ID: 1128242879

View in Genome Browser
Species Human (GRCh38)
Location 15:66113396-66113418
Sequence GATTTCACCTGGAAGCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128242875_1128242879 -5 Left 1128242875 15:66113378-66113400 CCACTGAAAGGGCCAGAAGATTT 0: 1
1: 0
2: 0
3: 14
4: 174
Right 1128242879 15:66113396-66113418 GATTTCACCTGGAAGCTTGAGGG 0: 1
1: 0
2: 0
3: 17
4: 179
1128242874_1128242879 -2 Left 1128242874 15:66113375-66113397 CCACCACTGAAAGGGCCAGAAGA 0: 1
1: 0
2: 0
3: 25
4: 149
Right 1128242879 15:66113396-66113418 GATTTCACCTGGAAGCTTGAGGG 0: 1
1: 0
2: 0
3: 17
4: 179
1128242870_1128242879 14 Left 1128242870 15:66113359-66113381 CCTCTGGCATTCCAAGCCACCAC 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1128242879 15:66113396-66113418 GATTTCACCTGGAAGCTTGAGGG 0: 1
1: 0
2: 0
3: 17
4: 179
1128242873_1128242879 3 Left 1128242873 15:66113370-66113392 CCAAGCCACCACTGAAAGGGCCA 0: 1
1: 0
2: 1
3: 13
4: 197
Right 1128242879 15:66113396-66113418 GATTTCACCTGGAAGCTTGAGGG 0: 1
1: 0
2: 0
3: 17
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128242879 Original CRISPR GATTTCACCTGGAAGCTTGA GGG Intronic
902608060 1:17580246-17580268 GATTTCACCTGTAAGCCAGAGGG + Intronic
903528841 1:24013971-24013993 GATTCCACCTGGAGTCTCGAGGG + Intergenic
908859026 1:68462427-68462449 AATTTCACCTGGAATCTGAAGGG - Intergenic
910723729 1:90315509-90315531 GATTTCAACAGGAATTTTGAGGG + Intergenic
916753167 1:167741948-167741970 GCTTGCACCTGGGAGGTTGAGGG + Intronic
916952695 1:169796729-169796751 TAGATCACCTGGAACCTTGAAGG - Intronic
917436514 1:175027445-175027467 GCTTGCACCTGGGAGGTTGAGGG - Intergenic
917917109 1:179713145-179713167 AAATTCACATGGAAACTTGAGGG + Intergenic
918875883 1:190042831-190042853 GATATCACTTAGAGGCTTGATGG + Intergenic
920789579 1:209076929-209076951 GCTTCCTCCTGGAGGCTTGAGGG - Intergenic
923072126 1:230575437-230575459 CATGTCACCTGGAAGCTCGCTGG + Intergenic
923485651 1:234428396-234428418 CATTTCACCCGGATACTTGAAGG - Intronic
1064131247 10:12712151-12712173 AACTTCACCAAGAAGCTTGAGGG + Intronic
1065973978 10:30826730-30826752 GATTGCAACTGGAAGCTGGTAGG + Intronic
1069047819 10:63761718-63761740 AAATTCAATTGGAAGCTTGAGGG - Intergenic
1070347213 10:75556415-75556437 TATTTCACCTTTATGCTTGAAGG - Intronic
1072570919 10:96656827-96656849 GACTTCACCTGGGAACCTGATGG - Exonic
1072843265 10:98798235-98798257 TATTTCTCCTGCATGCTTGAAGG - Intronic
1073051999 10:100673227-100673249 CATTTGAGCTGGAGGCTTGAAGG + Intergenic
1074569976 10:114615393-114615415 GAGGTGACCTAGAAGCTTGAGGG - Intronic
1074961407 10:118449160-118449182 GATTTAATCTGGAATCTTCATGG - Intergenic
1076537907 10:131194638-131194660 GATTTCCTCTGGAAGTTTTATGG + Intronic
1077291186 11:1794931-1794953 GATCACACCTGGAAGTTTGAAGG + Intergenic
1081832834 11:46128672-46128694 GATTTCACTTGGAAGACAGAAGG - Intergenic
1082221471 11:49643557-49643579 GGCATCACCTGGGAGCTTGAGGG - Intergenic
1083001868 11:59299577-59299599 GATGTCATTTGGAAGCCTGAAGG - Intergenic
