ID: 1128241998

View in Genome Browser
Species Human (GRCh38)
Location 15:66107584-66107606
Sequence CTCTTCACACACATGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 353}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128241993_1128241998 -4 Left 1128241993 15:66107565-66107587 CCAGAGCAGGGTTCCCAGACTCT 0: 1
1: 0
2: 0
3: 32
4: 272
Right 1128241998 15:66107584-66107606 CTCTTCACACACATGGGACATGG 0: 1
1: 0
2: 2
3: 15
4: 353
1128241992_1128241998 -3 Left 1128241992 15:66107564-66107586 CCCAGAGCAGGGTTCCCAGACTC 0: 1
1: 1
2: 1
3: 37
4: 314
Right 1128241998 15:66107584-66107606 CTCTTCACACACATGGGACATGG 0: 1
1: 0
2: 2
3: 15
4: 353
1128241990_1128241998 6 Left 1128241990 15:66107555-66107577 CCACAGAGCCCCAGAGCAGGGTT 0: 1
1: 0
2: 4
3: 48
4: 438
Right 1128241998 15:66107584-66107606 CTCTTCACACACATGGGACATGG 0: 1
1: 0
2: 2
3: 15
4: 353
1128241987_1128241998 8 Left 1128241987 15:66107553-66107575 CCCCACAGAGCCCCAGAGCAGGG 0: 1
1: 0
2: 6
3: 50
4: 443
Right 1128241998 15:66107584-66107606 CTCTTCACACACATGGGACATGG 0: 1
1: 0
2: 2
3: 15
4: 353
1128241989_1128241998 7 Left 1128241989 15:66107554-66107576 CCCACAGAGCCCCAGAGCAGGGT 0: 1
1: 0
2: 0
3: 37
4: 295
Right 1128241998 15:66107584-66107606 CTCTTCACACACATGGGACATGG 0: 1
1: 0
2: 2
3: 15
4: 353
1128241991_1128241998 -2 Left 1128241991 15:66107563-66107585 CCCCAGAGCAGGGTTCCCAGACT 0: 1
1: 0
2: 5
3: 34
4: 275
Right 1128241998 15:66107584-66107606 CTCTTCACACACATGGGACATGG 0: 1
1: 0
2: 2
3: 15
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128241998 Original CRISPR CTCTTCACACACATGGGACA TGG Intronic
900322539 1:2092263-2092285 CTCTTCACACAGAGGGGGCAGGG - Intronic
900841115 1:5049341-5049363 CTCTTCCCACACAAGGCAAATGG + Intergenic
901448142 1:9320402-9320424 ATCTGCACACACGTGGGGCAGGG - Intronic
902051201 1:13564912-13564934 CTCTTCCCACACAAGGCAAATGG + Intergenic
903317512 1:22520162-22520184 ATCTTCCCACACGTGGGGCAGGG - Exonic
905060164 1:35133325-35133347 CTCTTCCCACACAAGGCAAATGG - Intergenic
905237594 1:36560795-36560817 CTCTTGCCACACATGGGCTATGG - Intergenic
908749296 1:67404203-67404225 CTTTTCAAAGACCTGGGACAGGG + Intergenic
909729815 1:78877160-78877182 CTCTTCCCACACAAGGCAAATGG + Intergenic
911754774 1:101540807-101540829 CTCTTCAAATACATGTCACATGG - Intergenic
911984191 1:104600647-104600669 CTCTTCCCACACAAGGCAAATGG + Intergenic
912814989 1:112821830-112821852 CTCTTCCCACACAAGGCAAATGG - Intergenic
913095397 1:115511401-115511423 CTCTTCCCACACAAGGCAAATGG - Intergenic
913185242 1:116364755-116364777 CATTTCAGACACATGGGAAATGG + Intergenic
913245510 1:116866970-116866992 CTCTTCCCACACAAGGCAAATGG + Intergenic
915270061 1:154747376-154747398 CTCTTCCCACACCTAGGAGAGGG - Intronic
915955602 1:160217630-160217652 CTCCTCAGACACATCGGACGAGG - Exonic
916329124 1:163595051-163595073 CTCTTCCCACACAAGGCAAATGG + Intergenic
920425741 1:205873678-205873700 CTCTTCCCACACAAGGCAAATGG + Intergenic
920426989 1:205886314-205886336 CTCTTCCCACACAAGGCAAATGG - Intergenic
920908379 1:210191979-210192001 CTCTTCCCACACAAGGCAAATGG + Intergenic
921162677 1:212484207-212484229 CTGTTTACAAAGATGGGACAGGG - Intergenic
921205467 1:212845037-212845059 CTCTTCCCACACAAGGCAAATGG + Intronic
921881051 1:220254327-220254349 CGCTCCATACACCTGGGACATGG - Intronic
922845083 1:228678316-228678338 CTCTTCCCACACAAGGCAAATGG - Intergenic
922935143 1:229416864-229416886 CTCTTCCCACACAAGGCAAATGG + Intergenic
