ID: 1128249484

View in Genome Browser
Species Human (GRCh38)
Location 15:66154422-66154444
Sequence TGGGCTCTTCGGAGCAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128249476_1128249484 16 Left 1128249476 15:66154383-66154405 CCCCGCAAGAGCCAAGGGGCTGC 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1128249484 15:66154422-66154444 TGGGCTCTTCGGAGCAGAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 174
1128249478_1128249484 14 Left 1128249478 15:66154385-66154407 CCGCAAGAGCCAAGGGGCTGCGA 0: 1
1: 0
2: 2
3: 12
4: 109
Right 1128249484 15:66154422-66154444 TGGGCTCTTCGGAGCAGAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 174
1128249479_1128249484 5 Left 1128249479 15:66154394-66154416 CCAAGGGGCTGCGAAATTAATCA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1128249484 15:66154422-66154444 TGGGCTCTTCGGAGCAGAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 174
1128249477_1128249484 15 Left 1128249477 15:66154384-66154406 CCCGCAAGAGCCAAGGGGCTGCG 0: 1
1: 0
2: 1
3: 18
4: 159
Right 1128249484 15:66154422-66154444 TGGGCTCTTCGGAGCAGAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128249484 Original CRISPR TGGGCTCTTCGGAGCAGAGA GGG Intronic
900654985 1:3752404-3752426 TGGGCTCCTGGGAGCAGTGGTGG - Exonic
900714098 1:4133123-4133145 TGGGCTCTGCGGCCCCGAGAAGG + Intergenic
900972383 1:5998722-5998744 TGGGCTCCCAGGAGCAGCGAGGG + Intronic
901033775 1:6323953-6323975 TGGCCTCTCCAGGGCAGAGACGG + Intronic
901399825 1:9008098-9008120 TCGGCAGTTGGGAGCAGAGATGG - Intronic
901660611 1:10796014-10796036 TGCGCTCTCCAGGGCAGAGAAGG - Intronic
901775837 1:11560073-11560095 TGGGGTCTTGGGCTCAGAGAGGG - Intergenic
902754186 1:18538195-18538217 TGAGCTCTCTGGAGCAGAGAAGG - Intergenic
902834684 1:19038900-19038922 TGGGAGCTTGGAAGCAGAGATGG + Intergenic
902918096 1:19650862-19650884 TGGGCTCTTCGGGGCTGGGCAGG + Intronic
903306487 1:22416773-22416795 TGGCCTCTGCGCAGCAGCGAGGG + Intergenic
904585406 1:31577117-31577139 TGGGCCCTGGGGGGCAGAGATGG - Exonic
904865914 1:33578743-33578765 TGGGGTCTTCCAGGCAGAGATGG + Intronic
905407199 1:37742074-37742096 TTATCTCTTCGGAGCTGAGATGG - Intronic
917077640 1:171221881-171221903 TGGGCAGTGCTGAGCAGAGATGG + Intergenic
920340650 1:205273215-205273237 TGGGCACTTCTAAGAAGAGAGGG + Exonic
923304419 1:232675107-232675129 GGTGCTCTTGGGAGCAGAGGCGG - Intergenic
1063009758 10:2011048-2011070 TGGGCTCTTGTCAGCAGTGAAGG + Intergenic
1065805968 10:29394215-29394237 TGGGCTCCTGAGAGGAGAGATGG - Intergenic
1065942815 10:30580357-30580379 TGGGCTCCTGAGAGGAGAGATGG + Intergenic
1067015796 10:42755533-42755555 TGGGTGCCTGGGAGCAGAGACGG + Intergenic
1070559230 10:77553380-77553402 GGGGCACTTGGGAGCTGAGAAGG + Intronic
1071708993 10:88030564-88030586 TGGGCCCTTGGGAGCATAAAAGG + Intergenic
1072316993 10:94212799-94212821 TGGGGTCTTTGGAGCAGAAAGGG + Intronic