1083439065 11:62664158-62664180 GATTTCACTTGTAAGTTTCAAGG - Intronic
1084316646 11:68349606-68349628 GAGTTCACCTGGGCCCTTGAAGG + Intronic
1086627569 11:88975595-88975617 GGCATCACCTGGGAGCTTGATGG + Intronic
1088337155 11:108718444-108718466 GGTTTCAACTGCAAGTTTGAAGG - Intronic
1089154092 11:116387249-116387271 CAGATCACCTGGAAGCTTGTTGG + Intergenic
1090027869 11:123183180-123183202 GGTTTCACCAGGGAGCTTGTTGG - Intronic
1090394774 11:126411597-126411619 GTTCTCATCTGGAAGCTTGGGGG + Intronic
1092671677 12:10868545-10868567 CATTCAACCTGGAAGCCTGAGGG + Intronic
1093516347 12:19990962-19990984 CATTTCTTCTGGAGGCTTGAGGG - Intergenic
1093976718 12:25431060-25431082 GATGTTACCTGGAAGCAAGAAGG - Intronic
1094273244 12:28640607-28640629 AATTTCACCTGGGAGCTTGTAGG - Intergenic
1097221394 12:57453257-57453279 AATTTCTCCAAGAAGCTTGATGG - Intronic
1097922023 12:65086290-65086312 CACTTGTCCTGGAAGCTTGAGGG - Intronic
1099081822 12:78193249-78193271 TATTCCAGCTGGCAGCTTGAGGG - Intronic
1100055460 12:90503565-90503587 GAGCTCACCTGGAAGCTACAGGG + Intergenic
1100066790 12:90657095-90657117 CATATCACCTGGAAGCTTTATGG + Intergenic
1101504606 12:105334382-105334404 AATATCTCCTGGAAACTTGAAGG - Intronic
1101812145 12:108116592-108116614 GGCTTCACCTGGGAGCTTGTTGG - Intergenic
1104067843 12:125319931-125319953 GCTTGCACCTGGGAGGTTGAGGG + Intronic
1104946696 12:132417821-132417843 GCTTTCACCTGCAAGCAGGAAGG - Intergenic
1104992894 12:132636160-132636182 CATTTCCCCAGGAAGCCTGAGGG - Intronic
1106062256 13:26305194-26305216 TATTTCACCTTTAATCTTGAAGG + Intronic
1106644994 13:31624095-31624117 TATTTCACCTGGATGCAGGAGGG - Intergenic
1109904156 13:68816485-68816507 GATTCTCCCTGAAAGCTTGAAGG - Intergenic
1111603089 13:90499776-90499798 GAATTCAGATGGAAGCTTAATGG + Intergenic
1114683671 14:24507669-24507691 GATTTCACCTGGGAGGTTATGGG - Intronic
1116088101 14:40267518-40267540 GTTCTCATCTGGAGGCTTGATGG + Intergenic
1116963271 14:50988903-50988925 GACTTCAAGGGGAAGCTTGATGG - Intronic
1117546104 14:56795802-56795824 GATTTCATCTGGGAGATTGGGGG + Intergenic
1117842819 14:59878931-59878953 TATTTCACCTTTATGCTTGAAGG + Intergenic
1121650189 14:95552535-95552557 AATTTCCCTTGGAAGCTTCATGG + Intergenic
1121945139 14:98113186-98113208 GACCTCACCTGGCATCTTGAAGG - Intergenic
1122599193 14:102912817-102912839 AATGTCAGCTGGAGGCTTGAGGG + Intergenic
1125529977 15:40406693-40406715 GGTTTCACTTGGAGGCTGGATGG + Intronic
1125800829 15:42445242-42445264 GATTTCACCTGGAAAGGTGGTGG - Intronic
1126806347 15:52353129-52353151 AATGTCACCTGGTAGCTTGTTGG - Intronic
1128224962 15:65995077-65995099 GATTTGATCTGGGATCTTGAAGG + Intronic
1128242879 15:66113396-66113418 GATTTCACCTGGAAGCTTGAGGG + Intronic
1129168961 15:73796399-73796421 GATTTCTCCTCGAGGCTAGAAGG - Intergenic
1130231262 15:82098983-82099005 GGTTTCTCAGGGAAGCTTGAGGG + Intergenic
1131225336 15:90620178-90620200 CAGTTCACCTGGCAGCTTAATGG + Intronic
1131323313 15:91419015-91419037 TATTTCTCCTTCAAGCTTGAAGG + Intergenic