923213864 1:231831423-231831445 CTCTTCCCACACAAGGCAAATGG - Intronic
923466195 1:234249427-234249449 CTGTTCAGACCCATGGGATAAGG - Intronic
1064106622 10:12506001-12506023 ATCTTCACACATCTAGGACATGG - Intronic
1064771028 10:18722981-18723003 CTCCACACACAGGTGGGACAAGG + Intergenic
1065512033 10:26488917-26488939 GTGTACATACACATGGGACAAGG - Intronic
1066103080 10:32135040-32135062 CTCTTCCCACACAAGGCAAATGG - Intergenic
1066436819 10:35403351-35403373 CTCTTCCCACACAAGGCAAATGG - Intronic
1067374763 10:45717627-45717649 CCCTTCACTCACAGGAGACACGG - Intergenic
1067378967 10:45754922-45754944 CCCTTCACTCACAGGAGACACGG + Exonic
1067882576 10:50059265-50059287 CCCTTCACTCACAGGAGACACGG - Intergenic
1068361091 10:55975605-55975627 CTCTTCCCACACAAGGCAAATGG + Intergenic
1068638833 10:59378928-59378950 CTTTTCACACGCATGGTGCATGG - Intergenic
1068794387 10:61062338-61062360 CTCCTCACACACATGTGCAAAGG - Intergenic
1069837244 10:71317275-71317297 AGCTTCACAGACATGGGTCATGG + Intergenic
1069961207 10:72080553-72080575 CCCATCACACACCTGGGAGAGGG + Intronic
1071550473 10:86562626-86562648 CTCTTCCCACACAAGGCAAATGG - Intergenic
1071822071 10:89289159-89289181 CTCTTCCCACACAAGGCAAATGG + Intronic
1072011015 10:91302975-91302997 CTCTTCCCACACAAGGCAAATGG - Intergenic
1073395059 10:103210761-103210783 CTCTTCCCACACAAGGCAAATGG + Intergenic
1073436761 10:103521694-103521716 CTCTTCCCACACAAGGCAAATGG - Intronic
1073532420 10:104244774-104244796 GTCTTCACACACTTGGTACTTGG - Intronic
1075014262 10:118898710-118898732 CTCTTCCCACACAAGGCAAATGG + Intergenic
1078413957 11:11150062-11150084 CTGTTCTCACAGAGGGGACATGG + Intergenic
1078803676 11:14673775-14673797 CACTCCATACACCTGGGACATGG + Intronic
1079230876 11:18647745-18647767 CTCTTCCCACACAAGGCAAATGG + Intergenic
1079471999 11:20787181-20787203 GACTACACACACATGGAACAGGG - Intronic
1079573838 11:21978516-21978538 CTTTTCGCCCACATAGGACAGGG + Intergenic
1079847321 11:25488232-25488254 CTCTTCCCACACAAGGCAAATGG - Intergenic
1080203946 11:29707149-29707171 CTCTTCCCACACAAGGCAAATGG - Intergenic
1081160093 11:39739268-39739290 CTCTTCCCACACAAGGCAAATGG + Intergenic
1082755391 11:57070327-57070349 CACTTCACTCCCATGGGACTTGG + Intergenic
1083939135 11:65885811-65885833 CTCTTCGCACAGATGGGGAAGGG - Intronic
1085950003 11:81319014-81319036 CTCTTTACTCACATAGGAAATGG - Intergenic
1086134479 11:83432649-83432671 CTCTTCCCACACAAGGCAAATGG - Intergenic
1086135915 11:83443876-83443898 CTCTTCCCACACAAGGCAAATGG - Intergenic
1086550561 11:88047867-88047889 CTCTTCCCACACAAGGCAAATGG + Intergenic
1087197240 11:95314000-95314022 CTCTTCCCACACAAGGCAAATGG + Intergenic
1088255253 11:107897408-107897430 AACTTCAAACACATGGGATATGG + Intronic
1088608761 11:111556912-111556934 CTCTTCACAGTCATGGCTCATGG + Intronic
1089866715 11:121639143-121639165 CTCTTCCCACACAAGGCAAATGG - Intergenic
1089953700 11:122551820-122551842 CTCTTCCCACACAAGGCAAATGG + Intergenic
1091870977 12:3891044-3891066 CTCCTCACACACATGAGAAGAGG + Intergenic
1093617281 12:21241562-21241584 CTCTGGACCCACATGGGACCTGG + Intergenic
1094401029 12:30060680-30060702 CTCTTCCCACACAAGGCAAATGG + Intergenic
1095806403 12:46324952-46324974 CTCTTCCCACACAAGGCAAATGG - Intergenic
1096906934 12:54944623-54944645 CTCTTCCCACACAAGGAAAATGG - Intergenic
1098920274 12:76296317-76296339 CTCTTCCCACACAAGGCAAATGG + Intergenic
1100940663 12:99719968-99719990 CTCTTCCCACACAAGGCAAATGG + Intronic
1102074546 12:110049294-110049316 CTCTTCACACACATGAAACTGGG - Intronic