1075328040 10:121550336-121550358 TGGGCTCTGGGGAGATGAGAGGG - Intronic
1075642715 10:124076315-124076337 TAGGCTCTTCAGAACAGACAGGG - Intronic
1075978330 10:126716165-126716187 AGGGCTCTCTGTAGCAGAGAAGG - Intergenic
1076392292 10:130111716-130111738 TGGGCTGTTTGGAGCAGTCAAGG - Intergenic
1077429418 11:2508618-2508640 TGGGCTTCTCAGAGCACAGAGGG + Intronic
1081629762 11:44681261-44681283 TGGGCTCCACGCAGCAGAGAGGG + Intergenic
1084172855 11:67409027-67409049 TGGGCACTGCAGAGCAGCGAGGG + Exonic
1084529392 11:69718071-69718093 TGGGCTCTGCTGAGCTGAGCTGG + Intergenic
1085534912 11:77211946-77211968 TGGGCTTCTCAGAGCAGAGGAGG + Intronic
1086160607 11:83718178-83718200 TGGGCAATTGGGAGTAGAGACGG + Intronic
1087423550 11:97963561-97963583 AAGGCTCTCTGGAGCAGAGAGGG + Intergenic
1088586976 11:111367924-111367946 TGGGGTCACCGGAGCAGAAAGGG + Intronic
1090170617 11:124600350-124600372 TGAGCTCCTCTGAGCATAGAAGG + Intergenic
1092069438 12:5620922-5620944 TGGCCTCTTGGTGGCAGAGAGGG - Intronic
1097069061 12:56341624-56341646 GGGGCTCTTCTGAGCAGAAATGG - Intronic
1102651940 12:114448412-114448434 TGGACACTGCGGAGCAGGGAGGG - Intergenic
1103054913 12:117811224-117811246 AGGGCTCTACGGGGCAGAGGAGG - Intronic
1103926375 12:124425705-124425727 GGGGCTGTGCAGAGCAGAGACGG - Intronic
1104421293 12:128637762-128637784 TGGGCTGTTTGTAGCAGAGCAGG - Intronic
1105709367 13:22991857-22991879 TGGGTCCTTCGGAGCACAGATGG - Intergenic
1109562830 13:64075772-64075794 TGTGCTCTTGGGAGCTGGGAGGG - Intergenic
1110862188 13:80355865-80355887 TGGGCGCCTCAGAGCAGGGATGG - Intergenic
1110910714 13:80959313-80959335 TGGTTTCTTGGGAGTAGAGAAGG - Intergenic
1112543109 13:100336745-100336767 TGGGCTCTTCAGTGAAGACATGG - Intronic
1113974916 13:114220336-114220358 TGGGCTCTGGAGAGCAGGGAAGG - Intergenic
1119520102 14:75278912-75278934 TGGGCGCTGTGGAGCAGAGCTGG - Exonic
1119647714 14:76360339-76360361 TTGGGTCTCCGGAGCAGAGCAGG + Intronic
1121110349 14:91308398-91308420 TGTGCTCTTAGAAGCACAGATGG - Exonic
1126141429 15:45442627-45442649 TGGGCTCTGGGGAACAGAGAAGG + Intronic
1127207692 15:56737487-56737509 TGGGCCCTTTGGAGAATAGATGG - Intronic
1127298797 15:57632747-57632769 GGGGCTATTCTGAGTAGAGACGG - Intronic
1127385631 15:58464324-58464346 TAGGCTCTTTGGAGCCGAGTTGG - Intronic
1128249484 15:66154422-66154444 TGGGCTCTTCGGAGCAGAGAGGG + Intronic
1128615275 15:69104090-69104112 TGTGATCTTCCGAGCAAAGAAGG - Intergenic
1133699448 16:8295436-8295458 TGGGCTCTGCTGAGTGGAGAGGG - Intergenic
1136695707 16:32079140-32079162 TGGGGTCGTCGGAGCTGGGAGGG + Intergenic
1139119897 16:64003433-64003455 AAAGCTCTTTGGAGCAGAGAGGG + Intergenic
1142031075 16:87838911-87838933 AGGGCTCTTGTGAGCACAGAGGG - Intronic
1142150549 16:88510746-88510768 AGGGCTCTTCTGAGCTGAGGTGG - Intronic
1143727731 17:8860897-8860919 TGGGCTCTTGAAAGCAGACACGG + Intronic
