-174943923 CTCCCTGGGCAGAGCCTCCAGGG - Intronic
969489276 4:7490085-7490107 GGCCCTGGGCTGACACCCCAGGG + Intronic
969599552 4:8167927-8167949 CACCCACGGCAGAGATTCCAGGG - Intergenic
978238343 4:106487416-106487438 CTCCCTAGACAGAGCCCCCAGGG - Intergenic
979013106 4:115396233-115396255 CTCCCTAGACAGAGCCCCCAGGG - Intergenic
981516207 4:145612817-145612839 CGCCCTGGGCAGCAAGCCCACGG - Intergenic
985345796 4:189002549-189002571 CGCCTTCGTCAGGGAGCCCAGGG + Intergenic
985441468 4:189984698-189984720 CGTCCCCGGCAGGGAGCCCAGGG + Intergenic
985647944 5:1093858-1093880 CACCCATGGCAGGGACCCCAGGG + Intronic
985903982 5:2818848-2818870 CCTCCTTGGCAGAGTCCCCAGGG - Intergenic
992947697 5:81825469-81825491 AGCCTACGGCAGAGGCCCCAGGG - Intergenic
993351270 5:86853272-86853294 CTCCCTGGACAGAGCCCCCAGGG - Intergenic
998152313 5:139764497-139764519 GGCGCTCGGCGGGGACCCCAGGG - Intergenic
999571643 5:152925897-152925919 AGCCCTCCACAGAGTCCCCATGG + Intergenic
1001599616 5:172920416-172920438 CAGCCTCACCAGAGACCCCACGG + Intronic
1003873505 6:10418976-10418998 CGGCCTCGCCCTAGACCCCAGGG - Intronic
1003948215 6:11094159-11094181 CCCCCTCGGCAGCGCCCCCAGGG - Exonic
1015902495 6:138082411-138082433 GGCCCACGTCTGAGACCCCATGG + Intergenic
1024630755 7:51244844-51244866 CTCTGTCTGCAGAGACCCCAGGG + Intronic
1026806806 7:73434012-73434034 CGCCCCCCGCAGAGGCGCCACGG - Exonic
1027190744 7:75994354-75994376 CCCCCTTGGCAGTGACGCCAGGG + Intronic
1032255965 7:130297413-130297435 GGCCCTCGGCAGTGCCCACAGGG + Intronic
1034055968 7:148035392-148035414 CGCCCTGGGCAGAGAAACCAAGG - Intronic
1034950732 7:155295747-155295769 GGCCCTCAGCAGGAACCCCACGG + Intergenic
1035094795 7:156345574-156345596 CGGCCCAGGCAGAGGCCCCAAGG - Intergenic
1036049374 8:5179095-5179117 GGCCCTGGGCAGTGAGCCCAGGG - Intergenic
1037787561 8:21911850-21911872 CACCCTGGGGAGAGCCCCCAGGG + Intronic
1040708458 8:50158408-50158430 AGCACTGGGCAGAGTCCCCAGGG + Intronic
1048327105 8:133448341-133448363 GGCCCTCGGCAGGGACTCCAGGG - Intergenic
1048327124 8:133448407-133448429 GACCCTCGGCAGGGACTCCAGGG - Intergenic
1048969531 8:139637267-139637289 CTTCCTTGGCAGAGACCGCAAGG + Intronic
1049102237 8:140588080-140588102 CGCTCTCTCCAGACACCCCATGG + Intronic
1049180228 8:141218439-141218461 CGCCCTCGGCGGCTACACCAGGG - Exonic
1049696018 8:143984721-143984743 TGCCTTCTCCAGAGACCCCATGG + Exonic
1052766996 9:32651164-32651186 CTCCCTGGGCAGAGCCCACAGGG + Intergenic
1053577155 9:39364499-39364521 CAGCCTCCACAGAGACCCCACGG + Intergenic
1053841657 9:42192424-42192446 CAGCCTCCACAGAGACCCCACGG + Intergenic
1054098726 9:60923189-60923211 CAGCCTCCACAGAGACCCCACGG + Intergenic
1054120126 9:61198818-61198840 CAGCCTCCACAGAGACCCCACGG + Intergenic
1057239969 9:93399672-93399694 AGCCCACAGCAGGGACCCCAAGG - Intergenic
1061183104 9:129036690-129036712 CGGCCCCGGCCGAGCCCCCAAGG + Intronic
1061582482 9:131546239-131546261 CGACCTGGGAAGAGACCCCACGG + Intergenic
1061726907 9:132587102-132587124 CGCCCGAGGCCGAGACCCCCCGG - Intronic
1062272016 9:135714134-135714156 CGGCCTCGGCAAAGACCCTGGGG + Intronic
1062740953 9:138175194-138175216 CGTCCCCGGCAGGGAGCCCAGGG - Intergenic
1185469967 X:376421-376443 CACACTCGACAGAGCCCCCATGG + Intronic
1186165654 X:6823675-6823697 CTCCATAGGCAGAGGCCCCAAGG + Intergenic
1188869700 X:35359079-35359101 CCCACTGGACAGAGACCCCAGGG - Intergenic
1191659538 X:63635680-63635702 AGCCCTGGGCAGAAGCCCCAAGG + Exonic
1196152653 X:112392184-112392206 CTCCCTGGACAGAGCCCCCAGGG - Intergenic
1196443901 X:115735595-115735617 GGCCTTCGGCAGGGACCCCTGGG + Intergenic
1197434976 X:126416189-126416211 CTCCAACGGCAGAGACCCCAGGG + Intergenic
1200073227 X:153539062-153539084 CTCCCTCCGCAGAAGCCCCACGG + Intronic
1200135806 X:153874028-153874050 GGCCCTCTGCAGTGTCCCCAGGG - Intronic
1201759159 Y:17518859-17518881 CGTCCCCGGCAGGGAGCCCAGGG + Intergenic
1201842396 Y:18387131-18387153 CGTCCCCGGCAGGGAGCCCAGGG - Intergenic