1102604873 12:114060700-114060722 CTCTTCCCACACAAGGCAAATGG + Intergenic
1103506610 12:121445377-121445399 CTCGCCACACACAAGGCACACGG + Exonic
1104227650 12:126851542-126851564 CTCTTCACAGAGATTGGGCATGG + Intergenic
1107083133 13:36396266-36396288 CTTTTCTCCCTCATGGGACAGGG - Intergenic
1108702948 13:52959161-52959183 CTCTTCCCACACAAGGCAAATGG - Intergenic
1109408415 13:61932409-61932431 CTCTTCACACTCATGGGACTAGG + Intergenic
1110978800 13:81870672-81870694 CTCTTCCCACACAAGGCAAATGG + Intergenic
1111688261 13:91527925-91527947 CTCTGCACAGCCTTGGGACATGG - Intronic
1112896269 13:104304131-104304153 CTCTTCCCACTCCTGGGACAGGG - Intergenic
1113433298 13:110268723-110268745 CTCTTAACACAACTGGGACAAGG + Intronic
1113566593 13:111323105-111323127 CTCTGCACCCACATGGGAAGAGG - Intronic
1113723105 13:112575824-112575846 GTCAACACACACATGGGCCAAGG + Intronic
1114417816 14:22556102-22556124 GTCTTCCCACACATGGCTCACGG - Intergenic
1115137709 14:30130972-30130994 TTCCTGACACACATGGCACAAGG + Intronic
1119559950 14:75581976-75581998 CTCTTCCCACACAAGGCAAACGG - Intronic
1120187644 14:81411066-81411088 CTTTTCAGAGACATGGGGCAAGG + Intronic
1120305668 14:82766376-82766398 CTAACCACACACATAGGACATGG - Intergenic
1120539236 14:85734182-85734204 CTCTTCCCACACAAGGCAAATGG - Intergenic
1121014318 14:90539150-90539172 CTCTCCACCCACATGGCTCAAGG - Exonic
1121192930 14:92045783-92045805 CTCTTCTCACACAAGGCAAATGG - Exonic
1121389648 14:93563134-93563156 CTCTTCCCACACAAGGCAAATGG - Intronic
1121980281 14:98448493-98448515 CTCTTCCCACACAAGGCAAATGG - Intergenic
1122381009 14:101307017-101307039 CTCTTCCCACACAAGGCAAATGG - Intergenic
1123882220 15:24687099-24687121 CTCTTCCCACACAAGGCAAACGG - Intergenic
1125566153 15:40679998-40680020 CTCTGGACACACTTGGGACCTGG - Intergenic
1126919332 15:53503373-53503395 CTCTTCACAGAGATGGAACATGG - Intergenic
1127601531 15:60542655-60542677 CACCTCACACACATGGCACACGG + Intronic
1128241998 15:66107584-66107606 CTCTTCACACACATGGGACATGG + Intronic
1129259741 15:74358327-74358349 CTCTTCCCACACAAGGCAAATGG + Intronic
1129864445 15:78894186-78894208 CGCTCCATACACCTGGGACATGG - Exonic
1130304870 15:82706654-82706676 CTCTTCCCACACAAGGCAAATGG + Intronic
1130695586 15:86128203-86128225 GTCTTCACACTCATGGCAGAAGG + Intergenic
1132897115 16:2234353-2234375 CGCTTGCCACACTTGGGACAAGG - Exonic
1133397375 16:5459015-5459037 CTCTTCAGAGATATGGGATATGG - Intergenic
1133915374 16:10104842-10104864 CTCTGCGCTCACAAGGGACATGG - Intronic
1133939077 16:10293501-10293523 CTCTTCCCACACAAGGCAAATGG + Intergenic
1134364866 16:13568016-13568038 CTTTTCAAAGACATGGGAAAGGG - Intergenic
1135025087 16:18993438-18993460 CTCTTCCCACACAAGGCAAATGG - Intronic
1135893231 16:26375558-26375580 TTCTTCACACACCTGTGAAATGG - Intergenic
1136530294 16:30863693-30863715 CTCTTCCCACACAAGGTAAACGG + Intronic
1137821937 16:51454397-51454419 CTCTCTAAACACATGGGACTTGG + Intergenic
1137896320 16:52216634-52216656 CTCTTCCCACACAAGGCAAATGG - Intergenic
1138597756 16:58038255-58038277 CGCTTCATCCACCTGGGACATGG - Exonic
1138758756 16:59518731-59518753 CTCTTCCCACACAAGGCAAATGG - Intergenic
1138820921 16:60258277-60258299 GTCTTCACAAAAATGGTACAAGG + Intergenic
1141009062 16:80380382-80380404 ATCTTCACACACAGAGGACAGGG + Intergenic
1141062233 16:80884052-80884074 CACATCACAAACATGGGAAAGGG + Intergenic
1141907544 16:87037360-87037382 CTCTACACCCACAAAGGACAGGG + Intergenic
1144792292 17:17867198-17867220 CTCCTCACACACCTGGGCCCTGG + Intronic