1131545060 15:93308937-93308959 GATTTCATGTGGAGACTTGAGGG + Intergenic
1132949446 16:2552634-2552656 GATGGCACCTGGTAGCTTTAAGG + Intronic
1132964902 16:2647532-2647554 GATGGCACCTGGTAGCTTTAAGG - Intergenic
1133224311 16:4333340-4333362 GAGTTCAGCAGGAAGCCTGAGGG - Exonic
1133377016 16:5295490-5295512 GTTCTCATCTGGAGGCTTGACGG + Intergenic
1133918228 16:10128331-10128353 GACATCACTTGGAAGATTGAGGG - Intronic
1134783326 16:16918400-16918422 CATTCCATCTGGAGGCTTGAGGG + Intergenic
1138811693 16:60158439-60158461 GACTTCACCTGGAAGCTACATGG + Intergenic
1140266031 16:73421952-73421974 GATTTGTCCTGGAATCTTGTAGG - Intergenic
1140838700 16:78819181-78819203 CATTTCACCTGGGAACCTGATGG - Intronic
1143421040 17:6792516-6792538 GATTGGACCTGGAGGCCTGAAGG - Intronic
1144037417 17:11380012-11380034 GCTTTCATCTTGAGGCTTGAAGG - Intronic
1148564326 17:48624496-48624518 GATTCCACCTGGCAGGTTGGAGG + Intronic
1150588183 17:66537287-66537309 GATGTCAAGTGGAAGCTTGCAGG + Intronic
1150612448 17:66744807-66744829 GGTTTCTTCTGGAAGCTTTAGGG + Intronic
1151404463 17:73877730-73877752 GAACTCACCTGGCATCTTGAGGG - Intergenic
1155017858 18:21863394-21863416 GAGGTCACCTGGACACTTGAAGG + Intronic
1155545514 18:26910375-26910397 GATTTCCTTTGGAAGCTTGGCGG + Exonic
1157080996 18:44525110-44525132 GATTACACCTGGAAGAATGTTGG + Intergenic
1158307642 18:56124584-56124606 GATTTCACTTGGAAGAATGAGGG + Intergenic
1159079893 18:63725081-63725103 GATGTCACCTGGAAGTGTGGGGG + Intronic
1159112261 18:64073180-64073202 GATATCAAATGGAAGTTTGAAGG + Intergenic
1159915792 18:74186731-74186753 GATTCTCCCTGAAAGCTTGAAGG + Intergenic
1162454812 19:10777008-10777030 GATGTGACCTGGAAGTTTCAGGG + Intronic
1164427854 19:28158531-28158553 AAATTCACCTGGAAGCAAGAGGG + Intergenic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1164898671 19:31899475-31899497 GATTGCACCTGGGAGCTTCAAGG - Intergenic
1165263368 19:34639631-34639653 AATTTGACCTGTAAGCCTGATGG - Intronic
1167769790 19:51507998-51508020 GAGTTCACCAGGAAGCATGAAGG + Intergenic
924969950 2:116694-116716 GTCTTCACCTGGAATCTCGAGGG - Intergenic
925308720 2:2866935-2866957 TAATTCACCTGGAAGTTTGGTGG + Intergenic
925444164 2:3913428-3913450 GATTTTATCTGGAAGCCGGAAGG + Intergenic
926561155 2:14418962-14418984 GATTCCACCTGGAAGCTCCAGGG + Intergenic
927822388 2:26279301-26279323 CATTTCACCTGGTACTTTGAAGG - Exonic
928403742 2:30998247-30998269 GATTTCTCCTTGAAGCATGGTGG - Intronic
929709916 2:44256265-44256287 AATTTCAACCTGAAGCTTGAGGG + Intergenic
929830294 2:45341892-45341914 GTTTTCACCTAGAAGCCTGGAGG + Intergenic
932426382 2:71638008-71638030 GACATCACCTGGAACTTTGAAGG + Intronic
932472846 2:71974032-71974054 GATTTCAACTGCAAGCTTACAGG + Intergenic
936826924 2:116593127-116593149 TACTTCACATGAAAGCTTGAAGG - Intergenic
939708199 2:145481311-145481333 GATTTTACTTGGAAGACTGATGG - Intergenic
942702368 2:178727839-178727861 GGTTTCACTAGGAAGCTTGGTGG + Exonic
943022098 2:182587422-182587444 GGTTAGACCTGGAAGATTGATGG - Intergenic
944150389 2:196552357-196552379 GTTTTCTCCTGGAAGCTTTCTGG + Intronic
