ID: 1128243477

View in Genome Browser
Species Human (GRCh38)
Location 15:66117331-66117353
Sequence TTTCCTGGTGGACCGTCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 52}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128243473_1128243477 2 Left 1128243473 15:66117306-66117328 CCTGAAAGTGGCTTTTTGAGCTT 0: 1
1: 0
2: 1
3: 19
4: 239
Right 1128243477 15:66117331-66117353 TTTCCTGGTGGACCGTCCTAGGG 0: 1
1: 0
2: 0
3: 6
4: 52
1128243468_1128243477 23 Left 1128243468 15:66117285-66117307 CCCCTCCTAGAAGTCTTTCATCC 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1128243477 15:66117331-66117353 TTTCCTGGTGGACCGTCCTAGGG 0: 1
1: 0
2: 0
3: 6
4: 52
1128243469_1128243477 22 Left 1128243469 15:66117286-66117308 CCCTCCTAGAAGTCTTTCATCCT 0: 1
1: 0
2: 2
3: 21
4: 222
Right 1128243477 15:66117331-66117353 TTTCCTGGTGGACCGTCCTAGGG 0: 1
1: 0
2: 0
3: 6
4: 52
1128243470_1128243477 21 Left 1128243470 15:66117287-66117309 CCTCCTAGAAGTCTTTCATCCTG 0: 1
1: 0
2: 2
3: 12
4: 166
Right 1128243477 15:66117331-66117353 TTTCCTGGTGGACCGTCCTAGGG 0: 1
1: 0
2: 0
3: 6
4: 52
1128243467_1128243477 28 Left 1128243467 15:66117280-66117302 CCTGTCCCCTCCTAGAAGTCTTT 0: 1
1: 0
2: 0
3: 19
4: 196
Right 1128243477 15:66117331-66117353 TTTCCTGGTGGACCGTCCTAGGG 0: 1
1: 0
2: 0
3: 6
4: 52
1128243471_1128243477 18 Left 1128243471 15:66117290-66117312 CCTAGAAGTCTTTCATCCTGAAA 0: 1
1: 0
2: 1
3: 36
4: 264
Right 1128243477 15:66117331-66117353 TTTCCTGGTGGACCGTCCTAGGG 0: 1
1: 0
2: 0
3: 6
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128243477 Original CRISPR TTTCCTGGTGGACCGTCCTA GGG Intronic
906253910 1:44332784-44332806 TTTCCTGGTGGTCCCTCATAAGG - Intronic
923002063 1:230014933-230014955 TTTCCTGGAGGACCTGCCTGAGG - Intergenic
1064296468 10:14083530-14083552 TTTCCTGCTGGAGGGGCCTAAGG - Intronic
1074945689 10:118278539-118278561 TTCCCTGCTTGACCCTCCTAAGG - Intergenic
1078247925 11:9593287-9593309 TTTCCTGGTGAATCTTCCTAGGG - Intronic
1086048909 11:82566027-82566049 TTTCCTAGTGGATCTGCCTATGG - Intergenic
1086712961 11:90031188-90031210 TTTCCTGGTGGACTGTACCCAGG + Exonic
1089567525 11:119379856-119379878 TTACCAGGTGAACCTTCCTAGGG + Intronic
1089592746 11:119555217-119555239 TTTCCTGGAGGACCATTCTGCGG + Intergenic
1108596564 13:51954936-51954958 TTTCCTTGTGGATGGTCCTTGGG - Intronic
1117854464 14:60013289-60013311 CTTCCTGATGGCCTGTCCTATGG - Intronic
1126477524 15:49081089-49081111 TCTCCTGGAGGACCTGCCTAAGG - Intergenic
1127910486 15:63412204-63412226 TTACCTGGTGCACACTCCTAAGG + Intergenic
1127964153 15:63911635-63911657 TTTCCTGGTGGGCCTTCAGAGGG - Intronic
1128243477 15:66117331-66117353 TTTCCTGGTGGACCGTCCTAGGG + Intronic
1129514050 15:76145836-76145858 TGTCCTGGTGGACAGTGCTGGGG + Intronic
1131444974 15:92491010-92491032 TTTCCAGGTGGCCCTTCCAATGG + Intronic
1134395490 16:13858776-13858798 CTTCCTGGTGCACTGTCCTGCGG - Intergenic