1144795737 17:17889848-17889870 CTCTTCAGAGAAGTGGGACAGGG - Intronic
1146757496 17:35446373-35446395 CTCTTCAGACACCTGGGAAATGG + Intronic
1148780873 17:50121109-50121131 CTCCTCACACCCATGGAACCTGG + Intronic
1151520428 17:74625058-74625080 CTCATGTCACACATGGGACCAGG - Intergenic
1151587376 17:75018094-75018116 CTCTACACTCACGTGGCACACGG - Intronic
1154384000 18:13877207-13877229 CTCTTCATACCCAAGAGACAAGG + Intergenic
1155892435 18:31285948-31285970 CTCTTCCCACACAAGGCAAATGG - Intergenic
1155941874 18:31808293-31808315 CTCTTCCCACACAAGGCAAATGG + Intergenic
1156710493 18:39938450-39938472 TTCTTCACATTGATGGGACAGGG + Intergenic
1156916156 18:42466107-42466129 CTCTTCCCACACAAGGCAAATGG + Intergenic
1156923791 18:42554129-42554151 CTCTTCCCACACAAGGCAAATGG - Intergenic
1157401718 18:47394213-47394235 CACTCCACACACCTGGGACAGGG - Intergenic
1159778822 18:72637522-72637544 CTGTTCATTCACATGTGACATGG - Intronic
1159950032 18:74476205-74476227 CTCATCACACACATAAAACAAGG + Intergenic
1163725439 19:18920783-18920805 CTCATCTCACACGTGGGAAAAGG - Intronic
1163899829 19:20091462-20091484 CTCTTCCCACACAAGGCAAATGG - Intronic
1164153301 19:22572732-22572754 CTCTTCCCACACAAGGCAAATGG + Intergenic
1164202155 19:23027862-23027884 CTCTTCCCACACAAGGCAAATGG - Intergenic
1166727016 19:45034552-45034574 CTCTGCCCACCCAGGGGACAGGG - Intronic
1166993691 19:46708649-46708671 CTGTGCGCTCACATGGGACACGG - Intronic
1167055350 19:47107541-47107563 CTATTCACACAGATGCGAAATGG + Intronic
1168211792 19:54896050-54896072 CTCTTCCCACACAAGGCAAATGG - Intergenic
925433508 2:3817038-3817060 CTCTTCCCACACAAGGCAAATGG - Intronic
927708763 2:25312659-25312681 CTCTTGAAACAAATGGGGCAGGG - Intronic
927880554 2:26687288-26687310 CCCTTCCCACACTTGGGGCAGGG - Intergenic
928738338 2:34319225-34319247 CCTCTCACACACATGGCACATGG - Intergenic
929684158 2:44020053-44020075 CTCTTCCCACACAAGGCAAATGG - Intergenic
930098669 2:47586489-47586511 CTCTTCTCACACAAGGCAAATGG - Intergenic
933179464 2:79213073-79213095 CTCTTCCCACACAAGGCAAATGG - Intronic
933795357 2:85915131-85915153 CTCTTGAAGCACATGTGACATGG + Intergenic
935114777 2:100125939-100125961 CTGTGCACACACTTGGGACCAGG + Intronic
935661715 2:105472335-105472357 CCATTCAATCACATGGGACAGGG + Intergenic
935832317 2:107012905-107012927 ATCAGCACACACATAGGACAAGG + Intergenic
937305232 2:120866900-120866922 CTCCTCACACACAGGGGTCATGG - Intronic
938243339 2:129759435-129759457 GTGTGCACACCCATGGGACATGG - Intergenic
939307730 2:140430630-140430652 CTCTTCCCACACAAGGCAAATGG + Intronic
939460437 2:142491148-142491170 CTCTTCCCACACAAGGCAAATGG - Intergenic
939727159 2:145735661-145735683 ATCTTCACAGGTATGGGACAAGG - Intergenic
940508497 2:154584686-154584708 CTCTTCCCACACAAGGCAAATGG - Intergenic
941455811 2:165711340-165711362 CTCTTCCCACACAAGGCAAATGG - Intergenic
941750937 2:169135023-169135045 CTCTTCCCACACAAGGCAAATGG + Intronic
943412605 2:187561703-187561725 CTCTTCCCACACAAGGCAAATGG - Intronic
943460868 2:188170437-188170459 CTCTTCCCACACAAGGCAAATGG - Intergenic
944067327 2:195633037-195633059 CTTTTCACACAGAGGGGAAATGG + Intronic
944251413 2:197582978-197583000 CTCTTCCCACACAAGGCAAATGG + Intronic
944387778 2:199183865-199183887 CTCTTCTCACACAAGGCAAATGG + Intergenic
944395034 2:199257252-199257274 CTCTTAAAGCACAGGGGACAGGG - Intergenic
945376432 2:209082565-209082587 CTCTTCCCACACAAGGCAAATGG + Intergenic
945933897 2:215883688-215883710 AGCTTCAGACACCTGGGACACGG + Intergenic