947443844 2:230148115-230148137 GGGATCACCTGGAGGCTTGATGG + Intergenic
948265227 2:236630995-236631017 GATTTGACCAGGAGGTTTGAAGG + Intergenic
1169245773 20:4023341-4023363 GATCTCACCTTGAAGCAAGAGGG + Intergenic
1170768447 20:19311666-19311688 GATTTCACCAGGGAGGATGATGG + Intronic
1173145747 20:40522629-40522651 GATTTCAGCTGAAACCATGAAGG + Intergenic
1175426889 20:58873358-58873380 GTTTTCACTTGGAACCATGATGG - Intronic
1178754851 21:35338863-35338885 TATTTCACCTGGATGCTTTATGG - Intronic
1180675860 22:17586108-17586130 GAGGTGACCTGGAAGCCTGAGGG + Intronic
951317971 3:21209466-21209488 TATTTCTCCTGGAAGGTGGAAGG - Intergenic
952473510 3:33681767-33681789 GATTTCAGCTTGAGGCTTGGAGG - Intronic
953302209 3:41789025-41789047 GACATCACCTAGAAGCTTGTTGG - Intronic
953732721 3:45464111-45464133 GATTTCACCTGTGAGCTTGTGGG + Intronic
955655371 3:61239899-61239921 TATATCACCTGGCAGCTTGTTGG + Intronic
955906515 3:63813571-63813593 GATTTAACTTGGAAGCCTGTTGG + Intergenic
956638249 3:71388396-71388418 CATTTCACCTGAAACCTAGAAGG - Intronic
958477996 3:94609509-94609531 GATTGCACCTGGAAGGACGAAGG + Intergenic
958506087 3:94978827-94978849 GATTTCCCATAGAAACTTGAAGG - Intergenic
959125504 3:102285747-102285769 GTTTTCTCCTGGAATCTTTATGG + Intronic
960255821 3:115510512-115510534 AACATCACCTGGAAGCTTGCTGG - Intergenic
960866702 3:122208994-122209016 CATTTCCCCTGAAACCTTGAGGG + Intronic
963353788 3:144184956-144184978 GGTTTCAGCTGGAGACTTGACGG - Intergenic
974890295 4:67873705-67873727 GACATCACCTGGGAGCTTGTTGG - Intronic
976780656 4:88755044-88755066 GACTTCACCTGGGACTTTGACGG - Intronic
977087160 4:92616211-92616233 GATTTCACCTTCAATTTTGAAGG + Intronic
978489361 4:109295353-109295375 AATTTAACATGGATGCTTGAAGG + Intronic
979203659 4:118008918-118008940 GGTTTCTCCTGGAGGCTTGGAGG - Intergenic
981085356 4:140677679-140677701 GATGTCAGGTAGAAGCTTGAGGG - Intronic
984952075 4:185015510-185015532 GATGTCACCTGGGTGCCTGAAGG + Intergenic
987117548 5:14737653-14737675 GCTTTCACGTGGAAGCGTGCAGG - Intronic
988812210 5:34796772-34796794 CAGTTCACCTGGGAACTTGAAGG + Intronic
988862327 5:35295267-35295289 AATTTCAACATGAAGCTTGAAGG + Intergenic
991164637 5:63550271-63550293 GACTGCACCTTAAAGCTTGAAGG + Intergenic
996388357 5:122933349-122933371 GTTTTCACCTGAATACTTGAGGG + Intronic
997696256 5:135863367-135863389 GATTGCACCTGGAAGCATCAGGG + Intronic
998785487 5:145704274-145704296 GGTTGCAGCTGGAAGCTGGATGG - Intronic
1000108061 5:158079595-158079617 GATTTCTCCATGAAGCTTGGGGG - Intergenic
1007051837 6:38839229-38839251 GATTTCTCCTGCTAGCCTGAGGG - Intronic
1007141366 6:39577956-39577978 GAATTCACCTCAAAGCATGAAGG - Intronic
1007428215 6:41760682-41760704 GATTTGAGCTGGAAGCCTGGGGG - Intergenic
1009374141 6:62946846-62946868 AAATTCAACTGGGAGCTTGAAGG - Intergenic
1013526536 6:110979695-110979717 CATTCCACCTGGAGGCTTCAGGG - Intergenic
1013605861 6:111747280-111747302 GATAATACCTGGAAGCTTCAAGG + Intronic
1013788430 6:113808928-113808950 AATATCACCTGGGAGCTTGTTGG + Intergenic