1146304939 17:31723657-31723679 GGGGCTCGTGGGAGCTGAGATGG - Intergenic
1146563604 17:33892919-33892941 GGGGCTCTTTGGAGCAAGGAGGG - Intronic
1151425893 17:74030868-74030890 TGGAGTCTTCTGGGCAGAGATGG - Intergenic
1151968168 17:77442939-77442961 TAGGCCCTTAGGAGCTGAGATGG + Intronic
1152238605 17:79150754-79150776 TGGGCACTTCCGAGAAAAGAGGG + Intronic
1152536616 17:80953784-80953806 TGGGCTCTTCTGGGCAGAAACGG + Intronic
1152667713 17:81580885-81580907 TGGGCCCTTCAGAGCTGAGCGGG - Intronic
1155127354 18:22891363-22891385 TGGGGTCGGGGGAGCAGAGAGGG + Intronic
1155540503 18:26863908-26863930 TTAGATCTTTGGAGCAGAGAAGG + Intronic
1160100607 18:75916597-75916619 CGGGCTCTACGGAGCAGCGCGGG + Intergenic
1160824214 19:1071797-1071819 TGGGGTCTTCGGTGCCGAAAGGG + Intronic
1161620610 19:5295050-5295072 TGGGCCCTCAGGAGCAGAGTAGG + Intronic
1161725159 19:5924378-5924400 TGGGCTCCTGGGAACGGAGATGG + Intronic
1161765513 19:6205793-6205815 TGGGTTCTTGTAAGCAGAGATGG + Intergenic
1165070688 19:33253422-33253444 TGGGTTCTTGGGAGCCAAGAAGG - Intergenic
1165297670 19:34940871-34940893 TGGGCTCTTTGGATTAGGGATGG - Intronic
1166546316 19:43636421-43636443 TGGGCTCTTCTGGGAAGAGGGGG - Intronic
926112689 2:10193024-10193046 GGGGCTGCTCAGAGCAGAGAAGG - Intronic
926311069 2:11676745-11676767 TGGCCTCTAGGAAGCAGAGAAGG - Intergenic
926972602 2:18481932-18481954 TGGGCTCTTAAGAACAGATAGGG + Intergenic
927154481 2:20213618-20213640 TGGGCTCTTTAGGGCAGACAGGG - Intronic
927897079 2:26789784-26789806 TAGGCTAGTGGGAGCAGAGATGG - Intronic
928114436 2:28537015-28537037 TGGGCTCTTCAGGAAAGAGAGGG + Intronic
930062122 2:47298902-47298924 TGGGCCCTTAGGAGAACAGATGG + Intergenic
930529302 2:52571387-52571409 TGGGCTCCTCGGAGTCGAGCGGG - Intergenic
932169192 2:69538325-69538347 TGGGCTGTTCAGTGCAGTGAAGG + Intronic
932705831 2:74024380-74024402 AGGGGTCTTGGGAGGAGAGAGGG + Intronic
934686601 2:96326027-96326049 TAGCCCCTTAGGAGCAGAGAGGG + Intronic
934937260 2:98474442-98474464 AGGGCTCTTCGTAGCACAGGTGG - Intronic
937619925 2:123973554-123973576 AGGGCTCTTCTGAGCAACGATGG + Intergenic
943846436 2:192655238-192655260 TGTGCTCTAAGGAGCAGACAAGG + Intergenic
946155393 2:217803620-217803642 TGGGGTCTTTGTAGAAGAGAAGG + Exonic
947668971 2:231925044-231925066 TGGGTTTGTGGGAGCAGAGAAGG - Intronic
948310534 2:236982324-236982346 TGGGCTCTGTGGTACAGAGATGG - Intergenic
948372958 2:237502324-237502346 TGGGCTCTTCTGGGGACAGAAGG - Intronic
1170773476 20:19354999-19355021 TGGCCTCTTAGCATCAGAGAAGG + Intronic
1170944834 20:20881775-20881797 AGGGCTCTTGGGAGCAAGGAAGG - Intergenic
1171422184 20:25024773-25024795 AGGGCTCTTAGGAGGAGAAAGGG - Intronic
1172704470 20:36872881-36872903 TGGGCTGTTGGGGGCAGAGCTGG + Intergenic
1172943453 20:38670533-38670555 TGGGCTCTGCTGAGCACCGATGG + Intergenic