946155422 2:217803780-217803802 GTCTACAAACACATGGGACAAGG + Exonic
947588621 2:231371799-231371821 CCCTTCACACACAGAGGAGAGGG + Intronic
947842464 2:233216867-233216889 CTCTTCCCACACAAGGCAAATGG - Intronic
948802172 2:240437903-240437925 CTCTTCTCACCCTTGGGAGATGG - Intronic
1168839469 20:899994-900016 CTCTTCCCACACAAGGCAAATGG + Intronic
1169046380 20:2537303-2537325 CTCTCCACACACAGGTGAGATGG + Exonic
1170013786 20:11757603-11757625 CTCCACATCCACATGGGACAAGG - Intergenic
1170321147 20:15099395-15099417 CTCTCCACACACCTGCAACAAGG + Intronic
1171384573 20:24761593-24761615 CTCTTCACAAAGAGGGGCCAAGG - Intergenic
1173583142 20:44161402-44161424 CTCTCCACACACATAAGACTTGG - Intronic
1173929855 20:46809534-46809556 CTCTGCACCCACAGGTGACAAGG + Intergenic
1174633435 20:51978351-51978373 CTCTTACCACACATGTGTCAGGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176685973 21:9848897-9848919 CTCTTCCCACACAAGGCAAATGG + Intergenic
1177119901 21:17125985-17126007 CTCTTCCCACACAAGGCAAATGG + Intergenic
1179014897 21:37587960-37587982 CTCTTCCCACACAAGGCAAATGG - Intergenic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1183075887 22:35426475-35426497 CTCTTCACTCACCTGTGACCTGG + Intergenic
1183635271 22:39058318-39058340 CTCTTCCCACACAAGGCAAATGG - Intronic
1184178502 22:42803644-42803666 GTGGTCACACCCATGGGACAGGG - Intronic
950145643 3:10647860-10647882 CTCTTCTCTCACAGGGGAAAGGG + Intronic
950602825 3:14049962-14049984 TTCCTCACACAGATGTGACAAGG + Intronic
951762432 3:26161406-26161428 CTCTTCCCACACAAGGCAAATGG - Intergenic
952895196 3:38074037-38074059 GTCCTTACACAGATGGGACATGG + Intronic
953834108 3:46328335-46328357 CTCTTCCCACACAAGGCAAATGG - Intergenic
955482953 3:59407750-59407772 CTCTTCAGACAGATAGGACCTGG - Intergenic
957451774 3:80389356-80389378 CTCTTCCCACACAAGGCAAATGG + Intergenic
957455629 3:80439721-80439743 CTCTCCAAACACAGGGGACATGG + Intergenic
957675001 3:83354843-83354865 CTCTTCCCACACAAGGCAAATGG - Intergenic
957734568 3:84189174-84189196 CTCTTCCCACACAAGGCAAATGG - Intergenic
957904475 3:86539223-86539245 CTCTTCCCACACAAGGCAAATGG - Intergenic
958422320 3:93942618-93942640 CTCTTCCCACACAAGGCAAATGG + Intronic
958676471 3:97274198-97274220 CTCTTCCCACACAAGGCAAATGG - Intronic
958751357 3:98195842-98195864 CTCTTCCCACACAAGGCAAATGG + Intronic
959902936 3:111680169-111680191 CTCTTCCCACATGTGTGACATGG + Intronic
959915337 3:111810503-111810525 CTCTTCACATACATGCACCAAGG - Intronic
961712390 3:128837564-128837586 CTCTTCCCACACAAGGCAAATGG - Intergenic
963887780 3:150600998-150601020 CTCTTCCCACACAAGGCAAATGG + Intronic
964299904 3:155276187-155276209 CTCTTCCCACACAAGGCAAATGG - Intergenic
964956678 3:162367480-162367502 GTCAGCACACACATGGTACAGGG + Intergenic
965070667 3:163912219-163912241 CTCTTCCCACACAAGGCAAATGG + Intergenic
965184056 3:165440021-165440043 CTCTTTACAAACACAGGACAAGG - Intergenic
965804655 3:172529576-172529598 CTCTTCACCCATGTGGGACTTGG + Intergenic
965861637 3:173156986-173157008 CTCTTCCCACACAAGGCAAATGG - Intergenic
966279658 3:178212214-178212236 CTCTTCTCACACAAGGCAAATGG + Intergenic
966945341 3:184773733-184773755 CTCTTCAGGCATATGGAACAGGG + Intergenic
967887100 3:194340949-194340971 CTTTTCACATGCAAGGGACAGGG - Exonic
969110571 4:4841594-4841616 CTCTGGACACACCTGGGAAAGGG + Intergenic
970011064 4:11459755-11459777 CTCTTGACCCACTTGGGACCTGG + Intergenic
970200360 4:13598703-13598725 CTCTCCCCACACATGAGAAATGG + Intronic
970256093 4:14171741-14171763 CTCTTCCCACACAAGGCAAATGG - Intergenic
