ID: 1128248479

View in Genome Browser
Species Human (GRCh38)
Location 15:66148965-66148987
Sequence CCTCAGTCTCCAGAGCTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3101
Summary {0: 1, 1: 0, 2: 5, 3: 144, 4: 2951}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128248470_1128248479 29 Left 1128248470 15:66148913-66148935 CCATTGAATAGTAAGAGGACTTT 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1128248479 15:66148965-66148987 CCTCAGTCTCCAGAGCTGTAAGG 0: 1
1: 0
2: 5
3: 144
4: 2951
1128248475_1128248479 -5 Left 1128248475 15:66148947-66148969 CCACCTCACCATTTGGGGCCTCA 0: 1
1: 0
2: 1
3: 23
4: 229
Right 1128248479 15:66148965-66148987 CCTCAGTCTCCAGAGCTGTAAGG 0: 1
1: 0
2: 5
3: 144
4: 2951
1128248476_1128248479 -8 Left 1128248476 15:66148950-66148972 CCTCACCATTTGGGGCCTCAGTC 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1128248479 15:66148965-66148987 CCTCAGTCTCCAGAGCTGTAAGG 0: 1
1: 0
2: 5
3: 144
4: 2951
1128248474_1128248479 -1 Left 1128248474 15:66148943-66148965 CCAACCACCTCACCATTTGGGGC 0: 1
1: 0
2: 1
3: 6
4: 112
Right 1128248479 15:66148965-66148987 CCTCAGTCTCCAGAGCTGTAAGG 0: 1
1: 0
2: 5
3: 144
4: 2951

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128248479 Original CRISPR CCTCAGTCTCCAGAGCTGTA AGG Intronic
Too many off-targets to display for this crispr