1174104430 20:48152312-48152334 GGGGCTGTTCTGTGCAGAGAAGG + Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1178482722 21:32993661-32993683 TGCCCTCTGTGGAGCAGAGATGG - Intergenic
1178920748 21:36736600-36736622 GGGGCACCTCGGACCAGAGAAGG + Intronic
1179483444 21:41693333-41693355 TGGGATTTTAGGAGAAGAGAAGG + Intergenic
1181758887 22:25044081-25044103 TGGCCTCTTGGGAACAGACATGG - Intronic
1181830071 22:25553526-25553548 TAGCCTCTGAGGAGCAGAGAGGG - Intergenic
1182082198 22:27537559-27537581 GAGGCTCTTTGGAGGAGAGAAGG - Intergenic
1182981515 22:34675829-34675851 TGGGCACTCTGGAGCAAAGATGG - Intergenic
1185000556 22:48242847-48242869 TGAGCTTTTCGGAGCATGGATGG - Intergenic
1185142529 22:49110936-49110958 TGGGCACTGCGGAGGGGAGAGGG - Intergenic
953414018 3:42705317-42705339 TGGGCTCCTGGGAGCAGGGGAGG + Intronic
953627024 3:44579923-44579945 TTGGCTCTTCGGTGTGGAGACGG + Intronic
953748890 3:45594957-45594979 TGGGCTCTTCCGAGTGGACAAGG + Exonic
953885233 3:46711309-46711331 TGGGGTCTTAGGAGCAGTGAGGG + Intergenic
955870697 3:63435537-63435559 TGGGCTGGTTGAAGCAGAGAAGG + Intronic
956400455 3:68874045-68874067 TGGGATCCTAGAAGCAGAGAGGG - Intronic
957620571 3:82587711-82587733 TTGGCTCTACGGTTCAGAGAAGG + Intergenic
959499320 3:107087336-107087358 TAGGCCCTTCCTAGCAGAGAAGG - Intergenic
960993074 3:123324326-123324348 TGGGCTCTGTGGAGCAGACTGGG - Intronic
961007404 3:123414191-123414213 TGTCCACTTGGGAGCAGAGAAGG - Intronic
968004176 3:195228181-195228203 TGGGCTCTTCGGAGTTGATGAGG - Intronic
968540778 4:1167316-1167338 AGGGCCCTTCAGTGCAGAGATGG + Exonic
969308774 4:6340218-6340240 TGGGCTCTTGTGTGCAAAGATGG - Intronic
969703914 4:8781894-8781916 TGGGCGCTGCGGGGCAGAGGTGG + Intergenic
970987946 4:22179778-22179800 TGGGATTTTTGGAGCAGAGCTGG + Intergenic
975109974 4:70612147-70612169 TGGGCTCTTCTGAGTAGAAAAGG + Intergenic
980140048 4:128904538-128904560 TGGGCACTCAGGAGAAGAGAGGG - Intronic
983068850 4:163245373-163245395 TGGGCTCTTAGGAGAATAAATGG - Intergenic
984917029 4:184734107-184734129 TTGGCTGTTCGGAGCGGCGAGGG - Exonic
985141117 4:186841069-186841091 TGGGTTCCTCGGGGCAGTGAGGG - Intergenic
986213925 5:5700090-5700112 TGGGGTATTTGGGGCAGAGATGG - Intergenic
986405734 5:7423254-7423276 CTGGCTCTTTGGAGCAGAGGAGG + Intronic
988470811 5:31535823-31535845 TGGGCTCAGCAGATCAGAGAGGG + Exonic
996707921 5:126515557-126515579 TGGGCCCTTGGGAGAATAGATGG - Intergenic
997622746 5:135309469-135309491 TGTGCTCTTTGGATCAGAGGGGG + Intronic
997757663 5:136414946-136414968 TGGGCACTTAGGGGCAGACAGGG + Intergenic
1000325147 5:160166380-160166402 TGGGCCCTTAGGAGAATAGATGG - Intergenic
1006625164 6:35392562-35392584 TGGGTTCCTCGGGGGAGAGAGGG + Intronic
1006680065 6:35790637-35790659 TGGGCCCTTAGGAGAAAAGATGG + Intronic
1007376793 6:41462478-41462500 TGAGCTCTGGGAAGCAGAGAAGG - Intergenic
1007566145 6:42852123-42852145 TGTGGTCTTGGGAGCAGAAATGG - Exonic