970533058 4:17002156-17002178 CTCTTCCCACACAAGGCAAATGG + Intergenic
970565071 4:17323931-17323953 ATCTTCCCACACCAGGGACAGGG - Intergenic
970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG + Intergenic
970853738 4:20631515-20631537 CTCTTCCCACACAAGGCAAATGG - Intergenic
971702774 4:30000843-30000865 CTCTTGACACACCTGGACCAAGG + Intergenic
972113871 4:35603032-35603054 CACTTCACACACATTTGTCATGG + Intergenic
972319919 4:37964182-37964204 CTCTGCACACACATGGGCCAGGG + Intronic
973110943 4:46397222-46397244 ATATTCACACTCATGGGAAAAGG - Intronic
974904151 4:68035462-68035484 CTCTTCCCACACAAGGCAAATGG + Intergenic
975272188 4:72449188-72449210 CTCTTTACAACCATGGGACTCGG - Intronic
976588050 4:86820657-86820679 ATGTTCAGGCACATGGGACATGG - Intergenic
977225021 4:94384688-94384710 CTCTTCCCACACAAGGCAAATGG - Intergenic
977970036 4:103202249-103202271 CTTTGTACACACAGGGGACAAGG - Intergenic
979146637 4:117254433-117254455 GGCTCCACACAGATGGGACATGG - Intergenic
979347601 4:119606871-119606893 GTCTTCACAGACAAGGAACAGGG + Exonic
980349431 4:131667371-131667393 CTCTTCCCACACAAGGCAAATGG + Intergenic
980844961 4:138313164-138313186 CTCTTCTCACTCATGGTAAAAGG - Intergenic
980928199 4:139159428-139159450 CTCTTCCCACACAAGGCAAATGG - Intronic
981207988 4:142066947-142066969 CTCTTCAAACCCATCAGACAAGG - Intronic
983948777 4:173616128-173616150 CACTCCATACACCTGGGACATGG + Intergenic
984437618 4:179725128-179725150 CTCTTCCCACACAAGGCAAATGG + Intergenic
985471228 5:48123-48145 CTCTTCATACACAACGTACAAGG - Intergenic
986440620 5:7778359-7778381 TTCTAGAGACACATGGGACATGG + Intronic
988199456 5:28050347-28050369 CTCTTCCCACACAAGGCAAAAGG + Intergenic
989660214 5:43790270-43790292 CTCTTCCCACACAAGGCAAATGG + Intergenic
991778602 5:70110407-70110429 CTCTCCACAGAAATGGCACAGGG - Intergenic
991857892 5:70985874-70985896 CTCTCCACAGAAATGGCACAGGG - Exonic
991871049 5:71110760-71110782 CTCTCCACAGAAATGGCACAGGG - Intergenic
992451683 5:76881690-76881712 CTCTTCCCACACAAGGCAAATGG - Intronic
993629351 5:90265963-90265985 CACACCACACACATGTGACATGG - Intergenic
994125776 5:96168107-96168129 CTCTTCTCACACAAGGCAAATGG - Intergenic
994325267 5:98439417-98439439 CTCTTCCCACACAAGGCAAATGG + Intergenic
994375444 5:99012589-99012611 CTCTTCCCACACAAGGCAAATGG - Intergenic
995086121 5:108111905-108111927 CTGTTGACACACATTGAACAAGG + Intronic
995181227 5:109232229-109232251 GTCTTCACACTCATGCCACATGG - Intergenic
996917985 5:128733819-128733841 CTCTTCCCACACAAGGCAAATGG + Intronic
996989925 5:129616645-129616667 CTCTTCACTAACATTGTACATGG - Intronic
997456995 5:134025031-134025053 CTCATCCCACGCCTGGGACAGGG - Intergenic
997719480 5:136066095-136066117 CCTTTCCCACACAGGGGACAGGG + Intergenic
999079524 5:148829733-148829755 CTCTTCACAAACAGGAGTCATGG - Intergenic
999786604 5:154896238-154896260 CTCTTACCACACTTGGAACACGG - Exonic
999886803 5:155933257-155933279 CTATGCAAACACGTGGGACAGGG - Intronic
999965125 5:156801127-156801149 GTCTTCACAAATATGGAACAAGG - Intergenic
1001353919 5:171002235-171002257 CTCTTCCCACACAAGGCAAATGG - Intronic
1001688014 5:173610105-173610127 ATATTCAAACACTTGGGACAGGG + Intronic
1003100386 6:3172099-3172121 CTCTTCCCACACAAGGCAAATGG + Intergenic
1006325155 6:33348141-33348163 CTCTTCCCACACAAGGCAAATGG + Intergenic
1007300600 6:40865115-40865137 CTCTTCCCACACAAGGCAAATGG - Intergenic
1007462015 6:42025850-42025872 TTTTTCACACACACGGAACATGG + Intronic