1135185410 16:20311258-20311280 GTTCCTGGTGGCCTGGCCTATGG - Exonic
1137254169 16:46761271-46761293 TTTCCTGGTCCACTGTCTTAAGG - Intronic
1140102269 16:71928076-71928098 TTTCCTCCTGGCCCGTCCCATGG + Exonic
1143703374 17:8678799-8678821 TTTCCTAGTGGACCAGCCTGGGG - Intergenic
1151476640 17:74347907-74347929 TGTCCTGGTGGACGGTCCAGGGG - Intronic
1152387968 17:79986516-79986538 TTTTCTGGTGGAAGGTCCTGGGG - Intronic
1152861861 17:82701029-82701051 TTTCCTGAGGGACAGTCCTGTGG + Intergenic
1163063421 19:14776107-14776129 TGTCCTGGGGGACCCTCCTCAGG + Intronic
1165682963 19:37793136-37793158 TTTCCTCCTGGCCCGTCCCATGG + Intronic
929749394 2:44694102-44694124 CGTCCTGGAGGACAGTCCTAAGG - Intronic
929957526 2:46470045-46470067 TTTCCTGGTAGACCTTTCCAAGG - Intronic
935726531 2:106028693-106028715 TTGCCTGGTGGAGCTTCCAAAGG + Intergenic
937953370 2:127405352-127405374 TTTCCTGGTGGAGTTTCCTGTGG + Intergenic
945400575 2:209377581-209377603 TTTCCTCGTGGAGGGTTCTAGGG - Intergenic
1173249522 20:41357283-41357305 CTTCCTGGTGGGCCATCCTGGGG + Intronic
1177907463 21:26989482-26989504 TTTCCTGATGGCCCGCCCTATGG - Intergenic
1178709877 21:34907148-34907170 TTTCCTGGTGTACAGTCTTTGGG + Intronic
1180143024 21:45904059-45904081 TCTCCTGGTTGAAGGTCCTAAGG + Intronic
960252877 3:115475989-115476011 TTTCCTGGTGTACTGTGCCAAGG + Intergenic
963654995 3:148036461-148036483 TTTCCTGGTGGTCCTTCCAACGG + Intergenic
970606339 4:17685590-17685612 TTTCCTGGTGAACCAACCCATGG + Intronic
974722025 4:65752586-65752608 TTTCCTGATGGCCTGTCCTACGG + Intergenic
982661283 4:158210159-158210181 TTTCCTGGTTGACCGACCCAGGG + Intronic
985733359 5:1563825-1563847 TTTCCTTGTGGAGGGTCCTCAGG + Intergenic
986925455 5:12743254-12743276 TTTCCCTGTGGACAGACCTAGGG - Intergenic
987328525 5:16834332-16834354 TTTCCTGGTGCACCGTGATGAGG + Intronic
1001267629 5:170286167-170286189 TTCCCTGAGGGATCGTCCTAAGG - Intronic
1006334320 6:33412501-33412523 ATTCCAGGTGGACAGTGCTAGGG + Exonic
1012663042 6:101928430-101928452 TATCCTGGTGGACAGTGCTTTGG - Exonic
1025030700 7:55554470-55554492 TTTCCTCGTGTACAGTCCTTGGG - Intronic
1033285561 7:140037945-140037967 GCTCCTGGTGGACAGTCCTGTGG + Intronic
1037603721 8:20420384-20420406 TTTCCTGGTGGTCTGTGCTGAGG + Intergenic
1037896023 8:22656492-22656514 TTTCCAGGTAGACAGTCTTAGGG + Intronic
1041927345 8:63250348-63250370 TTTGCTGGTCTACAGTCCTAAGG - Intergenic
1042192744 8:66204377-66204399 TTCCCAGGTGGACCCTCCTCTGG + Intergenic
1045847717 8:106657801-106657823 TTTCCTGATGGTCCGTCCCCGGG + Intronic
1046166991 8:110450004-110450026 TTTCCTGATGGCCTGTTCTATGG + Intergenic
1052440652 9:28492743-28492765 TTTCCTAGTGGACTGTATTATGG - Intronic
1054804485 9:69384707-69384729 TGTCCTGGTGGACAATCCTCTGG - Intronic
1192595247 X:72400154-72400176 TTTAATGTTGGACTGTCCTAGGG + Intronic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic