ID: 1128242382

View in Genome Browser
Species Human (GRCh38)
Location 15:66109802-66109824
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128242382_1128242386 22 Left 1128242382 15:66109802-66109824 CCTCTCCCTAAGAGGTCTCTCAG 0: 1
1: 0
2: 1
3: 12
4: 151
Right 1128242386 15:66109847-66109869 CACTCACTCACTAAATTCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128242382 Original CRISPR CTGAGAGACCTCTTAGGGAG AGG (reversed) Intronic