1008132310 6:47732993-47733015 CTCTCCACACACCTGAGAAAAGG - Intergenic
1009270121 6:61604443-61604465 CTCTTCCCACACAAGGCAAATGG + Intergenic
1010586366 6:77661771-77661793 CTCTTCCCACACAAGGCAAATGG - Intergenic
1010829382 6:80511533-80511555 CTCTTCCCACACAAGGCAAATGG - Intergenic
1010841025 6:80649284-80649306 CTCTTCCCACACAAGGCAAATGG - Intergenic
1012675419 6:102106442-102106464 CTCTTCCCACACAAGGCAAATGG + Intergenic
1013043342 6:106458781-106458803 CTCCTCCCGCACATGGGACGTGG + Intergenic
1013807721 6:114013335-114013357 CTCTTCCCACACAAGGCAAATGG - Intergenic
1014612350 6:123560730-123560752 CTCTTCCCACACAAGGCAAATGG + Intronic
1015107672 6:129555990-129556012 GTCTTCACACACAGGTGAAATGG - Intergenic
1015217469 6:130766920-130766942 CTCTCCACACAAATGGGGCTGGG + Intergenic
1015801037 6:137062354-137062376 CTCTTCCCACACAAGGCAAATGG - Intergenic
1016725626 6:147362890-147362912 TTGTTCACACACTTTGGACAAGG + Intronic
1018700051 6:166419304-166419326 CTCTTCTCACTCAGGGGAGAGGG + Intronic
1018710541 6:166495500-166495522 TTCTTCACACTCCAGGGACAGGG + Intronic
1019540823 7:1550256-1550278 CACCCCACACACCTGGGACAGGG - Intronic
1019697182 7:2452398-2452420 CTCTTCACAGCCCTGGGACTGGG - Intergenic
1020546590 7:9540835-9540857 CTCTATACAGCCATGGGACATGG + Intergenic
1021660915 7:22917214-22917236 CTCTTCCCACACAAGGCAAATGG + Intergenic
1022574910 7:31488112-31488134 CTCTTCCCACAGCTGGGACTAGG + Intergenic
1026965439 7:74436325-74436347 CTCTGCTCACACATGGCAGAAGG + Intergenic
1028491680 7:91419327-91419349 CTTTTTACAAACATAGGACAAGG - Intergenic
1028589513 7:92480625-92480647 CTCTTCTCACACAAGGCAAATGG - Intergenic
1030163251 7:106529452-106529474 CTCTTCCCACACAAGGCAAATGG - Intergenic
1030674923 7:112374600-112374622 CTCTTCTTACACATTGGCCAAGG + Intergenic
1031777699 7:125922338-125922360 CTCTTCCCACACAAGGCAAATGG + Intergenic
1033085023 7:138333358-138333380 CTCTTCCCACACAAGGCAAATGG + Intergenic
1033211873 7:139465914-139465936 CTCTTCCCACACAAGGCAAATGG + Intronic
1033464684 7:141579833-141579855 CTCTTCCCACACAAGGCAAATGG - Intronic
1034561702 7:151884353-151884375 CTTTTGACCCACATGGCACAGGG - Intergenic
1035042114 7:155936483-155936505 ATCTTTTCAGACATGGGACAAGG - Intergenic
1035302685 7:157907556-157907578 CACCTCACACACAGGAGACAGGG - Intronic
1035706031 8:1675581-1675603 CTCTTGCCTCACAGGGGACAGGG + Intronic
1036472016 8:9060659-9060681 CTCTTCCCACACAAGGCAAATGG - Intronic
1038993282 8:32893206-32893228 CTCTGCACAAACATGGCACTTGG - Intergenic
1040025205 8:42775424-42775446 CTCACCACACTCCTGGGACATGG - Intronic
1040648359 8:49424230-49424252 CTCTTCCCACACAAGGCAAATGG + Intergenic
1041917168 8:63149348-63149370 CTCTTCCCACACAAGGCAAATGG - Intergenic
1043597133 8:81899782-81899804 CTCTTCCCACACAAGGCAAATGG - Intergenic
1043599216 8:81918153-81918175 CTCTTCCCACACAAGGCAAATGG + Intergenic
1043717587 8:83506437-83506459 CTCTTCCCACACAAGGCAAATGG - Intergenic
1045533138 8:103003115-103003137 CTCTTCCCACACAAGGCAAATGG + Intergenic
1046960162 8:120103104-120103126 CTCTGAACACTCTTGGGACAAGG - Intronic
1047632455 8:126723064-126723086 ATGTTCATACACATGGGTCATGG - Intergenic
1049439236 8:142601622-142601644 CTCTCCACACTCAGGGGACCTGG - Intergenic
1049939720 9:533866-533888 CTTTTCACAAACATGGAAAAGGG - Intronic
1051452888 9:17216779-17216801 GGCTTAATACACATGGGACAGGG - Intronic
1051994057 9:23192563-23192585 CTCTCCAAGCACATGGGATATGG - Intergenic
1052163428 9:25292381-25292403 CTCTTCCCACACAAGGCAAATGG + Intergenic