1015057998 6:128927658-128927680 GTTTACACCTGGAAGACTGATGG - Intronic
1016821371 6:148349344-148349366 GCTTGAACCTGGAAGGTTGAGGG - Intronic
1017864321 6:158429742-158429764 GATTTCACGTGGAGCCATGATGG + Exonic
1018248137 6:161841763-161841785 GATGTCACCTGGAAGATGGCAGG - Intronic
1018279834 6:162173191-162173213 AGTTTCAGCTGGAAGCTGGAGGG - Intronic
1018795391 6:167181386-167181408 GAGTTCACCTGGAAGCCTCCGGG + Intronic
1018820932 6:167373677-167373699 GAGTTCACCTGGAAGCCTCCGGG - Intronic
1019125478 6:169837821-169837843 GCTGTCTCCTGGAAGCTTCAGGG - Intergenic
1022151877 7:27616542-27616564 GATTGAGCCTGGAAGATTGAGGG - Intronic
1023257190 7:38323696-38323718 TGTTTCACCTGGAAACTGGATGG + Intergenic
1026626400 7:71996235-71996257 TATTTCATCTGGTAGCTTCATGG - Intronic
1027678752 7:81191993-81192015 GATTTGAACTGGAAGCTTAATGG + Intronic
1029007691 7:97227725-97227747 GGTTTTACCTGGGAGCATGATGG + Intergenic
1030201870 7:106914071-106914093 GGCTTCACCTGGGAGCTTGTTGG - Intergenic
1030896750 7:115070452-115070474 GCTCTTATCTGGAAGCTTGAGGG + Intergenic
1031720354 7:125167807-125167829 GATTGCACCTGTGAGGTTGAGGG - Intergenic
1032253828 7:130281264-130281286 GATTTCAACATGAGGCTTGAGGG + Intronic
1032494141 7:132348359-132348381 CATTTCTCCTGTATGCTTGAGGG + Intronic
1032663938 7:134016212-134016234 TATGTAAACTGGAAGCTTGAGGG + Intronic
1032943570 7:136823937-136823959 GAATCCACCTGAAAACTTGAAGG + Intergenic
1033393385 7:140950107-140950129 GAATTCACCTGGCAGCCAGATGG + Intergenic
1034399806 7:150854834-150854856 GATTTCACCTGGAAAGTCGGCGG - Intronic
1034523257 7:151637364-151637386 AATTTCACCTGTAATCGTGAGGG + Intronic
1041117227 8:54551692-54551714 GATTTTACCTGGAAACATTATGG + Intergenic
1041141810 8:54828271-54828293 GATTTCAACAGGAGGCTTGGTGG - Intergenic
1042135936 8:65633053-65633075 GGCCTCACCTGGAAGCTTGTTGG - Intronic
1045207745 8:100060183-100060205 TATTTTACCTGGGAACTTGAGGG - Intronic
1047063358 8:121252456-121252478 GTTTTCACCTGCAAGGTTGAAGG - Intergenic
1047982837 8:130201019-130201041 AATATCACCTGGAAACTTGTTGG + Intronic
1050281109 9:4050873-4050895 GATTTCACCTGCAGGTGTGAAGG - Intronic
1053122505 9:35557476-35557498 GATTTCACATGGCAACTTGAGGG + Intronic
1055951496 9:81733911-81733933 GGTTTCAGCTGACAGCTTGAAGG + Intergenic
1057012678 9:91619687-91619709 GGATTCACCTGGAAGCTAGAAGG - Intronic
1058284050 9:103153629-103153651 GATGTCAGCTGGAAGCTGGAGGG + Intergenic
1061182386 9:129032438-129032460 GAGGTCACCTGGACACTTGAAGG - Intergenic
1186178343 X:6948577-6948599 GGCTTCACCTGGGAGCTTGTTGG - Intergenic
1187118258 X:16375707-16375729 GGTGTCACCTGGAAACTTGTTGG - Intergenic
1189593032 X:42535838-42535860 CATTTCATCTGGCAGCTTTATGG - Intergenic
1189800270 X:44685457-44685479 GGTATCACCTGGGAGCTTGTTGG + Intergenic
1196916266 X:120538176-120538198 GCTTTCACCAGCAAACTTGAAGG - Exonic
1198093595 X:133356133-133356155 GATTTCAACATGAAACTTGAAGG - Intronic
1199725453 X:150575527-150575549 GGCATCACCTGGGAGCTTGATGG - Intronic