1010833377 6:80557203-80557225 TGGGCTCTGATGGGCAGAGAAGG + Intergenic
1013211415 6:107990242-107990264 AGAGCTCTTTGCAGCAGAGAGGG - Intergenic
1015072402 6:129110876-129110898 TGGGTTTTTCCGAGTAGAGATGG - Intronic
1017738342 6:157382461-157382483 TGGGCTTCTGGGAGCAGGGAGGG + Intronic
1017771233 6:157645952-157645974 TGAGCCCTTGGGAACAGAGACGG + Intronic
1019053270 6:169200955-169200977 TGGCCTCTCAGGAGCAGAGTGGG - Intergenic
1019893025 7:3962306-3962328 AGGGCACTGCAGAGCAGAGAGGG + Intronic
1020649765 7:10860141-10860163 TGGGGACTTCTGAGCTGAGATGG + Intergenic
1021848247 7:24783560-24783582 TGAGGTGTTTGGAGCAGAGAAGG + Intergenic
1022947085 7:35297264-35297286 TGGGGACTAAGGAGCAGAGAGGG - Intergenic
1026118717 7:67518203-67518225 TGGGCACTTCAGACCAGAGCTGG + Intergenic
1033492967 7:141862517-141862539 CTGGCTGTTCAGAGCAGAGAGGG + Intergenic
1033651346 7:143346178-143346200 TGGGCTCTTCTGGGGACAGAGGG - Exonic
1034392980 7:150800619-150800641 TGGGCTCTGGGGAGCTGGGAGGG - Exonic
1038219592 8:25594745-25594767 TGGGCTTGTGGAAGCAGAGAGGG - Intergenic
1042238589 8:66639939-66639961 TGGGCCTTTCGGAGCATAGAGGG + Intronic
1045692281 8:104772292-104772314 TGGGCCCTTGGGAGAATAGATGG - Intronic
1047312630 8:123705432-123705454 TGGGCTGCTCTGTGCAGAGATGG - Intronic
1048303439 8:133267481-133267503 TGGGCCCTGAGGGGCAGAGAGGG - Intronic
1051208522 9:14715433-14715455 TGGGCTCTGGGAATCAGAGAGGG + Intergenic
1056953963 9:91067680-91067702 TGGTCTTTTAGCAGCAGAGATGG - Intergenic
1059420444 9:114187198-114187220 TGGGCACTTGAGATCAGAGATGG + Intronic
1059622282 9:116020146-116020168 TAGGCTCTTGGGAGCTTAGAGGG - Intergenic
1059646280 9:116271308-116271330 TGGTCTCTGCAGAGCAGATATGG - Exonic
1060999885 9:127897130-127897152 TGGGGTGTGCGGAGCAGAGCTGG - Intronic
1061048312 9:128179402-128179424 TGGGCTCTTCTGAGCTAGGAAGG + Exonic
1061674136 9:132206180-132206202 TGGGCTCTTAGGAGCGCAAAGGG + Intronic
1061716474 9:132521463-132521485 TGAGCTCCACGGAGCAGGGATGG - Intronic
1061817031 9:133203727-133203749 AGGGCTCTCGGGAGCAGAAATGG + Intergenic
1062518405 9:136947288-136947310 TGGCCTCTTCCGAGCCGAGCTGG + Intronic
1062732065 9:138115606-138115628 CGGGCTCCTCGGAGCACAGCCGG - Exonic
1187266415 X:17737752-17737774 GGGGCTCTCCTGAGGAGAGAGGG + Intronic
1187701375 X:21967348-21967370 TGGTCACTTATGAGCAGAGAGGG + Intronic
1189225651 X:39411192-39411214 TGGGGGCTTTGGAGCTGAGATGG + Intergenic
1193468828 X:81875843-81875865 TGTGCTCTTGGGAGCCCAGAAGG - Intergenic
1195881972 X:109601844-109601866 TGGCATATTCTGAGCAGAGATGG - Intergenic
1197569112 X:128127657-128127679 TGAGCTCTTTGTAGCAGGGAGGG - Intergenic
1198481815 X:137048122-137048144 TGGGCTGTTTGGATCAGAAATGG + Intergenic
1198531310 X:137551295-137551317 TGGGGTGTGTGGAGCAGAGAGGG - Intergenic
1199390124 X:147269437-147269459 TAGGCTCTTCTGTGCAGAGAGGG - Intergenic