1052653668 9:31330883-31330905 CTCTTCCCACACAAGGCAAATGG + Intergenic
1053059655 9:35021024-35021046 CTCTTCCCACACAAGGCAAATGG - Intergenic
1053783340 9:41632701-41632723 CTCTTCCCACACAAGGCAAATGG - Intergenic
1054171293 9:61842843-61842865 CTCTTCCCACACAAGGCAAATGG - Intergenic
1054666241 9:67737969-67737991 CTCTTCCCACACAAGGCAAATGG + Intergenic
1055882046 9:81013511-81013533 CTCTTCCCACACAAGGCAAATGG + Intergenic
1056324215 9:85463139-85463161 CTCTTCCCACACAAGGCAAATGG + Intergenic
1056363368 9:85880666-85880688 CTCTTCCCACACAAGGCAAATGG - Intergenic
1056667090 9:88589641-88589663 CTGTGCACACACAGGGTACAGGG + Intergenic
1057299427 9:93869258-93869280 CACTTCGCACAGAGGGGACAAGG + Intergenic
1058697416 9:107571345-107571367 CCATTCACAGACATGGGAGAAGG - Intergenic
1058779990 9:108323963-108323985 CTCTTCACACTCATTGAAGATGG + Intergenic
1060678608 9:125540622-125540644 CTGTTCCCAGACATGGGGCATGG + Intronic
1060862744 9:126968640-126968662 CTCTTCACACAGATAGTACATGG + Intronic
1060888465 9:127173006-127173028 CCCCTCACACACATGGGAGGAGG - Intronic
1061923880 9:133796674-133796696 CTCTGCACACACCTGGTGCATGG - Intronic
1188332681 X:28893850-28893872 CTCTTCCCACACAAGGCAAATGG - Intronic
1188829577 X:34880155-34880177 GTCTTCATACAAATGGGTCATGG + Intergenic
1188895693 X:35665711-35665733 ATCTTCACAGGTATGGGACAAGG + Intergenic
1189657928 X:43266824-43266846 CTCTGGACCCACCTGGGACATGG - Intergenic
1189755896 X:44271013-44271035 AGGTTCACACACTTGGGACAGGG - Intronic
1189849477 X:45164583-45164605 AACATCACACACATGGGCCAGGG + Intronic
1191108617 X:56788247-56788269 CTCTTTATTCACATGGGAGAAGG + Intergenic
1191140896 X:57115625-57115647 CTGTTCACATCCATGTGACAAGG - Intergenic
1191761666 X:64653831-64653853 CTCTTCCCACACAAGGCAAATGG + Intergenic
1191825928 X:65364585-65364607 CTCTTCACACACAAGGCAAATGG + Intergenic
1192706491 X:73532236-73532258 CTCTTCCCACAGAAGGGAAATGG + Intergenic
1192993534 X:76488061-76488083 CTCTTCAAAACCATGAGACAGGG + Intergenic
1193897865 X:87135478-87135500 CTCTTCACACTCTTGACACATGG + Intergenic
1194141757 X:90217758-90217780 CTCTCCAGAGACATGGGAAAGGG + Intergenic
1194661039 X:96628732-96628754 CTCTTCCCACACAAGGCAAATGG + Intergenic
1194873446 X:99160463-99160485 CTCTTCCCACACAAGGCAAATGG - Intergenic
1195016741 X:100788492-100788514 CTCTTCCCACACAAGGCAAATGG - Intergenic
1195290837 X:103430791-103430813 CTCTTCCCACACAAGGCAAATGG - Intergenic
1195326547 X:103763090-103763112 CTCTTCCCACACAAGGCAAATGG - Intergenic
1196154106 X:112407548-112407570 CTCTTGACACACCTGGGGCCTGG + Intergenic
1196497145 X:116335065-116335087 CTCTTCCCACACAAGGCAAATGG + Intergenic
1197459992 X:126729383-126729405 CTCTTCTTACACATTGGCCAAGG + Intergenic
1197500066 X:127231274-127231296 CTCTTCCCACACAAGGCAAATGG + Intergenic
1198019380 X:132643390-132643412 CAGTTTCCACACATGGGACATGG - Intronic
1198330740 X:135620031-135620053 GTCTTTACAAACATGGGACATGG + Intergenic
1198336184 X:135668962-135668984 GTCTTTACAAACATGGGACGTGG - Intergenic
1198515137 X:137399831-137399853 CTCTGGACACACCTGGGGCATGG - Intergenic
1198966282 X:142231259-142231281 CTCTTCCCACACAAGGCAAATGG + Intergenic
1199073461 X:143504301-143504323 CTCTTCCCACACAAGGCAAATGG - Intergenic
1199518931 X:148713059-148713081 CTCTTCCCACACATAGTCCATGG - Intronic
1200813248 Y:7505745-7505767 CTCTTCCCACACAAGGCAAATGG + Intergenic
1201061380 Y:10049695-10049717 CTCTTCCCACACAAGGCAAATGG - Intergenic
1202076161 Y:21039870-21039892 CTCTTCTCACACAAGGCAAATGG - Intergenic